{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:29770536", "kind": "science-record", "revision": 9, "content_hash": "sha256:af10df7c1aebcae49f4b6be5fde6f62c8da484bd9bbf0bb409cf4830575a0b9c", "created_at": "2026-11-01T15:40:33Z", "updated_at": "2026-11-01T22:43:22Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Combination of IFITM1 knockdown and radiotherapy inhibits the growth of oral cancer.", "doi": "10.1111/cas.13640", "pmid": "29770536", "authors": ["Jie Yang", "Lei Li", "Yan Xi", "Ruimei Sun", "Hu Wang", "Yanxin Ren", "Liufang Zhao", "Xiaoli Wang", "Xiaojiang Li"], "journal": "Cancer science", "year": 2018, "abstract": "This research aimed to analyze the effect of IFITM1 on the radioresistance of oral neoplasm. Using a multi-group heat map from GSE9716 analysis of the GEO database, IFITM1 was determined to be a relevant radioresistance gene. The TCGA database was analyzed before the expression of IFITM1 was analyzed. IFITM1 expression was quantified by quantitative RT-PCR and immunohistochemistry in 19 paired oral neoplasm cases. The effects of time and dose of radiation on IFITM1 expression level in CAL27 and TSCC1 cell lines were tested by quantitative RT-PCR. Oral neoplasm cells were transfected with siRNA after radiotherapy to disturb IFITM1 expression. After this, the survival rates, cell apoptosis, caspase-3 viability, expression and γ-H2AX were detected using colony formation, flow cytometry, western blot and immunofluorescence, respectively. Western blot was used for STAT1/2/3/p21-related protein and phosphorylation changes. Finally, an in vivo nude mice tumor model was established to verify the effect of IFITM1 on oral neoplasm cells radioresistance. Through microarray analysis, the head and neck neoplasm radioresistance-related gene IFITM1 was found to be overexpressed. IFITM1 overexpression was verified not only using the TCGA database but also in 19 paired cases of oral neoplasm tissues and cells. With increases of dose and time of radiation, the expression of IFITM1 was increased in CAL27 and TSCC1 cell lines. Furthermore, si-IFITM1 may restrain cell proliferation, DNA damage and cell apoptosis in oral neoplasm cell lines. Finally, pSTAT1/2/p21 was found to be upregulated while pSTAT3/p-p21 was downregulated due to IFITM1 inhibition after radiotherapy. The evidence suggested that IFITM1 in combination with radiotherapy can inhibit oral neoplasm cells.", "claims": [{"id": "claim-method", "statement": "An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29770536", "locator": "sections[16] \"Statistical analysis\" paragraph 2", "quote": "An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA."}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29770536", "locator": "sections[15] \"Microarray\" paragraph 2", "quote": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:29770536"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE9716"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE9716"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:29770536", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/cas.13640", "sha256": "sha256:7461304302252a74164f204905c418a39fc115837080dfca301d640d4675c6bc", "bytes": 44940, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/cas.13640", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6172064", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE9716", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE9716", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE9716", "version": null, "note": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM245389", "GSM245390", "GSM245391", "GSM245392", "GSM245393", "GSM245394", "GSM245395", "GSM245396", "GSM245397", "GSM245398", "GSM245399", "GSM245400", "GSM245401", "GSM245402", "GSM245403", "GSM245404", "GSM245405", "GSM245406", "GSM245407", "GSM245408", "GSM245409", "GSM245410", "GSM245411", "GSM245412", "GSM245413", "GSM245414", "GSM245415", "GSM245416", "GSM245417", "GSM245418", "GSM245419", "GSM245420", "GSM245421", "GSM245422", "GSM245423", "GSM245424", "GSM245425", "GSM245426"], "sample_count": 38, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Radioresistant and radiosensitive tumors and cell lines", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:29770536:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:685569ccc46586933f4c4f2e7e400e4a7b59f6f3ec49dc8457a3dc6cb1957188", "bytes": 325, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#cas13640-tbl-0001", "version": null, "note": "siRNA sequences designed by BLOCK‐iT RNAi designer", "structure": {"pmcid": "PMC6172064", "section_index": 5, "section_title": "Cell transfection", "row_count": 3, "column_count": 2}, "table": {"label": "Table 1", "caption": "siRNA sequences designed by BLOCK‐iT RNAi designer", "rows": [["Gene", "Sequence (5′‐3′)"], ["SiIFITM1", "TGGTATTCGGCTCTGTGACAGTCTA"], ["SiNC", "TGGGCTTCTCGGTGTGACATATCTA"]], "row_count": 3, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[5]/table-wrap[1]#cas13640-tbl-0001"}}, {"id": "asset:table:pmid:29770536:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ec4b406e1471292085be74b118446276d192f4681eb77b6fb75776d3ebc3bdeb", "bytes": 409, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#cas13640-tbl-0002", "version": null, "note": "Primers for quantitative RT‐PCR", "structure": {"pmcid": "PMC6172064", "section_index": 7, "section_title": "Extraction of RNA and quantitative RT‐PCR", "row_count": 5, "column_count": 2}, "table": {"label": "Table 2", "caption": "Primers for quantitative RT‐PCR", "rows": [["Gene name", "Primer sequence (5′‐3′)"], ["IFITM1 forward", "TCGCCTACTCCGTGAAGTCTA"], ["IFITM1 reverse", "TGTCACAGAGCCGAATACCAG"], ["GAPDH forward", "TATAAATTGAGCCCGCAGCC"], ["GAPDH reverse", "TACGACCAAATCCGTTGACTC"]], "row_count": 5, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[7]/table-wrap[1]#cas13640-tbl-0002"}}, {"id": "asset:table:pmid:29770536:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:895546a741cba8d2807ac60ba0636757e71c3bee4e0e721f0de50d53ef56cff8", "bytes": 870, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#cas13640-tbl-0003", "version": null, "note": "Antibodies used for western blot, immunohistochemical staining and immunofluorescent staining", "structure": {"pmcid": "PMC6172064", "section_index": 13, "section_title": "Western blot", "row_count": 15, "column_count": 4}, "table": {"label": "Table 3", "caption": "Antibodies used for western blot, immunohistochemical staining and immunofluorescent staining", "rows": [["Protein", "Catalog", "Dilution", "Company"], ["IFITM1", "ab224063", "1/100", "Abcam"], ["Cleaved caspase3", "#9661", "1/500", "CST"], ["γH2AX", "ab2893", "1/500", "Abcam"], ["GAPDH", "ab181602", "1/10 000", "Abcam"], ["p‐STAT1(S727)", "ab109461", "1/5000", "Abcam"], ["STAT1", "ab31369", "1/1000", "Abcam"], ["p‐STAT2(Y690)", "ab53132", "1/3000", "Abcam"], ["STAT2", "ab134192", "1/2000", "Abcam"], ["p‐STAT3(S727)", "ab32143", "1/1000", "Abcam"], ["STAT3", "ab32500", "1/2000", "Abcam"], ["p‐p21(T145)", "ab47300", "1/200", "Abcam"], ["p21", "ab109520", "1/2000", "Abcam"], ["IgG‐HRP", "ab8227", "1/2000", "Abcam"], ["IgG‐Cy3", "ab6939", "1/500", "Abcam"]], "row_count": 15, "column_count": 4, "numeric_cells": 33, "header_rows": 1, "locator": "section[13]/table-wrap[1]#cas13640-tbl-0003"}}], "gaps": ["asset:data:geo:GSE9716 not downloaded", "asset:data:geo:GSE9716 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE9716"], "resolved_accessions": ["GSE9716"], "statements": ["GSE9716 containing 38 samples (from GSM245389 to GSM245426) was used to detect differentially‐expressed genes in radioresistant and radiosensitive human head and neck tumors before and after irradiation."], "basis": "The paper names GSE9716 in GEO and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:29770536", "data:geo:GSE9716", "asset:table:pmid:29770536:1", "asset:table:pmid:29770536:2", "asset:table:pmid:29770536:3"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE9716"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:11:41Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 34882, "completion_tokens": 998, "cached_tokens": 11912}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:29770536", "type": "paper", "label": "pmid:29770536"}, {"id": "source:pmid:29770536", "type": "manuscript", "label": "PMID 29770536 full text"}, {"id": "data:geo:GSE9716", "type": "dataset", "label": "GEO GSE9716"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:29770536", "type": "paper", "label": "pmid:29770536"}, {"id": "source:pmid:29770536", "type": "manuscript", "label": "PMID 29770536 full text"}, {"id": "data:geo:GSE9716", "type": "dataset", "label": "GEO GSE9716"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-29770536", "type": "extraction", "used": ["source:pmid:29770536"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE9716", "type": "accession_resolution", "used": ["data:geo:GSE9716"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:29770536", "parent_hash": "sha256:7e1609034c7261ee43f0a2df47a391d24b24616c081bc5810b18891651d6624c", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE9716 licence not read", "asset:data:geo:GSE9716 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["Combination of IFITM1 knockdown and radiotherapy inhibits the growth of oral", "uantitative RT-PCR. Oral neoplasm cells were transfected with siRNA after radiotherapy to disturb IFI", "R. Oral neoplasm cells were transfected with siRNA after radiotherapy to disturb IFITM1 express"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["on was quantified by quantitative RT-PCR and immunohistochemistry in 19 paired oral neoplasm cases. The effect", "formation, flow cytometry, western blot and immunofluorescence, respectively. Western blot was used for STA"], "order_basis": "paper_text_order:403", "id": "assay:2"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ession. After this, the survival rates, cell apoptosis, caspase-3 viability, expression and γ-H2AX", "rain cell proliferation, DNA damage and cell apoptosis in oral neoplasm cell lines. Finally, pSTAT1", "er this, the survival rates, cell apoptosis, caspase-3 viability, expression and γ-H2AX were dete"], "order_basis": "paper_text_order:727", "id": "assay:3"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["γ-H2AX were detected using colony formation, flow cytometry, western blot and immunofluorescence, respec"], "order_basis": "paper_text_order:819", "id": "assay:4"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["cted using colony formation, flow cytometry, western blot and immunofluorescence, respectively. Wester", "n blot and immunofluorescence, respectively. Western blot was used for STAT1/2/3/p21-related protein a"], "order_basis": "paper_text_order:835", "id": "assay:5"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["ein and phosphorylation changes. Finally, an in vivo nude mice tumor model was established to ver"], "order_basis": "paper_text_order:983", "id": "assay:6"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["oral neoplasm cells radioresistance. Through microarray analysis, the head and neck neoplasm radiore"], "order_basis": "paper_text_order:1108", "id": "assay:7"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["An unpaired student's t test was used to examine differences between groups. Differences among the groups of samples were assessed by one‐way ANOVA."], "order_basis": "consumes_earlier_output", "id": "assay:8"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:37:17+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}