{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:29197895", "kind": "science-record", "revision": 9, "content_hash": "sha256:b9d58085496861f3a8b72d860afe6af48920a76196e1ba927c10daaed0cbd96a", "created_at": "2026-11-01T15:40:29Z", "updated_at": "2026-11-01T22:43:10Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of Key Genes in Colorectal Cancer Regulated by miR-34a.", "doi": "10.12659/msm.904937", "pmid": "29197895", "authors": ["Tao Wang", "Haihe Xu", "Xianglong Liu", "Shuo Chen", "Yi Zhou", "Xipeng Zhang"], "journal": "Medical science monitor : international medical journal of experimental and clinical research", "year": 2017, "abstract": "BACKGROUND The aim of this study was to screen the molecular targets of miR-34a in colorectal cancer (CRC) and construct the regulatory network, to gain more insights to the pathogenesis of CRC. MATERIAL AND METHODS The microarray data of CRC samples and normal samples (GSE4988), as well as CRC samples transformed with miR-34a and non-transfected CRC samples (GSE7754), were downloaded from the Gene Expression Omnibus (GEO) database. The differently expressed genes (DEGs) were identified via the LIMMA package in R language. The Database for Annotation, Visualization and Integrated Discovery (DAVID) was used to identify significant Gene Ontology (GO) terms and pathways in DEGs. The targets of miR-34a were obtained via the miRWalk database, and then the overlaps between them were selected out to construct the regulatory network of miR-34a in CRC using the Cytoscape software. RESULTS A total of 392 DEGs were identified in CRC samples compared with normal samples, including 239 upregulated genes and 153 downregulated ones. These DEGs were enriched in 75 GO terms and one Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway. At the same time, 332 DEGs (188 upregulated and 144 downregulated) were screened out between miR-34a transformed CRC and miR-34a non-transfected CRC samples and they were enriched in 20 GO terms and eight KEGG pathways. Six overlapped genes were identified in two DEGs groups. There were 1,668 targets of miR-34a obtained via the miRWalk database, among which 21 were identified differently expressed in miR-34a transformed CRC samples compared with miR-34a non-transfected CRC samples. Two regulatory networks of miR-34a in CRC within these two groups of overlapped genes were constructed respectively. CONCLUSIONS Pathways related to cell cycle, DNA replication, oocyte meiosis, and pyrimidine metabolism might play critical roles in the progression of CRC. Several genes such as SERPINE1, KLF4, SEMA4B, PPARG, CDC45, and KIAA0101 might be the targets of miR-34a and the potential therapeutic targets of CRC.", "claims": [{"id": "claim-method", "statement": "LIMMA package in R language was used to analyze the DEGs in CRC samples compared to normal samples (regarded as DEGs-1), as well as CRC samples transformed with miR-34a compared to non-transfected CRC samples (regarded as DEGs-2).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29197895", "locator": "sections[4] \"Data preprocessing and identification of DEGs\" paragraph 2", "quote": "LIMMA package in R language was used to analyze the DEGs in CRC samples compared to normal samples (regarded as DEGs-1), as well as CRC samples transformed with miR-34a compared to non-transfected CRC samples (regarded as DEGs-2)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Microarray data set GSE4988 and GSE7754 were downloaded from the GEO (http://www.ncbi.nlm.nih.gov/geo/) database. The GSE4988 data set contained 20 samples: 12 CRC samples and eight normal samples. These microarray data were analyzed using the GPL3014 (ResGenHs15K_DIO) platform.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29197895", "locator": "sections[3] \"Microarray data\" paragraph 2", "quote": "Microarray data set GSE4988 and GSE7754 were downloaded from the GEO (http://www.ncbi.nlm.nih.gov/geo/) database. The GSE4988 data set contained 20 samples: 12 CRC samples and eight normal samples. These microarray data were analyzed using the GPL3014 (ResGenHs15K_DIO) platform."}], "state": "complete"}, {"id": "claim-target-result", "statement": "Using the GEO datasets GSE4988 and GSE7754, preprocessed with RMA and analyzed with the LIMMA package in R, the study identified 392 DEGs in CRC versus normal samples and 332 DEGs in miR-34a-transformed versus non-transfected CRC samples.", "kind": "quantitative", "target": {"value": 0.05, "unit": "p-value", "tolerance": null, "source": "DEGs were obtained according to the criteria: adjusted p<0.05 and |log(fold change)| >1."}, "evidence": [{"asset": "source:pmid:29197895", "locator": "sections[0] \"Abstract\" paragraph 2", "quote": "The microarray data of CRC samples and normal samples (GSE4988), as well as CRC samples transformed with miR-34a and non-transfected CRC samples (GSE7754), were downloaded from the Gene Expression Omnibus (GEO) database."}, {"asset": "source:pmid:29197895", "locator": "sections[4] \"Data preprocessing and identification of DEGs\" paragraph 2", "quote": "The raw data was background corrected, log2 transformed, and quantile normalized using Robust Multi-array Average (RMA)."}, {"asset": "source:pmid:29197895", "locator": "sections[4] \"Data preprocessing and identification of DEGs\" paragraph 2", "quote": "LIMMA package in R language was used to analyze the DEGs in CRC samples compared to normal samples (regarded as DEGs-1), as well as CRC samples transformed with miR-34a compared to non-transfected CRC samples (regarded as DEGs-2)."}, {"asset": "source:pmid:29197895", "locator": "sections[4] \"Data preprocessing and identification of DEGs\" paragraph 2", "quote": "DEGs were obtained according to the criteria: adjusted p<0.05 and |log(fold change)| >1."}, {"asset": "source:pmid:29197895", "locator": "sections[10] \"Identification of DEGs\" paragraph 2", "quote": "After data preprocessing, a total of 392 DEGs were identified in DEGs-1."}, {"asset": "source:pmid:29197895", "locator": "sections[10] \"Identification of DEGs\" paragraph 2", "quote": "At the same time, the DEGs-2 set contained 332 DEGs (188 upregulated and 144 downregulated), and the top 20 DEGs of are shown in Figure 1B."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "Using the GEO datasets GSE4988 and GSE7754, preprocessed with RMA and analyzed with the LIMMA package in R, the study identified 392 DEGs in CRC versus normal samples and 332 DEGs in miR-34a-transformed versus non-transfected CRC samples.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:29197895"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE4988"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE4988"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:29197895", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.12659/msm.904937", "sha256": "sha256:de501b93c5d3cedfa866b831d0889b8c34dc6ea0b2cf5b3c4b0ec6161ed9ca0c", "bytes": 27482, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.12659/msm.904937", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC5724350", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE4988", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE4988", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE4988", "version": null, "note": "Microarray data set GSE4988 and GSE7754 were downloaded from the GEO (http://www.ncbi.nlm.nih.gov/geo/) database. The GSE4988 data set contained 20 samples: 12 CRC samples and eight normal samples. These microarray data were analyzed using the GPL3014 (ResGenHs15K_DIO) platform.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Microarray data set GSE4988 and GSE7754 were downloaded from the GEO (http://www.ncbi.nlm.nih.gov/geo/) database. The GSE4988 data set contained 20 samples: 12 CRC samples and eight normal samples. These microarray data were analyzed using the GPL3014 (ResGenHs15K_DIO) platform.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM112207", "GSM112208", "GSM112299", "GSM112300", "GSM112301", "GSM112302", "GSM112303", "GSM112304", "GSM112305", "GSM112306", "GSM112307", "GSM112308", "GSM112309", "GSM112310", "GSM112311", "GSM112312", "GSM112313", "GSM112314", "GSM112315", "GSM112316"], "sample_count": 20, "group_sizes": null, "group_sizes_basis": null, "platform": "3014", "taxon": "Homo sapiens", "title": "Gene expression profiling of circulating plasma RNA from colorectal cancer patients", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE7754", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE7754", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE7754", "version": null, "note": "Microarray data set GSE4988 and GSE7754 were downloaded from the GEO (http://www.ncbi.nlm.nih.gov/geo/) database. The GSE4988 data set contained 20 samples: 12 CRC samples and eight normal samples. These microarray data were analyzed using the GPL3014 (ResGenHs15K_DIO) platform.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Microarray data set GSE4988 and GSE7754 were downloaded from the GEO (http://www.ncbi.nlm.nih.gov/geo/) database. The GSE4988 data set contained 20 samples: 12 CRC samples and eight normal samples. These microarray data were analyzed using the GPL3014 (ResGenHs15K_DIO) platform.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM187631", "GSM187632", "GSM187633", "GSM187634"], "sample_count": 4, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Identification of human miR-34a-responsive transcripts", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:29197895:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:51aa4ad56361554457623800797ad147cd21ebd7ebef2a17e5552471ecd387b0", "bytes": 701, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#t1-medscimonit-23-5735", "version": null, "note": "Target genes and corresponding primer sets.", "structure": {"pmcid": "PMC5724350", "section_index": 7, "section_title": "Verification of related upregulated and downregulated genes", "row_count": 13, "column_count": 2}, "table": {"label": "Table 1", "caption": "Target genes and corresponding primer sets.", "rows": [["Target genes", "Primer sets"], ["SERPINE1", "Forward: TCTTCGATTGTCACCACCGA"], ["Reverse: TCAAGCTGGGAGTACTGTGG"], ["KLF4", "Forward: CCACCGGACCTACTTACTCG"], ["Reverse: AAGCCAAAACCCAAAACCCC"], ["SEMA4B", "Forward: CACTTGACCCTGTTTCCCAC"], ["Reverse: CAGCTCCTCAGGCCCATC"], ["PPARG", "Forward: AAGGAGTCAGAAACGGGGAG"], ["Reverse: TGGCATCTCTGTGTCAACCA"], ["CDC45", "Forward: TAGGCCAGTCAATGTCGTCA"], ["Reverse: GAAGGCTCTGACCCATCACT"], ["KIAA0101", "Forward: CAGAAAAGGTGAGGCGATCG"], ["Reverse: ATAACCTTACCCTGCCCCTG"]], "row_count": 13, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[7]/table-wrap[1]#t1-medscimonit-23-5735"}}, {"id": "asset:table:pmid:29197895:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:04d886aea9cd89be93dbd275c0a111e6e60b17cf82aac527a51027735f4327cd", "bytes": 905, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#t2a-medscimonit-23-5735", "version": null, "note": "The top 20 DEGs of CRC samples compared to normal samples.", "structure": {"pmcid": "PMC5724350", "section_index": 10, "section_title": "Identification of DEGs", "row_count": 21, "column_count": 3}, "table": {"label": "Table 2A", "caption": "The top 20 DEGs of CRC samples compared to normal samples.", "rows": [["Gene name", "P value", "LogFC"], ["DD×46", "4.49×10−05", "2.04625"], ["ARMC1", "0.000199", "3.348333"], ["HNRNPH3", "0.000284", "1.926875"], ["FAM46A", "0.000446", "−2.04625"], ["EPAS1", "0.000526", "2.98625"], ["HNRNPLL", "0.000576", "2.830833"], ["CRAT", "0.000714", "3.89375"], ["TNKS", "0.000876", "−1.9825"], ["GPR98", "0.0009", "−2.80917"], ["CCNT1", "0.00093", "−2.43167"], ["CB×1", "0.001027", "1.990417"], ["DGKZ", "0.001154", "1.722083"], ["CD83", "0.001174", "2.910417"], ["BAD", "0.001219", "−1.9975"], ["IPO11", "0.001407", "1.87375"], ["TRIP10", "0.001578", "−1.94583"], ["SMN2", "0.001641", "1.835"], ["RNF139", "0.001666", "2.78625"], ["EIF3A", "0.001693", "3.027083"], ["MCL1", "0.001921", "2.909583"]], "row_count": 21, "column_count": 3, "numeric_cells": 48, "header_rows": 1, "locator": "section[10]/table-wrap[1]#t2a-medscimonit-23-5735"}}, {"id": "asset:table:pmid:29197895:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e9c482f32f7c7f9c9d2126c8338590098ff25b203f1d86c6b39cea2db739940e", "bytes": 1048, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[2]#t2b-medscimonit-23-5735", "version": null, "note": "The top 20 DEGs of miR-34a transformed CRC samples compared to miR-34a non-transfected CRC samples.", "structure": {"pmcid": "PMC5724350", "section_index": 10, "section_title": "Identification of DEGs", "row_count": 21, "column_count": 3}, "table": {"label": "Table 2B", "caption": "The top 20 DEGs of miR-34a transformed CRC samples compared to miR-34a non-transfected CRC samples.", "rows": [["Gene name", "P value", "LogFC"], ["RRM2", "2.82×10−09", "3.34178"], ["NCAPG", "6.47×10−09", "2.849829"], ["PBK", "7.61×10−09", "2.939017"], ["ANLN", "7.74×10−09", "2.775134"], ["NMU", "9.14×10−09", "2.73189"], ["TMEM158", "9.14×10−09", "−2.68421"], ["CCNB1", "9.31×10−09", "2.897966"], ["KIF11", "9.33×10−09", "2.829634"], ["ANKRD29", "9.56×10−09", "−2.66631"], ["BUB1B", "1.17×10−08", "2.667052"], ["LURAP1L", "1.35×10−08", "−2.56479"], ["CDC20", "1.50×10−08", "2.758017"], ["ZWINT", "1.52×10−08", "2.640488"], ["MAD2L1", "2.08×10−08", "2.402782"], ["SHCBP1", "2.32×10−08", "2.956084"], ["PRC1", "2.59×10−08", "2.241771"], ["MND1", "2.87×10−08", "2.368264"], ["KIF14", "3.04×10−08", "2.958099"], ["STK39", "3.52×10−08", "−2.22861"], ["MKI67", "3.73×10−08", "2.522868"]], "row_count": 21, "column_count": 3, "numeric_cells": 47, "header_rows": 1, "locator": "section[10]/table-wrap[2]#t2b-medscimonit-23-5735"}}, {"id": "asset:table:pmid:29197895:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2eef9932360c3ceacac51bf5f51edf246cedc5acfb3117b05268adc7be32dd4f", "bytes": 981, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#t3-medscimonit-23-5735", "version": null, "note": "The enriched KEGG pathway for DEGs of CRC samples compared to normal samples, as well as DEGs of miR-34a transformed CRC samples compared to miR-34a non-transfected CRC samples.", "structure": {"pmcid": "PMC5724350", "section_index": 11, "section_title": "Function enrichment of DEGs", "row_count": 12, "column_count": 4}, "table": {"label": "Table 3", "caption": "The enriched KEGG pathway for DEGs of CRC samples compared to normal samples, as well as DEGs of miR-34a transformed CRC samples compared to miR-34a non-transfected CRC samples.", "rows": [["Category", "Pathway name", "Gene number", "P value"], ["KEGG pathway for DEGs-1"], ["KEGG pathway", "Basal transcription factors", "11", "0.025411"], ["KEGG pathways for DEGs-2"], ["KEGG pathway", "Cell cycle", "23", "1.39×10−14"], ["KEGG pathway", "DNA replication", "13", "6.43×10−12"], ["KEGG pathway", "Oocyte meiosis", "12", "2.69×10−05"], ["KEGG pathway", "Pyrimidine metabolism", "10", "2.28×10−04"], ["KEGG pathway", "Progesterone-mediated oocyte maturation", "8", "0.002809"], ["KEGG pathway", "p53 signaling pathway", "7", "0.003764"], ["KEGG pathway", "pathways in cancer", "15", "0.013212"], ["KEGG pathway", "Base excision repair", "4", "0.041781"]], "row_count": 12, "column_count": 4, "numeric_cells": 21, "header_rows": 1, "locator": "section[11]/table-wrap[1]#t3-medscimonit-23-5735"}}], "gaps": ["asset:data:geo:GSE4988 not downloaded", "asset:data:geo:GSE4988 licence not read", "asset:data:geo:GSE7754 not downloaded", "asset:data:geo:GSE7754 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "LIMMA package in R language was used to analyze the DEGs in CRC samples compared to normal samples (regarded as DEGs-1), as well as CRC samples transformed with miR-34a compared to non-transfected CRC samples (regarded as DEGs-2)."}}], "targets": [{"id": "target-published-estimate", "claim_id": "claim-target-result", "operation": "differential_expression_fit", "expected_value": 0.05, "unit": "p-value", "tolerance": null, "state": "complete", "note": "The threshold the paper applied to its own result, as the paper states it. A run that reproduces the effect is judged against this threshold."}], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE4988", "GSE7754"], "resolved_accessions": ["GSE4988", "GSE7754"], "statements": ["Microarray data set GSE4988 and GSE7754 were downloaded from the GEO (http://www.ncbi.nlm.nih.gov/geo/) database. The GSE4988 data set contained 20 samples: 12 CRC samples and eight normal samples. These microarray data were analyzed using the GPL3014 (ResGenHs15K_DIO) platform."], "basis": "The paper names GSE4988, GSE7754 in Gene Expression Omnibus (GEO) database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:29197895", "data:geo:GSE4988", "asset:table:pmid:29197895:1", "asset:table:pmid:29197895:2", "asset:table:pmid:29197895:3", "asset:table:pmid:29197895:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE4988"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:32:52Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 8, "usage": {"prompt_tokens": 64737, "completion_tokens": 4100, "cached_tokens": 2088}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:29197895", "type": "paper", "label": "pmid:29197895"}, {"id": "source:pmid:29197895", "type": "manuscript", "label": "PMID 29197895 full text"}, {"id": "data:geo:GSE4988", "type": "dataset", "label": "GEO GSE4988"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:29197895", "type": "paper", "label": "pmid:29197895"}, {"id": "source:pmid:29197895", "type": "manuscript", "label": "PMID 29197895 full text"}, {"id": "data:geo:GSE4988", "type": "dataset", "label": "GEO GSE4988"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-29197895", "type": "extraction", "used": ["source:pmid:29197895"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE4988", "type": "accession_resolution", "used": ["data:geo:GSE4988"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:29197895", "parent_hash": "sha256:ca25353073f1079fdaa500940f6189a2e56c2f0fd41e47fae736081078a63d8c", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE4988 licence not read", "asset:data:geo:GSE4988 not downloaded", "asset:data:geo:GSE7754 licence not read", "asset:data:geo:GSE7754 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["athogenesis of CRC. MATERIAL AND METHODS The microarray data of CRC samples and normal samples (GSE4"], "order_basis": "paper_text_order:246", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["CRC samples transformed with miR-34a and non-transfected CRC samples (GSE7754), were downloaded from", "ween miR-34a transformed CRC and miR-34a non-transfected CRC samples and they were enriched in 20 GO", "formed CRC samples compared with miR-34a non-transfected CRC samples. Two regulatory networks of miR-"], "order_basis": "paper_text_order:363", "id": "assay:2"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["LIMMA package in R language was used to analyze the DEGs in CRC samples compared to normal samples (regarded as DEGs-1), as well as CRC samples transformed with miR-34a compared to non-transfected CRC samples (regarded as DEGs-2)."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T03:03:07+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}