{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:27801851", "kind": "science-record", "revision": 8, "content_hash": "sha256:9c19ea33c4bcf2a0bad2e9eb79d5393ac9cc9268d56e4b217285f9fb6d78bf77", "created_at": "2026-11-01T15:40:21Z", "updated_at": "2026-11-01T21:59:12Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "PPIC, EMP3 and CHI3L1 Are Novel Prognostic Markers for High Grade Glioma.", "doi": "10.3390/ijms17111808", "pmid": "27801851", "authors": ["Yuan-Feng Gao", "Tao Zhu", "Chen-Xue Mao", "Zhi-Xiong Liu", "Zhi-Bin Wang", "Xiao-Yuan Mao", "Ling Li", "Ji-Ye Yin", "Hong-Hao Zhou", "Zhao-Qian Liu"], "journal": "International journal of molecular sciences", "year": 2016, "abstract": "Current treatment methods for patients diagnosed with gliomas have shown limited success. This is partly due to the lack of prognostic genes available to accurately predict disease outcomes. The aim of this study was to investigate novel prognostic genes based on the molecular profile of tumor samples and their correlation with clinical parameters. In the current study, microarray data (GSE4412 and GSE7696) downloaded from Gene Expression Omnibus were used to identify differentially expressed prognostic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years) and short-term survivors (≤2 years). DEPGs generated from these two datasets were intersected to obtain a list of common DEPGs. The expression of a subset of common DEPGs was then independently validated by real-time reverse transcription quantitative PCR (qPCR). Survival value of the common DEPGs was validated using known survival data from the GSE4412 and TCGA dataset. After intersecting DEPGs generated from the above two datasets, three genes were identified which may potentially be used to determine glioma patient prognosis. Independent validation with glioma patients tissue (n = 70) and normal brain tissue (n = 19) found PPIC, EMP3 and CHI3L1 were up-regulated in glioma tissue. Survival value validation showed that the three genes correlated with patient survival by Kaplan-Meir analysis, including grades, age and therapy.", "claims": [{"id": "claim-data-access", "statement": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:27801851", "locator": "sections[10] \"4.1. Affymetrix Microarray Data\" paragraph 2", "quote": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database."}, {"asset": "source:pmid:27801851", "locator": "sections[10] \"4.1. Affymetrix Microarray Data\" paragraph 2", "quote": "The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array."}, {"asset": "source:pmid:27801851", "locator": "sections[10] \"4.1. Affymetrix Microarray Data\" paragraph 2", "quote": "Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412."}], "state": "complete"}, {"id": "claim-target-result", "statement": "The study identified PPIC, EMP3, and CHI3L1 as three common differentially expressed prognostic genes in glioma.", "kind": "quantitative", "target": {"value": 0.05, "unit": "p-value", "tolerance": null, "source": "Genes were considered differentially expressed when meeting the cut-off criterion of |log fold change (FC)| ≥ 1.5 and p < 0.05."}, "evidence": [{"asset": "source:pmid:27801851", "locator": "sections[3] \"2.1. Identification of DEPGs\" paragraph 2", "quote": "Intersection of the DEPGs revealed a total of three common DEPGs—PPIC, EMP3 and CHI3L1—suggesting that these common DEPGs may be potential prognostic indicators of glioma progression (Figure 1E)."}, {"asset": "source:pmid:27801851", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "In the current study, microarray data (GSE4412 and GSE7696) downloaded from Gene Expression Omnibus were used to identify differentially expressed prognostic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years) and short-term survivors (≤2 years)."}, {"asset": "source:pmid:27801851", "locator": "sections[11] \"4.2. Differentially Expressed Prognostic Genes (DEPGs) Analysis\" paragraph 2", "quote": "Genes were considered differentially expressed when meeting the cut-off criterion of |log fold change (FC)| ≥ 1.5 and p < 0.05."}, {"asset": "source:pmid:27801851", "locator": "sections[11] \"4.2. Differentially Expressed Prognostic Genes (DEPGs) Analysis\" paragraph 2", "quote": "The results generated from GSE4412 and GSE7696 datasets were then intersected to find DEPGs."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "The study identified PPIC, EMP3, and CHI3L1 as three common differentially expressed prognostic genes in glioma.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:27801851"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE4290"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE4290"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:27801851", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3390/ijms17111808", "sha256": "sha256:33be9a55f94dbcde0315188ed3fb07a98575195d456b8d4a97a78ccefcfe9a9e", "bytes": 33682, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3390/ijms17111808", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC5133809", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE4290", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE4290", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE4290", "version": null, "note": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM97793", "GSM97794", "GSM97795", "GSM97796", "GSM97797", "GSM97798", "GSM97799", "GSM97800", "GSM97801", "GSM97802", "GSM97803", "GSM97804", "GSM97805", "GSM97806", "GSM97807", "GSM97808", "GSM97809", "GSM97810", "GSM97811", "GSM97812", "GSM97813", "GSM97814", "GSM97815", "GSM97816", "GSM97817", "GSM97818", "GSM97819", "GSM97820", "GSM97821", "GSM97822", "GSM97823", "GSM97824", "GSM97825", "GSM97826", "GSM97827", "GSM97828", "GSM97829", "GSM97830", "GSM97831", "GSM97832", "GSM97833", "GSM97834", "GSM97835", "GSM97836", "GSM97837", "GSM97838", "GSM97839", "GSM97840", "GSM97841", "GSM97842", "GSM97843", "GSM97844", "GSM97845", "GSM97846", "GSM97847", "GSM97848", "GSM97849", "GSM97850", "GSM97851", "GSM97852", "GSM97853", "GSM97854", "GSM97855", "GSM97856", "GSM97857", "GSM97858", "GSM97859", "GSM97860", "GSM97861", "GSM97862", "GSM97863", "GSM97864", "GSM97865", "GSM97866", "GSM97867", "GSM97868", "GSM97869", "GSM97870", "GSM97871", "GSM97872", "GSM97873", "GSM97874", "GSM97875", "GSM97876", "GSM97877", "GSM97878", "GSM97879", "GSM97880", "GSM97881", "GSM97882", "GSM97883", "GSM97884", "GSM97885", "GSM97886", "GSM97887", "GSM97888", "GSM97889", "GSM97890", "GSM97891", "GSM97892", "GSM97893", "GSM97894", "GSM97895", "GSM97896", "GSM97897", "GSM97898", "GSM97899", "GSM97900", "GSM97901", "GSM97902", "GSM97903", "GSM97904", "GSM97905", "GSM97906", "GSM97907", "GSM97908", "GSM97909", "GSM97910", "GSM97911", "GSM97912", "GSM97913", "GSM97914", "GSM97915", "GSM97916", "GSM97917", "GSM97918", "GSM97919", "GSM97920", "GSM97921", "GSM97922", "GSM97923", "GSM97924", "GSM97925", "GSM97926", "GSM97927", "GSM97928", "GSM97929", "GSM97930", "GSM97931", "GSM97932", "GSM97933", "GSM97934", "GSM97935", "GSM97936", "GSM97937", "GSM97938", "GSM97939", "GSM97940", "GSM97941", "GSM97942", "GSM97943", "GSM97944", "GSM97945", "GSM97946", "GSM97947", "GSM97948", "GSM97949", "GSM97950", "GSM97951", "GSM97952", "GSM97953", "GSM97954", "GSM97955", "GSM97956", "GSM97957", "GSM97958", "GSM97959", "GSM97960", "GSM97961", "GSM97962", "GSM97963", "GSM97964", "GSM97965", "GSM97966", "GSM97967", "GSM97968", "GSM97969", "GSM97970", "GSM97971", "GSM97972"], "sample_count": 180, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data of glioma samples from Henry Ford Hospital", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE4412", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE4412", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE4412", "version": null, "note": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM99432", "GSM99433", "GSM99434", "GSM99435", "GSM99436", "GSM99437", "GSM99438", "GSM99439", "GSM99440", "GSM99441", "GSM99442", "GSM99443", "GSM99444", "GSM99445", "GSM99446", "GSM99447", "GSM99448", "GSM99449", "GSM99450", "GSM99451", "GSM99452", "GSM99453", "GSM99454", "GSM99455", "GSM99456", "GSM99457", "GSM99458", "GSM99459", "GSM99460", "GSM99461", "GSM99462", "GSM99463", "GSM99464", "GSM99465", "GSM99466", "GSM99467", "GSM99468", "GSM99469", "GSM99470", "GSM99471", "GSM99472", "GSM99473", "GSM99474", "GSM99475", "GSM99476", "GSM99477", "GSM99478", "GSM99479", "GSM99480", "GSM99481", "GSM99482", "GSM99483", "GSM99484", "GSM99485", "GSM99486", "GSM99487", "GSM99488", "GSM99489", "GSM99490", "GSM99491", "GSM99492", "GSM99493", "GSM99494", "GSM99495", "GSM99496", "GSM99497", "GSM99498", "GSM99499", "GSM99500", "GSM99501", "GSM99502", "GSM99503", "GSM99504", "GSM99505", "GSM99506", "GSM99507", "GSM99508", "GSM99509", "GSM99510", "GSM99511", "GSM99512", "GSM99513", "GSM99514", "GSM99515", "GSM99516", "GSM99517", "GSM99518", "GSM99519", "GSM99520", "GSM99521", "GSM99522", "GSM99523", "GSM99524", "GSM99525", "GSM99526", "GSM99527", "GSM99528", "GSM99529", "GSM99530", "GSM99531", "GSM99532", "GSM99533", "GSM99534", "GSM99535", "GSM99536", "GSM99537", "GSM99538", "GSM99539", "GSM99540", "GSM99541", "GSM99542", "GSM99543", "GSM99544", "GSM99545", "GSM99546", "GSM99547", "GSM99548", "GSM99549", "GSM99550", "GSM99551", "GSM99552", "GSM99553", "GSM99554", "GSM99555", "GSM99556", "GSM99557", "GSM99558", "GSM99559", "GSM99560", "GSM99561", "GSM99562", "GSM99563", "GSM99564", "GSM99565", "GSM99566", "GSM99567", "GSM99568", "GSM99569", "GSM99570", "GSM99571", "GSM99572", "GSM99573", "GSM99574", "GSM99575", "GSM99576", "GSM99577", "GSM99578", "GSM99579", "GSM99580", "GSM99581", "GSM99582", "GSM99583", "GSM99584", "GSM99585", "GSM99586", "GSM99587", "GSM99588", "GSM99589", "GSM99590", "GSM99591", "GSM99592", "GSM99593", "GSM99594", "GSM99595", "GSM99596", "GSM99597", "GSM99598", "GSM99599", "GSM99600", "GSM99601"], "sample_count": 170, "group_sizes": null, "group_sizes_basis": null, "platform": "96;97", "taxon": "Homo sapiens", "title": "freij-affy-human-91666", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE7696", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE7696", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE7696", "version": null, "note": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM187153", "GSM187154", "GSM187155", "GSM187156", "GSM187157", "GSM187158", "GSM187159", "GSM187160", "GSM187161", "GSM187162", "GSM187163", "GSM187164", "GSM187165", "GSM187166", "GSM187167", "GSM187168", "GSM187169", "GSM187170", "GSM187171", "GSM187172", "GSM187173", "GSM187174", "GSM187175", "GSM187176", "GSM187177", "GSM187178", "GSM187179", "GSM187180", "GSM187181", "GSM187182", "GSM187183", "GSM187184", "GSM187185", "GSM187186", "GSM187187", "GSM187188", "GSM187189", "GSM187190", "GSM187191", "GSM187192", "GSM187193", "GSM187194", "GSM187195", "GSM187196", "GSM187197", "GSM187198", "GSM187199", "GSM187200", "GSM187201", "GSM187202", "GSM187203", "GSM187204", "GSM187205", "GSM187206", "GSM187207", "GSM187208", "GSM187209", "GSM187210", "GSM187211", "GSM187212", "GSM187213", "GSM187214", "GSM187215", "GSM187216", "GSM187217", "GSM187218", "GSM187219", "GSM187220", "GSM187221", "GSM187222", "GSM187223", "GSM187224", "GSM187225", "GSM187226", "GSM187227", "GSM187228", "GSM187229", "GSM187230", "GSM187231", "GSM187232", "GSM187233", "GSM187234", "GSM187235", "GSM187236"], "sample_count": 84, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Glioblastoma from a homogenous cohort of patients treated within clinical trial", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:27801851:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f5ea95aec2e6114b27b3abe489ef41bb6e3d752d3271b6237528bf0e18504cb2", "bytes": 1157, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#ijms-17-01808-t001", "version": null, "note": "Correlation between PPIC/EMP3/CHI3L1 expression and glioma clinicopathologic features in 70 patients.", "structure": {"pmcid": "PMC5133809", "section_index": 4, "section_title": "2.2. Independent Validation of Glioma-Specific Markers", "row_count": 12, "column_count": 14}, "table": {"label": "Table 1", "caption": "Correlation between PPIC/EMP3/CHI3L1 expression and glioma clinicopathologic features in 70 patients.", "rows": [["", "N%", "PPIC Expression Levels", "", "", "EMP3 Expression Levels", "", "", "CHI3L1 Expression Levels", "", ""], ["High", "Low", "Ratio", "p", "High", "Low", "Ratio", "p", "High", "Low", "Ratio", "p"], ["Expression", "Expression", "(High/Low)", "", "Expression", "Expression", "(High/Low)", "", "Expression", "Expression", "(High/Low)", ""], ["Sex", ""], ["Male", "48 (68.57)", "13", "35", "0.371", "0.184", "16", "32", "0.5", "0.835", "15", "33", "0.454", "0.441"], ["Female", "22 (31.42)", "10", "12", "0.833", "5", "17", "0.294", "7", "15", "0.467"], ["Age, year", ""], ["<45", "45 (64.28)", "13", "32", "0.406", "0.068", "14", "31", "0.452", "0.762", "13", "32", "0.406", "0.965"], ["≥45", "25 (35.72)", "11", "14", "0.786", "7", "18", "0.389", "9", "16", "0.563"], ["Grade", ""], ["Low (I + II)", "38 (54.28)", "7", "31", "0.226", "0.005", "11", "27", "0.407", "0.876", "13", "25", "0.52", "0.935"], ["High (III + IV)", "32 (45.71)", "16", "16", "0.500", "10", "22", "0.454", "9", "23", "0.391"]], "row_count": 12, "column_count": 14, "numeric_cells": 71, "header_rows": 3, "locator": "section[4]/table-wrap[1]#ijms-17-01808-t001"}}, {"id": "asset:table:pmid:27801851:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1af73da8df207080153b40bb127fe029310e029cb7ccd2cb31d44153c43cd215", "bytes": 723, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#ijms-17-01808-t002", "version": null, "note": "Clinical and histological characteristics of patients with glioma.", "structure": {"pmcid": "PMC5133809", "section_index": 10, "section_title": "4.1. Affymetrix Microarray Data", "row_count": 16, "column_count": 5}, "table": {"label": "Table 2", "caption": "Clinical and histological characteristics of patients with glioma.", "rows": [["Sequence", "GSE4412", "GSE7696", "GSE4290", "TCGA"], ["Patients (n)", "74", "60", "157", "567"], ["Male", "28", "43", "", "347"], ["Female", "46", "17", "", "220"], ["Age (years)", "46 (18–82)", "48 (33–70)", "", "58 (10–89)"], ["Grade (n)", "", "", "", ""], ["I", "", "", "", ""], ["II", "", "", "45", ""], ["III", "24", "", "31", ""], ["IV", "50", "60", "81", "567"], ["Temozolomide (TMZ) (n)", "", "", "", ""], ["Yes", "", "", "", "166"], ["No", "", "", "", "401"], ["Radiotherapy Z (n)", "", "", "", ""], ["Yes", "", "", "", "422"], ["No", "", "", "", "145"]], "row_count": 16, "column_count": 5, "numeric_cells": 27, "header_rows": 1, "locator": "section[10]/table-wrap[1]#ijms-17-01808-t002"}}, {"id": "asset:table:pmid:27801851:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:188b6a2cd3fceea60e8b3b351f2a3ffbccd46efd73c0614e1402544f5f75d259", "bytes": 530, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#ijms-17-01808-t003", "version": null, "note": "Primer sequences used for real-time PCR.", "structure": {"pmcid": "PMC5133809", "section_index": 13, "section_title": "4.4. RNA Extraction and Reverse-Transcription PCR from Human Tissue", "row_count": 9, "column_count": 3}, "table": {"label": "Table 3", "caption": "Primer sequences used for real-time PCR.", "rows": [["Gene", "Sequence", "Base"], ["PPIC", "F: AGCAAGTTTCATCGTGTCATCA", "22"], ["R: TGGAAATGTCTCACCATAGATGC", "23"], ["EMP3", "F: GGAGGTCTCTTCTATGCCACC", "21"], ["R: AGGATCTCCTCGGCGTGAAT", "20"], ["CHI3L1", "F: GTGAAGGCGTCTCAAACAGG", "20"], ["R: GAAGCGGTCAAGGGCATCT", "19"], ["GAPDH", "F: GAGTCAACGGATTTGGTCGT", "20"], ["R: TTGATTTTGGAGGGATCTCG", "20"]], "row_count": 9, "column_count": 3, "numeric_cells": 8, "header_rows": 1, "locator": "section[13]/table-wrap[1]#ijms-17-01808-t003"}}], "gaps": ["asset:data:geo:GSE4290 not downloaded", "asset:data:geo:GSE4290 licence not read", "asset:data:geo:GSE4412 not downloaded", "asset:data:geo:GSE4412 licence not read", "asset:data:geo:GSE7696 not downloaded", "asset:data:geo:GSE7696 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "Kaplan-Meier"}}, {"id": "method-2", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "log-rank"}}, {"id": "method-3", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "PPI"}}, {"id": "method-4", "family": null, "specific": null, "label": "Significant analysis of microarray (SAM)", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "reordered", "quote": "“In the current study, microarray data (GSE4412 and GSE7696) downloaded from Gene Expression Omnibus were used to identify differentially expressed prognostic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years) and short-term survivors (≤2 years).”"}}], "targets": [{"id": "target-published-estimate", "claim_id": "claim-target-result", "operation": "build_graph", "expected_value": 0.05, "unit": "p-value", "tolerance": null, "state": "complete", "note": "The threshold the paper applied to its own result, as the paper states it. A run that reproduces the effect is judged against this threshold."}], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE4412", "GSE7696", "GSE4290"], "resolved_accessions": ["GSE4412", "GSE7696", "GSE4290"], "statements": ["Expression profiles (GSE4412, GSE7696 and GSE4290) were acquired from the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database. The platform of GSE4412 is GPL96 [HG-U133A] Affymetrix Human Genome U133A Array. Only grade III (n = 24) and IV (n = 50) gliomas were included in GSE4412."], "basis": "The paper names GSE4412, GSE7696, GSE4290 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:27801851", "data:geo:GSE4290", "asset:table:pmid:27801851:1", "asset:table:pmid:27801851:2", "asset:table:pmid:27801851:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE4290"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:29:59Z", "independence": "same_provider"}, "evidence_check": {"method": "reordered", "availability": null}, "calls": 8, "usage": {"prompt_tokens": 75324, "completion_tokens": 5509, "cached_tokens": 2104}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:27801851", "type": "paper", "label": "pmid:27801851"}, {"id": "source:pmid:27801851", "type": "manuscript", "label": "PMID 27801851 full text"}, {"id": "data:geo:GSE4290", "type": "dataset", "label": "GEO GSE4290"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:27801851", "type": "paper", "label": "pmid:27801851"}, {"id": "source:pmid:27801851", "type": "manuscript", "label": "PMID 27801851 full text"}, {"id": "data:geo:GSE4290", "type": "dataset", "label": "GEO GSE4290"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-27801851", "type": "extraction", "used": ["source:pmid:27801851"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE4290", "type": "accession_resolution", "used": ["data:geo:GSE4290"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:27801851", "parent_hash": "sha256:ae9c08148f7031f3d2e01015ed1fd5b07b13222fddfc4544190680d22baa0f5e", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE4290 licence not read", "asset:data:geo:GSE4290 not downloaded", "asset:data:geo:GSE4412 licence not read", "asset:data:geo:GSE4412 not downloaded", "asset:data:geo:GSE7696 licence not read", "asset:data:geo:GSE7696 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["h clinical parameters. In the current study, microarray data (GSE4412 and GSE7696) downloaded from G", "tic genes (DEPGs) by significant analysis of microarray (SAM) between long-term survivors (>2 years)"], "order_basis": "paper_text_order:402", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["time reverse transcription quantitative PCR (qPCR). Survival value of the common DEPGs was val"], "order_basis": "paper_text_order:892", "id": "assay:2"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Kaplan-Meier"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T00:42:29+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}