{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30153287", "kind": "science-record", "revision": 7, "content_hash": "sha256:7ed937ba75d4432cb7407c7397e1e9e1c90d76a56436ee077d3734f24d73dc17", "created_at": "2026-11-01T15:40:36Z", "updated_at": "2026-11-01T22:00:00Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Circular RNAs hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 are predicted to promote CADM1 expression by functioning as miRNAs sponge in human osteosarcoma.", "doi": "10.1371/journal.pone.0202896", "pmid": "30153287", "authors": ["Gaoyang Chen", "Qingyu Wang", "Qiwei Yang", "Zhaoyan Li", "Zhenwu Du", "Ming Ren", "Haiyue Zhao", "Yang Song", "Guizhen Zhang"], "journal": "PloS one", "year": 2018, "abstract": "BACKGROUND: Osteosarcoma (OS) is a primary malignant bone tumor with a high fatality rate. Many circRNAs have been proved to play important roles in the pathogenesis of some diseases. However, the occurrence of circRNAs in OS remains little known.\nMETHODS: The circular RNA (circRNA) expression file GSE96964 dataset, which included seven osteosarcoma cell lines and one control sample (osteoblast cell line), was downloaded from the Gene Expression Omnibus (GEO) database to explore the potential function of circRNAs in osteosarcoma by competing endogenous RNA (ceRNA) analysis. Three gene expression profiles of OS were downloaded from GEO database and then used for the pathway enrichment analysis, Venn analysis and protein-protein interaction (PPI) network analysis. Real-time qPCR validation and RNA interference were conducted to verify our prediction.\nRESULTS: Differentially expressed circRNAs between OS and control, including 8 up-regulated and 102 down-regulated circRNAs, were generated and ceRNA analysis for 5 most up-regulated or 5 most down-regulated circRNAs in OS were then performed. The pathway enrichment analysis of gene expression profiles indicated differentially expressed genes (DEGs) of three gene profiles significantly enriched in cell cycle pathway, cell adhesion molecules (CAMs) pathway, oxidative phosphorylation pathway, cytokine-cytokine receptor interaction pathway, p53 signaling pathway and proteoglycans in cancer pathway, which were critical important pathways in the pathogenesis of OS. The Venn analysis showed that 2 (one is a pseudogene) up-regulated and 39 down-regulated DEGs were co-expressed in all three gene profiles. Then PPI networks of 41 co-expressed DEGs (up- and down-regulated DEGs) were constructed to predict their functions using the GeneMANIA. The expression levels of these related RNAs also matched our predictions really well.\nCONCLUSION: Ultimately, we found cell adhesion molecule 1 (CADM1) gene was not only a co-expression mRNA of the three mRNA expression profiles of OS, but also are predicted to be regulated by hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 by functioning as miRNAs 'Sponge' in human osteosarcoma. These over-expressed circRNAs may result in the over expression of CADM1 which promote the development of OS. We envision this discovery of these important moleculars, incuding hsa_circ_0032462, hsa_circ_0028173, hsa_circ_0005909 and CADM1 may lead to further development of new concepts, thus allowing for more opportunities in diagnosis and therapy of OS.", "claims": [{"id": "claim-method", "statement": "The adjust P values were utilized to reduce the false positive rate using Benjamini and Hochberg false discovery rate method by default [14].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30153287", "locator": "sections[4] \"Differential expression analysis\" paragraph 2", "quote": "The adjust P values were utilized to reduce the false positive rate using Benjamini and Hochberg false discovery rate method by default [14]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Our data are all contained within the paper.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30153287", "locator": "sections[23] \"Data Availability\" paragraph 2", "quote": "Our data are all contained within the paper."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30153287"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33382"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33382"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30153287", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1371/journal.pone.0202896", "sha256": "sha256:8c181ec4ceb3220334737d55688bcef33d4f0c1ca931f4cc2e603238e3096bbd", "bytes": 45306, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1371/journal.pone.0202896", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6112665", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE33382", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE33382", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE33382", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM825623", "GSM825624", "GSM825625", "GSM825626", "GSM825627", "GSM825628", "GSM825629", "GSM825630", "GSM825631", "GSM825632", "GSM825633", "GSM825634", "GSM825635", "GSM825636", "GSM825637", "GSM825638", "GSM825639", "GSM825640", "GSM825641", "GSM825642", "GSM825643", "GSM825644", "GSM825645", "GSM825646", "GSM825647", "GSM825648", "GSM825649", "GSM825650", "GSM825651", "GSM825652", "GSM825653", "GSM825654", "GSM825655", "GSM825656", "GSM825657", "GSM825658", "GSM825659", "GSM825660", "GSM825661", "GSM825662", "GSM825663", "GSM825664", "GSM825665", "GSM825666", "GSM825667", "GSM825668", "GSM825669", "GSM825670", "GSM825671", "GSM825672", "GSM825673", "GSM825674", "GSM825675", "GSM825676", "GSM825677", "GSM825678", "GSM825679", "GSM825680", "GSM825681", "GSM825682", "GSM825683", "GSM825684", "GSM825685", "GSM825686", "GSM825687", "GSM825688", "GSM825689", "GSM825690", "GSM825691", "GSM825692", "GSM825693", "GSM825694", "GSM825695", "GSM825696", "GSM825697", "GSM825698", "GSM825699", "GSM825700", "GSM825701", "GSM825702", "GSM825703", "GSM825704", "GSM825705", "GSM825706", "GSM825707", "GSM825708", "GSM825709"], "sample_count": 87, "group_sizes": null, "group_sizes_basis": null, "platform": "10295", "taxon": "Homo sapiens", "title": "Genome-wide gene expression analysis of high-grade osteosarcoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE36001", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36001", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE36001", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM879156", "GSM879157", "GSM879158", "GSM879159", "GSM879160", "GSM879161", "GSM879162", "GSM879163", "GSM879164", "GSM879165", "GSM879166", "GSM879167", "GSM879168", "GSM879169", "GSM879170", "GSM879171", "GSM879172", "GSM879173", "GSM879174", "GSM879175", "GSM879176", "GSM879177", "GSM879178", "GSM879179", "GSM879180"], "sample_count": 25, "group_sizes": null, "group_sizes_basis": null, "platform": "6102", "taxon": "Homo sapiens", "title": "Integrative analysis reveals relationships of genetic and epigenetic alterations in osteosarcoma [gene expression]", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE42352", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE42352", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE42352", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1038236", "GSM1038237", "GSM1038238", "GSM1038239", "GSM1038240", "GSM1038241", "GSM1038242", "GSM1038243", "GSM1038244", "GSM1038245", "GSM1038246", "GSM1038247", "GSM1038248", "GSM1038249", "GSM1038250", "GSM1038251", "GSM1038252", "GSM1038253", "GSM1038254", "GSM717846", "GSM717847", "GSM717848", "GSM717849", "GSM717850", "GSM717851", "GSM717852", "GSM717853", "GSM717854", "GSM717855", "GSM717856", "GSM717857", "GSM825623", "GSM825624", "GSM825625", "GSM825626", "GSM825627", "GSM825628", "GSM825629", "GSM825630", "GSM825631", "GSM825632", "GSM825633", "GSM825634", "GSM825635", "GSM825636", "GSM825637", "GSM825638", "GSM825639", "GSM825640", "GSM825641", "GSM825642", "GSM825643", "GSM825644", "GSM825645", "GSM825646", "GSM825647", "GSM825648", "GSM825649", "GSM825650", "GSM825651", "GSM825652", "GSM825653", "GSM825654", "GSM825655", "GSM825656", "GSM825657", "GSM825658", "GSM825659", "GSM825660", "GSM825661", "GSM825662", "GSM825663", "GSM825664", "GSM825665", "GSM825666", "GSM825667", "GSM825668", "GSM825669", "GSM825670", "GSM825671", "GSM825672", "GSM825673", "GSM825674", "GSM825675", "GSM825676", "GSM825677", "GSM825678", "GSM825679", "GSM825680", "GSM825681", "GSM825682", "GSM825683", "GSM825684", "GSM825685", "GSM825686", "GSM825687", "GSM825688", "GSM825689", "GSM825690", "GSM825691", "GSM825692", "GSM825693", "GSM825694", "GSM825695", "GSM825696", "GSM825697", "GSM825698", "GSM825699", "GSM825700", "GSM825701", "GSM825702", "GSM825703", "GSM825704", "GSM825705", "GSM825706", "GSM825707", "GSM825708", "GSM825709"], "sample_count": 118, "group_sizes": null, "group_sizes_basis": null, "platform": "10295", "taxon": "Homo sapiens", "title": "Genome-wide gene expression profiling of mesenchymal stem cells, osteosarcoma cells, and osteosarcoma cell lines.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE96964", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE96964", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE96964", "version": null, "note": "Our data are all contained within the paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Our data are all contained within the paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2546888", "GSM2546889", "GSM2546890", "GSM2546891", "GSM2546892", "GSM2546893", "GSM2546894", "GSM2546895"], "sample_count": 8, "group_sizes": null, "group_sizes_basis": null, "platform": "19978", "taxon": "Homo sapiens", "title": "Microarray expression profile and functional analysis of circular RNAs in osteosarcoma", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30153287:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:45bb6f203706a2589831ac4d63a46aa7562f3cb75f4463ba7dcce26758fab5e0", "bytes": 476, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#pone.0202896.t001", "version": null, "note": "The information of expression profiles.", "structure": {"pmcid": "PMC6112665", "section_index": 3, "section_title": "Microarray data", "row_count": 5, "column_count": 5}, "table": {"label": "Table 1", "caption": "The information of expression profiles.", "rows": [["", "Series", "Platforms", "OS cell lines/ biopsies", "Osteoblast cell lines"], ["circRNA profile", "GSE96964", "GPL19978", "7", "1"], ["gene profile 1", "GSE42352", "GPL10295", "19", "3"], ["gene profile 2", "GSE33382", "GPL10295", "84", "3"], ["gene profile 3", "GSE36001", "GPL6102", "19", "2"]], "row_count": 5, "column_count": 5, "numeric_cells": 19, "header_rows": 1, "locator": "section[3]/table-wrap[1]#pone.0202896.t001"}}, {"id": "asset:table:pmid:30153287:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:303aae7a383af96357ec985fc8b9ad14b811a66630f6d0149139e058bbe6fd49", "bytes": 678, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#pone.0202896.t002", "version": null, "note": "The primers of circRNAs and mRNA.", "structure": {"pmcid": "PMC6112665", "section_index": 10, "section_title": "Quantitative real-time PCR analysis and RNA interference", "row_count": 6, "column_count": 3}, "table": {"label": "Table 2", "caption": "The primers of circRNAs and mRNA.", "rows": [["Gene", "Primer sequences"], ["hsa_circ_0032462", "F: 5’- TGAAACTGGATGAACAAGGGAG-3’", "R: 5’- GCCGTCTGTGCCAACAAC-3’"], ["hsa_circ_0028173", "F: 5’- TCCGCTACCTCATCTCGT-3’", "R: 5’- GTTGCTACCACCACTCCC-3’"], ["hsa_circ_0005909", "F: 5’- GTATCCACTTGCCCTTTA -3’", "R: 5’- TTACTCCAGCCTGTCTC -3’"], ["CADM1", "F: 5’- CTGTGATTCAGCTACTGAATC -3’", "R: 5’- TAGAAAAATTCAGCAACTGAAAC -3’"], ["GAPDH", "F: 5’- CGGACCAATACGACCAAATCCG-3’", "R: 5’- AGCCACATCGCTCAGACACC-3’"]], "row_count": 6, "column_count": 3, "numeric_cells": 13, "header_rows": 1, "locator": "section[10]/table-wrap[1]#pone.0202896.t002"}}, {"id": "asset:table:pmid:30153287:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:73c503aed6be55b1b6029416cfdd94205a2b0d4ab2fe8e74383a0007729ca0ad", "bytes": 442, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#pone.0202896.t003", "version": null, "note": "The differentially expressed circRNAs and genes of the downloaded expression profiles.", "structure": {"pmcid": "PMC6112665", "section_index": 13, "section_title": "Differentially expressed circRNA and genes", "row_count": 5, "column_count": 4}, "table": {"label": "Table 3", "caption": "The differentially expressed circRNAs and genes of the downloaded expression profiles.", "rows": [["", "Up regulation", "Down regulation", "Total"], ["circRNA profile", "8", "102", "110"], ["gene profile 1", "456", "536", "991"], ["gene profile 2", "321", "524", "845"], ["gene profile 3", "67", "188", "255"]], "row_count": 5, "column_count": 4, "numeric_cells": 15, "header_rows": 1, "locator": "section[13]/table-wrap[1]#pone.0202896.t003"}}, {"id": "asset:table:pmid:30153287:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:62e8528e37e1e8240a4388e0e84de48378188a92470b0dbe2e2fa646a8ea64c9", "bytes": 577, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#pone.0202896.t004", "version": null, "note": "The co-expression DEGs of three gene expression profiles.", "structure": {"pmcid": "PMC6112665", "section_index": 16, "section_title": "The co-expressed DEGs", "row_count": 2, "column_count": 3}, "table": {"label": "Table 4", "caption": "The co-expression DEGs of three gene expression profiles.", "rows": [["", "Up-regulated DEGs", "Down-regulated DEGs"], ["co-expression DEGs", "CADM1, DNM1P46", "IGFBP4, PTX3, SERPINE1, COL8A1, AOX1, MAOA, ANGPTL4, TRNP1, PLPP3, NPR3, SRGN, SORBS2, TAGLN, LPAR1, CCL20, CAV1, ANPEP, LHFP, TFPI, ITPRIP, PYGB, RGS4, ITGA5, FKBP5, EPS8, PLIN2, CXCL5, CLCF1, FAM129B, NR2F1, FN1, CD59, TGFBR2, PRR16, LOXL3, OLAH, TBC1D2, CYGB, PDE7B"]], "row_count": 2, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[16]/table-wrap[1]#pone.0202896.t004"}}], "gaps": ["asset:data:geo:GSE33382 not downloaded", "asset:data:geo:GSE33382 licence not read", "asset:data:geo:GSE36001 not downloaded", "asset:data:geo:GSE36001 licence not read", "asset:data:geo:GSE42352 not downloaded", "asset:data:geo:GSE42352 licence not read", "asset:data:geo:GSE96964 not downloaded", "asset:data:geo:GSE96964 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-3", "family": null, "specific": null, "label": "Benjamini–Hochberg false discovery rate method", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The adjust P values were utilized to reduce the false positive rate using Benjamini and Hochberg false discovery rate method by default [14]."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE96964", "GSE42352", "GSE33382", "GSE36001"], "resolved_accessions": ["GSE96964", "GSE42352", "GSE33382", "GSE36001"], "statements": ["Our data are all contained within the paper."], "basis": "The paper names GSE96964, GSE42352, GSE33382, GSE36001 in Gene Expression Omnibus (GEO) database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:30153287", "data:geo:GSE33382", "asset:table:pmid:30153287:1", "asset:table:pmid:30153287:2", "asset:table:pmid:30153287:3", "asset:table:pmid:30153287:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE33382"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:12:12Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 37328, "completion_tokens": 2196, "cached_tokens": 648}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30153287", "type": "paper", "label": "pmid:30153287"}, {"id": "source:pmid:30153287", "type": "manuscript", "label": "PMID 30153287 full text"}, {"id": "data:geo:GSE33382", "type": "dataset", "label": "GEO GSE33382"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30153287", "type": "paper", "label": "pmid:30153287"}, {"id": "source:pmid:30153287", "type": "manuscript", "label": "PMID 30153287 full text"}, {"id": "data:geo:GSE33382", "type": "dataset", "label": "GEO GSE33382"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30153287", "type": "extraction", "used": ["source:pmid:30153287"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE33382", "type": "accession_resolution", "used": ["data:geo:GSE33382"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30153287", "parent_hash": "sha256:10a0bb5b3e4d6a8b6a1130f211723abb19d95dbf19811d01caf0f53666c4cda5", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE33382 licence not read", "asset:data:geo:GSE33382 not downloaded", "asset:data:geo:GSE36001 licence not read", "asset:data:geo:GSE36001 not downloaded", "asset:data:geo:GSE42352 licence not read", "asset:data:geo:GSE42352 not downloaded", "asset:data:geo:GSE96964 licence not read", "asset:data:geo:GSE96964 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["nteraction (PPI) network analysis. Real-time qPCR validation and RNA interference were conduct"], "order_basis": "paper_text_order:902", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["American Type Culture Collection (ATCC). All cell lines were cultured in DMEM (Dulbecco minimum essential medium;", "lture Collection (ATCC). All cell lines were cultured in DMEM (Dulbecco minimum essential medium; Gib", "tion The human osteosarcoma cell lines MG63, U2OS, 143B, HOS and the human osteoblast cell lin"], "order_basis": "paper_text_order:3623", "id": "assay:2"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:36:27+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}