{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30124448", "kind": "science-record", "revision": 5, "content_hash": "sha256:8b82fe6a13a90192d5118d2fc3c8fed4ba93c193308183b4cc73c1803adecfa5", "created_at": "2026-11-01T15:40:36Z", "updated_at": "2026-11-01T21:21:36Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Application of Weighted Gene Co-Expression Network Analysis to Explore the Key Genes in Alzheimer's Disease.", "doi": "10.3233/JAD-180400", "pmid": "30124448", "authors": ["Jia-Wei Liang", "Zheng-Yu Fang", "Yong Huang", "Zhen-Yu Liuyang", "Xiao-Lin Zhang", "Jing-Lin Wang", "Hui Wei", "Jian-Zhi Wang", "Xiao-Chuan Wang", "Ji Zeng", "Rong Liu"], "journal": "Journal of Alzheimer's disease : JAD", "year": 2018, "abstract": "BACKGROUND: Weighted co-expression network analysis (WGCNA) is a powerful systems biology method to describe the correlation of gene expression based on the microarray database, which can be used to facilitate the discovery of therapeutic targets or candidate biomarkers in diseases.\nOBJECTIVE: To explore the key genes in the development of Alzheimer's disease (AD) by using WGCNA.\nMETHODS: The whole gene expression data GSE1297 from AD and control human hippocampus was obtained from the GEO database in NCBI. Co-expressed genes were clustered into different modules. Modules of interest were identified through calculating the correlation coefficient between the module and phenotypic traits. GO and pathway enrichment analyses were conducted, and the central players (key hub genes) within the modules of interest were identified through network analysis. The expression of the identified key genes was confirmed in AD transgenic mice through using qRT-PCR.\nRESULTS: Two modules were found to be associated with AD clinical severity, which functioning mainly in mineral absorption, NF-κB signaling, and cGMP-PKG signaling pathways. Through analysis of the two modules, we found that metallothionein (MT), Notch2, MSX1, ADD3, and RAB31 were highly correlated with AD phenotype. Increase in expression of these genes was confirmed in aged AD transgenic mice.\nCONCLUSION: WGCNA analysis can be used to analyze and predict the key genes in AD. MT1, MT2, MSX1, NOTCH2, ADD3, and RAB31 are identified to be the most relevant genes, which may be potential targets for AD therapy.", "claims": [{"id": "claim-method", "statement": "Weighted gene co-expression network analysis (WGCNA) is a popular systems biology method used to describe the correlation of gene expression based on the microarray database [2].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30124448", "locator": "sections[1] \"INTRODUCTION\" paragraph 3", "quote": "Weighted gene co-expression network analysis (WGCNA) is a popular systems biology method used to describe the correlation of gene expression based on the microarray database [2]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30124448", "locator": "sections[3] \"Data acquisition and preprocessing\" paragraph 2", "quote": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30124448"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE1297"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE1297"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30124448", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3233/JAD-180400", "sha256": "sha256:764a999bf7ac46cd9044ebeb0a33fe391c88b08284efd522ac077652e322a075", "bytes": 33049, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3233/JAD-180400", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6218130", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE1297", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE1297", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE1297", "version": null, "note": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM21203", "GSM21204", "GSM21205", "GSM21206", "GSM21207", "GSM21208", "GSM21209", "GSM21210", "GSM21211", "GSM21212", "GSM21213", "GSM21214", "GSM21215", "GSM21216", "GSM21217", "GSM21218", "GSM21219", "GSM21220", "GSM21221", "GSM21222", "GSM21223", "GSM21224", "GSM21225", "GSM21226", "GSM21227", "GSM21228", "GSM21229", "GSM21230", "GSM21231", "GSM21232", "GSM21233"], "sample_count": 31, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Incipient Alzheimer's Disease: Microarray Correlation Analyses", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30124448:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d1b16baf648d885b7e2a231b6fae120b54720e78f1c715e9a21a8e98ab78be03", "bytes": 841, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#jad-65-jad180400-t001", "version": null, "note": "PCR primers for quantitative real-time PCR", "structure": {"pmcid": "PMC6218130", "section_index": 7, "section_title": "Total RNA isolation and qRT-PCR", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "PCR primers for quantitative real-time PCR", "rows": [["Gene", "Primer sequence (5’→*3’)"], ["ADD3", "F: TCGACCATGCAGTTTGACGA", "R:CACTCTGCGGTGACTGAGTT"], ["MT1", "F:CTCCTGCAAGAAGAGCTGCT", "R:CACAGCACGTGCACTTGTC"], ["MT2", "F:CTCCGATGGATCCTGCTCCT", "R:GGATGTAACCTGCCCAAGCT"], ["NOTCH2", "F:CTCCGATGCCACATCCTCTC", "R:GGATGTAACCTGCCCAAGCT"], ["RAB31", "F:CGGGAGCTCAAAGTGTGTCT", "R:CTGCAGCAGATCCTCGGTAG"], ["EHD1", "F:GTCCTTGAGTGGTTCGCAGA", "R:TAGACTCTGACCACCTCGGG"], ["VCAN", "F:GTTCCACATCACTGCTCCCA", "R:TAGACCTCCTCCACACTGGG"], ["MSX1", "F:AGTTCCGCCAGAAGCAGTAC", "R:GGACCGCCAAGAGGAAAAGA"], ["HEY2", "F:AGCTGCTTTCCACCATCTCC", "R:ACAGTGGCCGAAAGAGACAG"], ["EHD3", "F:TCCAGCCACTGAAGAGCAAG", "R:ATACATAGGCTTGTCCCGCG"]], "row_count": 11, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[7]/table-wrap[1]#jad-65-jad180400-t001"}}, {"id": "asset:table:pmid:30124448:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9aebe1a7f411d650bd83585a403ee5963d5b3e496a3d045c4a5669ad09fa3e7d", "bytes": 463, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#jad-65-jad180400-t002", "version": null, "note": "Module and the number of genes in each module", "structure": {"pmcid": "PMC6218130", "section_index": 10, "section_title": "Gene co-expression network construction and module identification", "row_count": 3, "column_count": 7}, "table": {"label": "Table 2", "caption": "Module and the number of genes in each module", "rows": [["Black 217", "Blue 936", "Brown 426", "Cyan 150", "Green 255", "Greenyellow 87", "Gray 137"], ["Grey60 32", "Lightcyan 39", "Lightgreen 35", "Magenta 140", "Turquoise1626", "Midnightblue 149", "Yellow281"], ["Purple 109", "Red 230", "Pink 199", "Salmon 50", "Tan 54"]], "row_count": 3, "column_count": 7, "numeric_cells": 19, "header_rows": 0, "locator": "section[10]/table-wrap[1]#jad-65-jad180400-t002"}}, {"id": "asset:table:pmid:30124448:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:58aa2c9e7882bf19c9c2e14c1eb39c49c62713706fe472e5b62a3d5e3e69c373", "bytes": 1102, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#jad-65-jad180400-t003", "version": null, "note": "KEGG pathway analysis of salmon module", "structure": {"pmcid": "PMC6218130", "section_index": 11, "section_title": "Finding module of interest and functional annotation", "row_count": 11, "column_count": 5}, "table": {"label": "Table 3", "caption": "KEGG pathway analysis of salmon module", "rows": [["geneset", "description", "C", "O", "P Value"], ["hsa04022", "cGMP-PKG signaling pathway - Homo sapiens (human)", "168", "3", "0.010725"], ["hsa05412", "Arrhythmogenic right ventricular cardiomyopathy (ARVC) - Homo sapiens (human)", "74", "2", "0.017684"], ["hsa04540", "Gap junction - Homo sapiens (human)", "88", "2", "0.024487"], ["hsa04970", "Salivary secretion - Homo sapiens (human)", "90", "2", "0 025534"], ["hsa04974", "Protein digestion and absorption - Homo sapiens (human)", "90", "2", "0.025534"], ["hsa04713", "Circadian entrainment - Homo sapiens (human)", "96", "2", "0.028785"], ["hsa04010", "MARK signaling pathway - Homo sapiens (human)", "255", "3", "0.03234"], ["hsa04725", "Cholinergic synapse - Homo sapiens (human)", "111", "2", "0.037592"], ["hsa04724", "Glutamatergic synapse - Homo sapiens (human)", "114", "2", "0.039465"], ["hsa04919", "Thyroid hormone signaling pathway - Homo sapiens (human)", "118", "2", "0.042017"]], "row_count": 11, "column_count": 5, "numeric_cells": 40, "header_rows": 1, "locator": "section[11]/table-wrap[1]#jad-65-jad180400-t003"}}, {"id": "asset:table:pmid:30124448:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d01fffb82bf3087c7c43f2261c3d76aadc148f140855d38abf251ea9abedf114", "bytes": 743, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[2]#jad-65-jad180400-t004", "version": null, "note": "KEGG pathway analysis of lightgreen module", "structure": {"pmcid": "PMC6218130", "section_index": 11, "section_title": "Finding module of interest and functional annotation", "row_count": 7, "column_count": 5}, "table": {"label": "Table 4", "caption": "KEGG pathway analysis of lightgreen module", "rows": [["geneset", "description", "C", "O", "P Value"], ["hsa04978", "Mineral absorption - Homo sapiens (human)", "52", "9", "1.23E-14"], ["hsa04064", "NF-kappa B signaling pathway - Homo sapiens (human)", "95", "2", "0.033744"], ["hsa00565", "Ether lipid metabolism - Homo sapiens (human)", "45", "1", "0.12943879"], ["hsa05030", "Cocaine addiction - Homo sapiens (human)", "49", "1", "0.14013605"], ["hsa04720", "Long-term potentiation - Homo sapiens (human)", "67", "1", "0.18674032"], ["hsa05031", "Amphetamine addiction - Homo sapiens (human)", "68", "1", "0.18925744"]], "row_count": 7, "column_count": 5, "numeric_cells": 24, "header_rows": 1, "locator": "section[11]/table-wrap[2]#jad-65-jad180400-t004"}}], "gaps": ["asset:data:geo:GSE1297 not downloaded", "asset:data:geo:GSE1297 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-2", "family": null, "specific": null, "label": "Weighted co-expression network analysis (WGCNA)", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Weighted gene co-expression network analysis (WGCNA) is a popular systems biology method used to describe the correlation of gene expression based on the microarray database [2]."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pathway_enrichment."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE1297"], "resolved_accessions": ["GSE1297"], "statements": ["The data used in this paper was obtained from the GEO database in NCBI (Gene Expression Omnibus, http://www.ncbi.nlm.gov/geo), and the data entry number is GSE1297."], "basis": "The paper names GSE1297 in GEO database in NCBI (Gene Expression Omnibus) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["pathway_enrich"], "assets": ["source:pmid:30124448", "data:geo:GSE1297", "asset:table:pmid:30124448:1", "asset:table:pmid:30124448:2", "asset:table:pmid:30124448:3", "asset:table:pmid:30124448:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE1297"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:12:12Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 26055, "completion_tokens": 940, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30124448", "type": "paper", "label": "pmid:30124448"}, {"id": "source:pmid:30124448", "type": "manuscript", "label": "PMID 30124448 full text"}, {"id": "data:geo:GSE1297", "type": "dataset", "label": "GEO GSE1297"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30124448", "type": "paper", "label": "pmid:30124448"}, {"id": "source:pmid:30124448", "type": "manuscript", "label": "PMID 30124448 full text"}, {"id": "data:geo:GSE1297", "type": "dataset", "label": "GEO GSE1297"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30124448", "type": "extraction", "used": ["source:pmid:30124448"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE1297", "type": "accession_resolution", "used": ["data:geo:GSE1297"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30124448", "parent_hash": "sha256:58be513b0c5260945727abcb86f9a75882a48790678c6689969b99230025aa40", "fork_of": null, "generation": 4}, "gaps": ["asset:data:geo:GSE1297 licence not read", "asset:data:geo:GSE1297 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["correlation of gene expression based on the microarray database, which can be used to facilitate th"], "order_basis": "paper_text_order:222", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["pathway enrichment"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T01:24:57+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}