{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:25678762", "kind": "science-record", "revision": 8, "content_hash": "sha256:b1b37529a04e8f1d966b6fc2006efc8bab02d777efdcc8e934b1e70ae4c0d1b4", "created_at": "2026-11-01T15:40:07Z", "updated_at": "2026-11-01T22:42:11Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "partial", "title": "Gene expression changes during retinal development and rod specification.", "doi": null, "pmid": "25678762", "authors": ["Fiona C Mansergh", "Matthew Carrigan", "Karsten Hokamp", "G Jane Farrar"], "journal": "Molecular vision", "year": 2015, "abstract": "PURPOSE: Retinitis pigmentosa (RP) typically results from individual mutations in any one of >70 genes that cause rod photoreceptor cells to degenerate prematurely, eventually resulting in blindness. Gene therapies targeting individual RP genes have shown efficacy at clinical trial; however, these therapies require the surviving photoreceptor cells to be viable and functional, and may be economically feasible for only the more commonly mutated genes. An alternative potential treatment strategy, particularly for late stage disease, may involve stem cell transplants into the photoreceptor layer of the retina. Rod progenitors from postnatal mouse retinas can be transplanted and can form photoreceptors in recipient adult retinas; optimal numbers of transplantable cells are obtained from postnatal day 3-5 (P3-5) retinas. These cells can also be expanded in culture; however, this results in the loss of photoreceptor potential. Gene expression differences between postnatal retinas, cultured retinal progenitor cells (RPCs), and rod photoreceptor precursors were investigated to identify gene expression patterns involved in the specification of rod photoreceptors.\nMETHODS: Microarrays were used to investigate differences in gene expression between cultured RPCs that have lost photoreceptor potential, P1 retinas, and fresh P5 retinas that contain significant numbers of transplantable photoreceptors. Additionally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photoreceptor precursors were compared with Rho-eGFP-negative cells from the same P5 retinas. Differential expression was confirmed with quantitative polymerase chain reaction (q-PCR).\nRESULTS: Analysis of the microarray data sets, including the use of t-distributed stochastic neighbor embedding (t-SNE) to identify expression pattern neighbors of key photoreceptor specific genes, resulted in the identification of 636 genes differentially regulated during rod specification. Forty-four of these genes when mutated have previously been found to cause retinal disease. Although gene function in other tissues may be known, the retinal function of approximately 61% of the gene list is as yet undetermined. Many of these genes' promoters contain binding sites for the key photoreceptor transcription factors Crx and Nr2e3; moreover, the genomic clustering of differentially regulated genes appears to be non-random.\nCONCLUSIONS: This study aids in understanding gene expression differences between rod photoreceptor progenitors versus cultured RPCs that have lost photoreceptor potential. The results provide insights into rod photoreceptor development and should expedite the development of cell-based treatments for RP. Furthermore, the data set includes a large number of retinopathy genes; less-well-characterized genes within this data set are a resource for those seeking to identify novel retinopathy genes in patients with RP (GEO accession: GSE59201).", "claims": [{"id": "claim-method", "statement": "Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:25678762", "locator": "sections[10] \"Expression analysis\" paragraph 2", "quote": "Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:25678762", "locator": "sections[15] \"GEO\" paragraph 2", "quote": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201."}], "state": "complete"}], "gaps": ["doi"]}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:25678762"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE59201"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE59201"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:25678762", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": null, "sha256": "sha256:effb194f3ca02841f02f9ee686a64342aa68bb5c3e21fa25b5e230801872b293", "bytes": 56748, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "25678762", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC4301594", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE59201", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE59201", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE59201", "version": null, "note": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1430377", "GSM1430378", "GSM1430379", "GSM1430380", "GSM1430381", "GSM1430382", "GSM1430383", "GSM1430384", "GSM1430385", "GSM1430386", "GSM1430387", "GSM1430388", "GSM1430389", "GSM1430390", "GSM1430391", "GSM1430392", "GSM1430393", "GSM1430394", "GSM1430395", "GSM1430396"], "sample_count": 20, "group_sizes": null, "group_sizes_basis": null, "platform": "8321", "taxon": "Mus musculus", "title": "Gene expression changes during retinal development and rod specification.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:25678762:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:129b13c30fad22bbaeb705e501606a4956a9b27c349e91412fd7bb2916eaf0b7", "bytes": 3317, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#t1", "version": null, "note": "Primer sequences for primers used in q-PCR.", "structure": {"pmcid": "PMC4301594", "section_index": 16, "section_title": "Q-PCR", "row_count": 47, "column_count": 4}, "table": {"label": "Table 1", "caption": "Primer sequences for primers used in q-PCR.", "rows": [["Primer name", "Sequence", "Primer name", "Sequence"], ["A530058N18RikR:", "CCACCTTGACACAGGCTGGA", "Lrp4F", "TTCCAGTGCTGGTGTGAAGC"], ["A530058N18RikF:", "CCGCAGGAGGAACAGACACA", "Lrp4R", "CGGTGATGAAAGTCGAGGGC"], ["Arr3F", "CTGGATGGCAAACTCAAGCA", "MitfF", "GATGGACGATGCCCTCTCAC"], ["Arr3R", "AGGAGATGGCTTTGGATGGA", "MitfR", "CTGGGCTACTGATAAAGCACGAA"], ["B9d1F", "GTACGGCAAGCACTGGTGTG", "Neurog2F", "GCAGCGCATCAAGAAGACCC"], ["B9d1R", "GAGAGAGGGGCACATGCACT", "Neurog2R", "GTAATTGTGGGCGAAGCGCA"], ["BC022687F", "AGGGTCATGTCCTGGAAGGT", "NfiaF", "TCACCGACCTACTCGACACC"], ["BC022687R", "AGGTAATCAGGCTGCCCTGT", "NfiaR", "GGTTGAGGTTGCGTCCATGT"], ["BC027072F", "GTCCCGCTCAGACTGGGAAT", "Nr2e3F", "TTGGGAAATTGCTCCTCCTG"], ["BC027072R", "CCCTGCAGTTCTGGGACTCT", "Nr2e3R", "CCTGTGGACACTTGGCACTC"], ["B-actin F", "CCACCATGTACCCAGGCATT", "Nr6a1F", "TCCTGCTCTCCTCCCTCACA"], ["B-actin R", "ACAGTGAGGCCAGGATGGAG", "Nr6a1R", "GCATGCGTACTCCTCGTTGC"], ["Bin1F", "GGCGATGTGGTGTTGGTGAT", "NrlF", "ATGCAAGTGGATTGGAGGAG"], ["Bin1R", "TCTTCACACTCGGGAAGGCT", "NrlR", "CATGGCAACTGTGAGACCTG"], ["Cdk2ap2F", "TCCCTACAGCCGGGAGTGTC", "NsfF", "TCCCTGCAGATGGATCCTGA"], ["Cdk2ap2R", "ACAGCAGGTCCGTGTAGGTG", "NsfR", "CATCTGCACCTTGGTCGCTT"], ["Chx10F:", "AAGGAGCCATGTTGGACTGA", "Otx2F", "GGTCCATCAACCAGCAACCT"], ["Chx10R:", "GCCTGGGAATACAGGAGCAG", "Otx2R", "ACACCGGATCACCTCTGCTT"], ["Cnga1F", "TTGGGAGAAAGAGTCGTCTG", "Pax6F", "GAGAAATGGCGGTTAGAAGCA"], ["Cnga1R", "GAACATCGGTGGGGAAGAAA", "Pax6R", "CAACCACATGAGCAACACAGA"], ["CrxF", "TCTTCCGTAAAGGTGCTGAGA", "Plagl1F", "CGAAGGCTGAGTGTGGCAAA"], ["CrxR", "TGCTGGGATTATGACCATTGA", "Plagl1R", "TCGTCACACGCGTAGGAGAT"], ["Dleu2F", "CTGGAGAGCTCGCCCAGAC", "Ppargc1aF", "TACACCTGTGACGCTTTCGC"], ["Dleu2R", "CCAATGCATTACATGGGCATTCA", "Ppargc1aR", "TCTTGGTGGAAGCAGGGTCA"], ["Eno2F", "AGGAGTTCATGATCCTCCCAGT", "PtgdsF", "GCATCCACTCCGTGTCAGTG"], ["Eno2R", "TGGCTTCCTTCACCAGCTCC", "PtgdsR", "CTGGGCCTTGCTAAAGGTGG"], ["Epb4.1l2F", "GTCGGTCACAAGGGTGGTAG", "RhoF", "CTGAGGGCATGCAATGTTCA"], ["Epb4.1l2R", "TGGAGTAGTGGTACGGCGTT", "RhoR", "CATAGCAGAAGAAGATGACG"], ["Fgf9F", "GAAAGACCACAGCCGCTTCG", "RtbdnF", "TGGAGAGAGAGGCTGTGAGC"], ["Fgf9R", "AGAGGTTGGAAGAGTAGGTGTTGT", "RtbdnR", "TGGAGACGTTGAGGCAGTGA"], ["Fgf13F", "CTACCGTCAGCAGCAATCCG", "SamD11F", "CTAGGGCCTGCCCTCAAGAT"], ["Fgf13R", "CCAGATCGGGAGAACTCCGT", "SamD11R", "CCTTCATACGGGGAGGTGGT"], ["Fgf15F", "GCGGACGGCAAGATATACGG", "Sema7aF", "GGCTTCTGCTGGTGTTCTGG"], ["Fgf15R", "TCCTGGAGCTGTTCTCTGGG", "Sema7aR", "CGGCTCATGGAAAAGCACGG"], ["Foxo1F", "GCCACTCGCGGGACAG", "Shisa2F", "CAGACCGAGAAGGCCCAGA"], ["Foxo1R", "AGTAGGGCACGCTCTTCACC", "Shisa2R", "TCTGCTGGGGATCCTGCTTT"], ["Glo1F", "TGGGATTGCCGTTCCTGATG", "Slc25a33F", "CTCCTGCATCGCTTACCCAC"], ["Glo1R", "CCTCAAAGGCACATTCTCCCG", "Slc25a33R", "CAGTCCTCGGTAGAAGGCGA"], ["Igsf9F", "GGCCAGGGTCAGGTGCAA", "Sox2F", "CTAGACTCCGGGCGATGAAA"], ["Igsf9R", "AGTTGACTGTACTGTTGCTGGG", "Sox2R", "TGCCTTAAACAAGACCACGAA"], ["Kcnk1F", "CGTGTTCTCTGTGCTGGAGG", "Stx3F", "GGATGAAGGACCGGCTGGAG"], ["Kcnk1R", "CAACCAGCATGGCGATGAGT", "Stx3R", "AGCCGTGTTTCCTCGATCTCA"], ["Kif9F", "CATGACAGGGGCAACGGAGA", "Vopp1F", "GCCACCACTCATTGAGGAGC"], ["Kif9R:", "AGGGCAGAGTGGACAGGAGA", "Vopp1R", "GCCTCCGTGAGGTGAATTGG"], ["Klc3F", "AACAACCTGGCCTCAGCCTA", "Vsx2F", "CTGTGCCCCATGGCTACTG"], ["Klc3R", "TCCTCGCCTGATGGATTCCC", "Vsx2R", "CCGTTCCTCCTGCTCCATCT"]], "row_count": 47, "column_count": 4, "numeric_cells": 18, "header_rows": 1, "locator": "section[16]/table-wrap[1]#t1"}}, {"id": "asset:table:pmid:25678762:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9d59f734d61fd19f508e938af78e24ff97a147f0aa8c3eede629b043fe4474f0", "bytes": 3424, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t2", "version": null, "note": "Genes upregulated in rods, as determined by upregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 42, "column_count": 6}, "table": {"label": "Table 2", "caption": "Genes upregulated in rods, as determined by upregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "rows": [["Upregulated genes.", "", "Upregulated + Neighbours", ""], ["0610010O12Rik", "Epn2", "Pax7", "Abcg4 [32]", "Lztfl1", "Samd11 [31,35]"], ["Abhd5", "Eps8 [32]", "Pcdh15 [16,32,38,42]", "Acsl1", "Mak [31,34,35]", "Sec14l2 [34]"], ["Abhd14b", "Fam107b", "Pias3 [31,34]", "Agtpbp1 [31,32]", "Mdm1", "Sema7a [16]"], ["Acadvl", "Fam60a", "Pip4k2c", "Aipl1 [35-38]", "Mpp4 [32,35]", "Shisa2 [42]"], ["Aco2 [31]", "Galnt4", "Pla2g5", "Amy1", "Mrpl49 [31]", "Slc12a5"], ["Ahr [37]", "Galt", "Pla2r1 [16,32,42]", "Ankrd33 [31,37]", "Mtfp1", "Slc19a1"], ["Akap1 [31]", "Gdpd5", "Plagl2 [32],", "Arl6 [38],", "Mthfr", "Slc25a33"], ["Aldoc", "Glmn [31]", "Plekha2 [16]", "Bbs9 [16,32,38],", "Ndrg1 [31,37]", "Slc27a2"], ["Alpl", "Hif1a [32]", "Plekhf2", "BC027072 [35],", "Nr2e3 [31,34-36,38,40]", "Snap25 [16,31,36,38]"], ["Apobec2", "Hsp90aa1 [31]", "Plxna2", "C1ql3", "Nrl [31]", "Spint2"], ["Arhgap24", "Hspa41 [31]", "Ppargc1a", "Cdhr1 [34]", "Nsf", "St6galnac2"], ["Arl4a", "Htra1 [38]", "Ppargc1b [32]", "Cdk5r2", "Nxnl2 [35]", "Stx3 [31,42]"], ["BC022687", "Ift80", "Ppp2r5c", "Cep290 [38]", "Pdc 31 [30,36,38]", "Stxbp1 [31]"], ["Bcar3", "Ift88 [31]", "Prr14", "Chga [31]", "Pde6b [16,30,31,34-38,40]"], ["Bicd2", "Laptm4b", "Rbpms", "Ckmt1 [32]", "Pde6g [16,31,32,34-36,38,40]"], ["Bin1 [33]", "Lass4 [31]", "Reep6 [36,40]", "Clstn1 [16,42]", "Pitpnm1 [31]", "Syngr1"], ["C1qtnf4", "Lmo1", "Rpl31", "Cnga1 [16,34,36,38,40,42]", "Podxl [16,31,34,42]"], ["Cadm1", "Lrp4 [16,34,42]", "Scamp5", "Cplx3", "Ppef2", "Sys1"], ["Camk1d [31]", "Madd", "Sh3bgrl2", "Crx [33,35,38,40]", "Prickle1 [31]", "Tbc1d8 [34]"], ["Camkk1", "Map4k3 [31]", "Slc25a5 [31],", "Crxos1 [39]", "Prkab1 [31,32]", "Tob2"], ["Capn7", "Mat2a [31]", "Slc44a1", "Dalrd3", "Prom1 [16,31,34,38,40,42]", "Ttc8 [16,38,40]"], ["Ccdc72", "Me1", "Slc4a7", "Doc2b [31]", "Ptp4a3 [16,31]", "Tub [31,32]"], ["Ccng1 [31]", "Med16", "Snca [16]", "Elovl4 [31,38]", "Ptpn21 [31,32]", "Tulp1 [31,33,35,38,40]"], ["Cd276", "Mef2d [31,33]", "Snrk [31]", "Eml3", "Rab28 [16,31]", "Uckl1 [32]"], ["Cdh13 [16],", "Mlf1", "Ssx2ip [31]", "Eml5", "Rbp3 [31,34-36,38-41]"], ["Cdk2ap2", "Mmd", "Strbp", "Eno2 [16,31]", "Rcvrn [16,31,36,37]"], ["Cltb//LOC100046457", "Mtap7", "Sugp2", "Flcn", "Rd3 Sie [32]", "Unc119 [31,32,36,38,40]"], ["Cngb1 [35,36],", "Mtch2", "Supt16h", "Frmd4b [31]", "Rdh12 [32,34,35,38,40]"], ["Cngb3 [16,32,36,38,40,42],", "Mtfr1 [16]", "Suv39h2", "Gnat1 [31,32,36-38,40]", "Rho [16,30-32,34-38,40,42]"], ["Cnnm2", "Mylk [31]", "Syp [31,36,38]", "Gnb3 [31,32,36]", "Rhpn1", "Vldlr [31]"], ["Cpt1a", "Myo6", "Tdrd7 [31]", "Gngt1 [16,31,34-36]", "Rom1 [31,35-38,40]"], ["Crnkl1", "Naaa", "Tle2", "Gulo [36,40]", "Rp1", "Vopp1"], ["Cst3 [31]", "Nap1l1", "Tmem135", "Hcn1 [38]", "Rpgr [32]", "Zranb1"], ["Ctbp2 [31]", "Napg", "Tmem216", "Icmt [31]", "Rpgrip1 [31, 32, 34, 38-40]"], ["Dctn1 [31]", "Nfic [37]", "Tmem30a [31]", "Impdh1 [32,38]", "Rraga", ""], ["Dhrs3", "Npnt", "Tmem42", "Kcnb1 [31,37]", "Rs1 [31,32,34,35,38,40]"], ["Dlg4 [16,37]", "Nt5e [16,34]", "Tmem9 [31]", "Klc3 [31]", "Rtbdn", ""], ["Dnm1", "Nxnl1 [40]", "Tpp1", "Krt18", "Rxrg [30]", ""], ["Dnmt3a [31]", "Oat [38,40]", "Trim3", "Llgl2 [34]", "Sag [31,34-36,38,40]"], ["Ebpl", "Osgep [40]", "Uqcr11", "Lpgat1 [31,37]", "", ""], ["Epb4.1l2 [31]", "Paqr4", "Vamp2", "Lrrc48", "", ""]], "row_count": 42, "column_count": 6, "numeric_cells": 148, "header_rows": 1, "locator": "section[17]/table-wrap[1]#t2"}}, {"id": "asset:table:pmid:25678762:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:00d7c59b9ba3f333b473cf34e19834ea737e132226e9578ece17e6ba9d40aeea", "bytes": 2732, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[2]#t3", "version": null, "note": "Genes downregulated in rods, as determined by downregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 49, "column_count": 5}, "table": {"label": "Table 3", "caption": "Genes downregulated in rods, as determined by downregulation in FACSed Rho-eGFP positive cells and expression changes in at least 2/3 other comparisons (RPC versus pn1, RPC versus pn5, pn1 versus pn5).", "rows": [["Downregulated genes.", "", "", ""], ["1110002B05Rik", "Dbn1", "Itgb1", "Pip4k2a", "Spred1"], ["1190002N15Rik", "Dkk3 [31]", "Itm2c", "Pkia [31]", "Srgap3"], ["2700094K13Rik", "Dpysl4", "Kcnmb4", "Plagl1 [37]", "Sri [32]"], ["41160", "Dpysl5", "Kctd17", "Ppap2b", "St14"], ["6330527O06Rik [31]", "Ebf1", "Kdr", "Ppic", "St6galnac5"], ["Abcd2 [39]", "Epdr1", "Khdrbs3", "Ppp1r14b [31]", "St8sia2"], ["Adam12", "Epha3", "Klhl13", "Pros1", "Stmn2"], ["Agap1", "Evl", "Laptm4a", "Ptgds", "Stmn4"], ["Aif1l", "F2r", "Ldb1 [32]", "Ptn", "Sulf2"], ["Aldh2", "Fads1", "Lgr5", "Ptprk", "Tcf7l1"], ["Ank3 [32]", "Fam19a5", "Limk1", "Ptprz1", "Tcf7l2"], ["Ankrd43", "Fbxw7", "Litaf [31]", "Qk", "Tcfap2a"], ["Anxa5", "Fezf2", "Lrp1", "Rab31", "Tcfap2b"], ["Arhgdia", "Fgf13", "Lrrn1", "Rai14", "Tcfap2c"], ["Arrb1", "Fgf15", "Magt1", "Rap2b", "Tiam1"], ["Ass1", "Fgf9", "Map4k4 [31]", "Rftn2", "Timp2 [31]"], ["Astn1", "Fgfr1", "Mapk6 [31]", "Rgl1", "Tmeff2"], ["Atp2b2", "Fgfrl1 LOC100046239", "Marveld1", "Rgs2", "Tmem43"], ["Auts2 [32]", "Fjx1", "Mdk", "Rnasel [31]", "Tmtc4"], ["B2m", "Fkbp7", "Mfge8", "Rnd3", "Tnfrsf21"], ["Basp1 LOC100045716", "Fkbp9", "Mllt11", "Rrh", "Tor1aip2"], ["Bcl11a", "Foxn4", "Mmp2", "Rrm2", "Tpbg"], ["Bhlhe22", "Ftl1/2/Gm10116", "Mpp3", "Rsu1", "Traf4"], ["Cadps [31]", "Fuca1", "Msn", "Rtn4 [31]", "Tspan14"], ["Capn2", "Fyn", "Mt1", "Sash1", "Vim"], ["Cartpt", "Gad2", "Mtap6", "Sat1 [31]", "Ywhag [37]"], ["Cat", "Gm3932", "Myadm", "Scd2 [37]", "Zbtb12"], ["Cbx2", "Gng3", "Myb [30,37]", "Sema4d", ""], ["Ccng2 [31]", "Gp1bb", "Ncan", "Sepp1", "Downregulated"], ["Cd151 [39]", "Gpc1 [31]", "Ndrg4", "Serpine2", "+ Neighbours"], ["Cd9", "Gpc3", "Neurod4 [30,33,37]", "Serping1", "Cmtm7"], ["Cdc42se1", "Gpr37 [31]", "Nfia", "Serpinh1", "Darc"], ["Cfl1 [30]", "Gpr56", "Nfib [35]", "Serpini1", "Ebf3"], ["Chn2", "Gprc5c", "Nfix [31,35]", "Sfxn1", "Efnb2 [37]"], ["Chodl", "Grb10", "Ngfr", "Sgk3", "Elavl3"], ["Cnot2 [35]", "Grn", "Nhsl1", "Sh3bp4", "Hmx1"], ["Cntnap2 [32]", "Gstm1", "Nme2", "Six3", "Kcnk1"], ["Col18a1", "H19 [35]", "Notch2", "Skap2", "Kif5c [32]"], ["Col2a1 [38,40]", "H2afy2", "Npc2", "Slc1a3", "Klc1, LOC100047609"], ["Crabp1", "Hbb-b1/Hbb-b2", "Olfm1 [32]", "Slc1a4", "Meg3"], ["Crmp1", "Hkdc1", "Olig2", "Slc32a1", "Pmepa1"], ["Crym [41]", "Hmgb2 [37]", "Pak1", "Smad2", "Rian"], ["Csnk1e", "Ier5", "Pax6 [30,31]", "Smarce1", "Stmn1"], ["Csrp1 [37]", "Igfbp2", "Pbxip1", "Socs2", "Tbx2"], ["Ctsc", "Il17ra", "Pcp4", "Sox5", "Vsx2"], ["Cyp26a1", "Ina", "Pcyox1", "Sox6", "Zfp532"], ["Dag1", "Isl1 [31,37]", "Pdlim5", "Sparc [31]", ""], ["Dbi", "Itgav", "Phlpp1", "Spc25", ""]], "row_count": 49, "column_count": 5, "numeric_cells": 77, "header_rows": 1, "locator": "section[17]/table-wrap[2]#t3"}}, {"id": "asset:table:pmid:25678762:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2be9781585e10bfd5457f8e3020c94f717bb18d545ea8dc76f3012c1aa40b667", "bytes": 1761, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[3]#t4", "version": null, "note": "Genes differentially regulated in all comparisons of RPC versus pn1, RPC versus pn5, pn1 versus pn5 (but not significantly changed between FACS positive and negative samples).", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 37, "column_count": 3}, "table": {"label": "Table 4", "caption": "Genes differentially regulated in all comparisons of RPC versus pn1, RPC versus pn5, pn1 versus pn5 (but not significantly changed between FACS positive and negative samples).", "rows": [["Differentially regulated genes", "", ""], ["ENSMUSG00000063277", "Grina", "Rbpms"], ["1200009O22Rik", "H3f3b [31]", "Rffl"], ["1700020C11Rik [31]", "Hba-a1, Hba-a2 [31]", "Rnmt"], ["1810009A15Rik", "Hist2h2aa1, Hist2h2aa2, Hist2h2ac, Hist2h3c1", "Rpl19"], ["2310028O11Rik", "Hmgn1", "Sdha"], ["2310044H10Rik", "Hsd17b4", "Sfrs14 [31]"], ["2410017P09Rik", "Hspe1", "Snrnp40"], ["Acadl", "Jam2 [31]", "Snrpn /// Snurf [37]"], ["Ak3l1 /// LOC100047616", "Lhx9", "Sox6"], ["Asf1a", "LOC100044115, Rin2", "Sub1"], ["Atp5k", "LOC100044139, Snrpn, Snurf", "Tspan31"], ["Banf1", "LOC100045551, Ppm1d", "Tspan7"], ["BC016201 [31]", "LOC100046232, Nfil3", "Tuba1a"], ["Cadm3", "LOC100046704, Nras", "Txn1"], ["Calb1", "LOC100047393, Nae1", "Uba2"], ["Chrna6", "LOC677317, Me1", "Ube2d2"], ["Cox6b1", "Mcm7 [30]", "Ube2e1"], ["Cox7c, LOC100047065, LOC100048613", "Mdfic", "Vsnl1 [31]"], ["Cplx3", "Med19", ""], ["D0H4S114", "Ndrg1 [37]", "Diff regulated + Neighbours"], ["Dab2ip", "Ndrg4", "Otx2 [30,34]"], ["Deb1", "Ndufa6 [31]", "Stxbp1 [31]"], ["Dohh", "Nlk [31]", ""], ["Eef1b2", "Notch4", ""], ["Eef1g, LOC100047986", "P4hb", ""], ["Extl3", "Pcdhga1-12, Pcdhgb1-8, Pcdhgc3-5 [31]", ""], ["Fam108a", "Phactr1 [31]", ""], ["Fam125a", "Phb", ""], ["Fkbp3", "Pip5k1a", ""], ["Gba2", "Pkig [31]", ""], ["Gdpd5", "Pnkd", ""], ["Glo1 [31]", "Polr2e", ""], ["Hist1h2bc, Hist1h2be, Hist1h2bl, Hist1h2bm, Hist1h2bp, LOC100046213", "Prdx3", ""], ["Gm5256, Gm5529, Slc25a5", "Prkar1b [31]", ""], ["Gm6293, Uqcr10", "Prnp [31]", ""], ["Gm9800, Ptma", "Psrc1", ""]], "row_count": 37, "column_count": 3, "numeric_cells": 48, "header_rows": 1, "locator": "section[17]/table-wrap[3]#t4"}}, {"id": "asset:table:pmid:25678762:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:50e943e37c54f246de959a63e835068c2199d15fdfbf648637e62418ffe33224", "bytes": 2981, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[4]#t5", "version": null, "note": "Expression “neighbours” of well-known retinal and eye specification genes, as determined by t-SNE.", "structure": {"pmcid": "PMC4301594", "section_index": 17, "section_title": "Results", "row_count": 35, "column_count": 6}, "table": {"label": "Table 5", "caption": "Expression “neighbours” of well-known retinal and eye specification genes, as determined by t-SNE.", "rows": [["Expression pattern neighbours of selected retinopathy genes", "", ""], ["1110051M20Rik", "Crx [32,33,35,38,40]", "Gnat1 [31,36-38,40]", "Mpp7", "Pstk", "Smarcd2 [31]"], ["A530058N18Rik", "Crxos1 [39]", "Gnb1 [36,38,40]", "Mrpl49 [31]", "Ptp4a3 [16,31,32]", "Smpd2"], ["Abcg4 [32]", "D0Kist5", "Gnb3 [31,36]", "Mtfp1", "Ptpn21 [31,32]", "Snap25 [16,31,36,38]"], ["Acsl1", "D2Ertd63e", "Gngt1 [16,31,34-36]", "Mthfr", "Rab27a", "Snta1 [16,31]"], ["Adcy7", "Dalrd3", "Grk1 [32,34,38]", "Ndrg1 [37]", "Rab28 [16,31]", "Spint2"], ["Agtpbp1 [31,32]", "Darc", "Gucy2e [42]", "Ndufv1", "Rbks", "St3gal3 [32]"], ["Aipl1 [31,32,35-38]", "Dgke", "Guk1", "Neurog2 [30]", "Rbp3 [31,35,36,38-41]", "St6galnac2"], ["Amy1", "Dleu2", "Gulo [36,40]", "Nme5", "Rcvrn [16,30,31,36,37]", "Stk39 [31]"], ["Ankrd33 [31,37]", "Dnaja4", "Hcn1 [38]", "Nr2e3 [31,34-36,38,40]", "Rd3 40", "Stmn1"], ["Ap1b1 [31]", "Doc2b [31]", "Heph", "Nr6a1", "Rdh12 [32,34,35,38,40]", "Stx3 [31,42]"], ["Ap2m1 [31]", "Dusp26", "Hmx1", "Nrl [31,34-36,38,40]", "Rho [16,30-32,34-38,40,42]", "Stxbp1 [31]"], ["Arl6 [38],", "Ebf3", "Icmt [31]", "Nsf", "Rhpn1", "Suv39h2"], ["B9d1", "Efnb2 [31]", "Ift81", "Nxnl2 [35]", "Rian", "Syngr1"], ["Bbs9 [16,35,38],", "Elavl3", "Igsf9", "Otud7b", "Rnf157", "Sys1"], ["BC027072 [35],", "Elovl2", "Impdh1 [38]", "Otx2 [33,38]", "Rom1 [30,31,35,36,38,40]", "Syt1 [16,32]"], ["Btc [16,31,42]", "Elovl4 [31,38]", "Impg1 [35]", "Pax6 [30,31]", "Rp1", "Tbc1d8 [34]"], ["C1ql3", "Eml3 [31]", "Itfg2 [31]", "Pdc [30,34,36,38]", "Rpgr [32]", "Tbx2"], ["Calml4", "Eml5", "Kcnb1 [31,37]", "Pde6a [30,32,35,36,38,40]", "Rpgrip1 [31,34,35,38-40]", "Tmeff1"], ["Camk2d [31]", "Endod1", "Kcnk1", "Pde6b [16,30-32,35-38,40]", "Rraga", "Tmem229b"], ["Camsap1 [31,32]", "Eno2 [16,31]", "Kif5c", "Pde6g [16,30-32,34-36,38,40]", "Rs1 [31,34,35,37,38,40]", "Tob2"], ["Cdhr1 [34]", "Eno3", "Kif9", "Pex11a", "Rsph9", "Tox"], ["Cdk5r2", "Epb4.1l3 [31]", "Klc1", "Pex5l", "Rtbdn", "Ttc8 [16,38,40]"], ["Cep250", "Ezh1", "Klc3 [31]", "Pitpnm1 [31]", "Rxrg [36]", "Tub [31]"], ["Cep290 [32,38]", "Fabp4", "Krt18", "Pja1", "Sag [31,34,36,38,40]", "Tuba4a"], ["Chchd10", "Fam132a", "Llgl2 [34]", "Pmepa1", "Samd11 [31,35]", "Tulp1 [31,33,35,38,40]"], ["Chga [31]", "Fam161a", "Lpgat1 [31,37]", "Podxl [16,31,34,42]", "Sec14l2 [34]", "Uckl1"], ["Chrna5 [16,42]", "Fam89a", "Lrp2", "Ppef2", "Sema7a [16]", "Unc119 [31,36,38,40]"], ["Ckmt1", "Fance", "Lrrc48", "Ppm1b [31]", "Sez6 [16,42]", "Unc13b"], ["Clstn1 [16,31,42]", "Fbrs", "Lztfl1", "Ppp3cc", "Shisa2 [42]", "Vldlr [31]"], ["Cmtm7", "Flcn", "Magi2 16", "Prdm9", "Slc12a5", "Vopp1"], ["Cnga1 [16,34,36-38,40,42]", "Foxo1 [31]", "Mak [31,34,35]", "Prickle1 [31]", "Slc19a1", "Vsx2"], ["Cplx3", "Frmd4b [31]", "Mdm1", "Prkab1 [31]", "Slc25a33", "Vtn [31,32]"], ["Cplx4 [16,34],", "Fyco1", "Meg3", "Prom1 [16,31,34,38,40,42]", "Slc27a2", "Zfp532"], ["Crmp1", "Gdpd3", "Mpp4 [35]", "Prr14", "Slc7a8 [16]", "Zranb1"]], "row_count": 35, "column_count": 6, "numeric_cells": 125, "header_rows": 1, "locator": "section[17]/table-wrap[4]#t5"}}, {"id": "asset:table:pmid:25678762:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0f4e709379c93cdf320c37555bd0a0ae7c6f546c8e73356efb1212374875fc14", "bytes": 4148, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[1]#t6", "version": null, "note": "Functions of selected genes also identified in other retinal array studies.", "structure": {"pmcid": "PMC4301594", "section_index": 23, "section_title": "Discussion", "row_count": 7, "column_count": 4}, "table": {"label": "Table 6", "caption": "Functions of selected genes also identified in other retinal array studies.", "rows": [["Gene Title and symbol", "Functions", "Retinal functions", "References"], ["betacellulin, epidermal growth factor family member Btc", "Member of the EGF family of growth factors, synthesized primarily as a transmembrane precursor, which is then processed to mature molecule by proteolytic events. This protein is a ligand for the EGF receptor. Involved in propagating luteinizing hormone signalling through the ovary during ovulation. Constituent of bone marrow stem cell conditioned medium (BMSC medium),", "BMSC medium treated RPCs are more likely to favour neural differentiation.May also enhance RPC proliferation. Overexpressed in diabetic mice, may contribute to increased vascular permeability and vascular oedema, leading to diabetic retinopathy.", "Gene ID:685. OMIM 600345 [63,64]."], ["synaptosomal-associated protein 25 Snap25", "Snap25 is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Neuronal exocytosis requires 3 SNARE proteins: synaptobrevin on the synaptic vesicle, and syntaxin and SNAP25 on the plasma membrane. Expressed in ribbon synapses from pn4, may be involved in their organization.", "Strongly expressed in horizontal cells. Thought to play role in photoreceptor development. Expressed in the Golgi complex of retinal neurons as well as involvement in synaptic vesicle release. It is located in the perinuclear compartment of retinal neurons", "Gene ID: 6616, OMIM 600322 [65-67],"], ["complexin 4 Cplx4", "Probable member of the complexin family, may be involved in synaptic vesicle exocytosis. Contains a C-terminal CAAX box motif for posttranslational prenylation. Expression is retinal specific, or restricted to eye and retina (databases). Expression seems to be localized to rod photoreceptor ribbon synapses. Positive regulator of synaptic transmission in mouse hippocampal neurons.", "Present in IPL and bipolar cell synapses. Double Cplx3/4 KO mice show behavioural responses suggestive of visual deficit and disordered ribbon synapses. Ganglion cell ON and OFF synapses also affected differentially. Essential regulators of neurotransmission at retinal ribbon synapses.", "Gene ID:339302 OMIM609586 [68,69]."], ["podocalyxin-like Podxl", "Member of the sialomucin protein family. Important component of glomerular podocytes. Other biological activities include binding in a membrane protein complex with Na+/H+ exchanger regulatory factor to intracellular cytoskeletal elements, playing a role in hematopoetic cell differentiation, and being expressed in vascular endothelium cells and L-selectin binding. Highest expression in kidney, pancreas and heart. Linked to ezrin and the actin cytoskeleton via Nherf2.", "Identified via array as a marker of early rod precursors which are capable of integrating into recipient retinas after transplantation.", "[31] Gene ID: 5420. OMIM602632."], ["calsyntenin 1 Clstn1", "Isolated from brain cDNA library, expressed by >90% of neurons. Localized in post-synaptic membrane. Signalling may be by proteolytic cleavage. Expression raised in Alzheimers and Parkinsons samples decreased in neuroblastoma. Localized in organelles alongside microtubules, partially co-localized with kinesin. Organelles transported in a manner consistent with fast axonal transport.", "Unknown", "Gene ID: 22883 OMIM611321 [70,71]"], ["cholinergic receptor, nicotinic, alpha polypeptide 5 Chrna5", "Nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2), variants are associated with increased risk of nicotine addiction, a propensity shared with Chrna5 knockout mice. Evolution of this gene in primates has been faster than would be expected by chance, may be involved in the evolution of larger brains in humans.", "Unknown", "Gene ID: 1138. OMIM118505 [72,73]."]], "row_count": 7, "column_count": 4, "numeric_cells": 14, "header_rows": 1, "locator": "section[23]/table-wrap[1]#t6"}}, {"id": "asset:table:pmid:25678762:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:05c0a8ad30f87930bcb62482d5f9e9cccb501066f01ae3fbe2043c0a7caef53f", "bytes": 4053, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[2]#t7", "version": null, "note": "Functions of selected genes confirmed by qPCR (see Figure 2 and Supplementary Datafile 4 for associated qPCR results).", "structure": {"pmcid": "PMC4301594", "section_index": 23, "section_title": "Discussion", "row_count": 9, "column_count": 4}, "table": {"label": "Table 7", "caption": "Functions of selected genes confirmed by qPCR (see Figure 2 and Supplementary Datafile 4 for associated qPCR results).", "rows": [["Gene Title and Symbol", "Functions", "Retinal functions", "References"], ["low density lipoprotein receptor-related protein 4 Lrp4", "Member of the low-density lipoprotein receptor-related protein family, may be a Wnt signaling regulator. Contains EGF like domain. Co-ordinates synapse formation at neuromuscular junctions. Mutated in Cenani-Lenz syndactyly syndrome and sclerosteosis. Knockout mice are growth retarded with fully penetrant polysyndactyly in their fore and hind limbs and partially penetrant abnormalities of tooth development.", "unknown", "Gene ID: 4038, OMIM604270"], ["A530058N18Rik RIKEN cDNA , A530058N18Rik", "No human homologue noted. Uncharacterised", "unknown", "Gene ID: 320846."], ["sterile alpha motif domain containing 11, SamD11", "Relatively uncharacterised. May promote cell proliferation slightly. Evolutionarily conserved from zebrafish to human. High expression levels in mouse retina, but human SamD11 is more widely expressed.", "Mouse SamD11 is expressed in developing photoreceptors and the pineal gland; expression is controlled by Crx.", "Gene ID: 148398 [74]."], ["Cdk2ap2 CDK2-associated protein 2, Cdk2ap2", "Interacts with cyclin-dependent kinase 2 associated protein 1. May be involved in self renewal regulation in ES cells; knockout ESCs showed an early differentiation phenotype, but embryoid bodies were unhealthy and showed high levels of apoptosis. Knockout ESCs were unable to form teratomas in SCID mice.", "unknown", "Gene ID: 10263 [75]."], ["peroxisome proliferative activated receptor, gamma, coactivator 1 alpha, Ppargc1a", "Transcriptional coactivator regulating genes involved in energy metabolism. Interacts with PPARgamma, permitting interaction with multiple transcription factors. It provides a direct link between external physiological stimuli and the regulation of mitochondrial biogenesis (particularly vital in the retina), and is a major factor regulating muscle fiber type determination. May also be involved in controlling blood pressure, regulating cellular cholesterol homoeostasis, and the development of obesity. Ppargc1a/Ppargc1b double knockouts show heart abnormalities.", "SNP associated with neovascularization in AMD. Regulates VEGF in the retina, is strongly upregulated during postnatal retinal development, and is necessary for normal retinal vascularization. Knockout mice have reduced retinal vasculature. Regulator of interneuron function, master regulator of metabolism in peripheral tissues.", "[76-78] Gene ID:10891"], ["cDNA sequence BC027072, BC027072", "68% identity to human C2ORF71, which causes RP when mutated. Homology possibly not high enough to say this is definitively the mouse homologue. C2ORF71 causes digenic Usher syndrome when mutations in CEP250 are also present", "C2ORF71 is predominantly retinally expressed and localizes to the primary cilium of photoreceptor cells. Function otherwise uncharacterised.", "OMIM613425 [79-81]."], ["nuclear receptor subfamily 6, group A, member 1, Nr6a1", "Orphan nuclear receptor, member of the nuclear hormone receptor family. Homodimerizes and binds DNA, but in vivo targets unidentified. High level expression in testis, promotes neural development in early embryogenesis via suppression of Oct4", "unknown", "Gene ID: 2649 [82,83]."], ["kinesin family member 9 /// similar to kinesin family member 9, Kif9", "Expression downregulated during hippocampal development and upregulated during kidney development. Interacts with GEM and stabilised microtubules. Gem and Kif9 are responsible for the regulation of spindle length during mitosis. Spindle abnormalities are seen when either protein is downregulated.", "Co-ordinated expression with Atoh1 during hair cell development in the inner ear; candidate gene for Usher syndrome?", "OMIM607910. Gene ID: 64147 [84,85]"]], "row_count": 9, "column_count": 4, "numeric_cells": 21, "header_rows": 1, "locator": "section[23]/table-wrap[2]#t7"}}], "gaps": ["asset:data:geo:GSE59201 not downloaded", "asset:data:geo:GSE59201 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49]."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE59201"], "resolved_accessions": ["GSE59201"], "statements": ["All data have been submitted to GEO ([55]) in accordance with MIAMI standards [56,57]. The GEO accession number for this data set is GSE59201."], "basis": "The paper names GSE59201 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:25678762", "data:geo:GSE59201", "asset:table:pmid:25678762:1", "asset:table:pmid:25678762:2", "asset:table:pmid:25678762:3", "asset:table:pmid:25678762:4", "asset:table:pmid:25678762:5", "asset:table:pmid:25678762:6", "asset:table:pmid:25678762:7"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE59201"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": null, "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 0, "usage": {}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:25678762", "type": "paper", "label": "pmid:25678762"}, {"id": "source:pmid:25678762", "type": "manuscript", "label": "PMID 25678762 full text"}, {"id": "data:geo:GSE59201", "type": "dataset", "label": "GEO GSE59201"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:25678762", "type": "paper", "label": "pmid:25678762"}, {"id": "source:pmid:25678762", "type": "manuscript", "label": "PMID 25678762 full text"}, {"id": "data:geo:GSE59201", "type": "dataset", "label": "GEO GSE59201"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-25678762", "type": "extraction", "used": ["source:pmid:25678762"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE59201", "type": "accession_resolution", "used": ["data:geo:GSE59201"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:25678762", "parent_hash": "sha256:f8c9835982440772ec4bc659e247c499fbf2296434e47db558c40687ecf28594", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE59201 licence not read", "asset:data:geo:GSE59201 not downloaded", "doi", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["f the retina. Rod progenitors from postnatal mouse retinas can be transplanted and can form pho"], "order_basis": "paper_text_order:675", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ssion differences between postnatal retinas, cultured retinal progenitor cells (RPCs), and rod pho", "e medium after 7 days of culture. Cells were passaged when 80–90% confluent. About 0.5 ml 0.25% tr"], "order_basis": "paper_text_order:1019", "id": "assay:2"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["onally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photorecepto", "transplantable photoreceptors. Additionally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photor", "eptors. Additionally, fluorescence-activated cell sorting (FACS) sorted Rho-eGFP-expressing rod photor"], "order_basis": "paper_text_order:1455", "id": "assay:3"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["n reaction (q-PCR). RESULTS: Analysis of the microarray data sets, including the use of t-distribute"], "order_basis": "paper_text_order:1739", "id": "assay:4"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Expression across different conditions, together with associated significance tests, were performed using R and Limma [48,49]."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T00:38:07+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}