{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32463597", "kind": "science-record", "revision": 9, "content_hash": "sha256:27229e20f61a597f1f682e1e5353f60cbfee7bf4ec605dd1e524d10802031a8d", "created_at": "2026-11-01T15:41:02Z", "updated_at": "2026-11-01T22:44:54Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "High expression of KITLG is a new hallmark activating the MAPK pathway in type A and AB thymoma.", "doi": "10.1111/1759-7714.13486", "pmid": "32463597", "authors": ["Zhaoyu Yang", "Shinan Liu", "Yuanguo Wang", "Yuan Chen", "Peng Zhang", "Yimei Liu", "Hui Zhang", "Peng Zhang", "Ziyou Tao", "Kai Xiong"], "journal": "Thoracic cancer", "year": 2020, "abstract": "BACKGROUND: KIT proto-oncogene ligand (KITLG) is a pleiotropic factor which is found in diverse cancers and is involved in cell proliferation, differentiation, and survival. However, the value of KITLG in thymoma remains unclear.\nMETHODS: A total of 121 thymoma samples from The Cancer Genome Atlas Thymoma (TCGA-THYM) dataset were used to analyze KITLG related genome-wide expression profiles, and microRNA profiles and methylation alterations and a GEO dataset-GSE29695, including 37 samples was used as verification. For cell-based studies, specific small interfering RNA targeting KITLG or a KITLG overexpression vector were used to clarify the changes of the MAPK pathway in an AB thymoma cell line Thy0517.\nRESULTS: Both datasets showed that high expression of KITLG was significantly associated with type A and AB thymoma. Through multiomic analysis of the TCGA-THYM, it was found that with the high expression of KITLG, there were 220 upregulated and 72 downregulated genes at the mRNA level, 79 positive and 78 negative miRNAs, 28 hypermethylation and 163 hypomethylation regions. In the thymoma cell line Thy0517, it was found that the expression of GRB2 and the phosphorylation levels of BRAF, MEK1/2, and ERK1/2 in the MAPK pathway were positively correlated with the change in KITLG.\nCONCLUSIONS: High expression of KITLG is a new hallmark of WHO type A and AB thymomas in which it might play a critical role through the activation of the MAPK signaling pathway. Additionally, it is hoped that KITLG will become a potential target for the diagnosis of type A and AB thymoma through further research in the future.\nKEY POINTS: SIGNIFICANT FINDINGS OF THE STUDY: KIT proto-oncogene ligand (KITLG) is a new hallmark of type A and AB thymomas which induce a series of aberrant alteration of mRNA, miRNA and DNA methylation. The expression of KITLG is significantly higher in type A and AB than other subtypes of thymoma.\nWHAT THIS STUDY ADDS: KITLG activated the MAPK signaling pathway to promote type A and AB thymoma which might be a potential diagnostic biomarker or target.", "claims": [{"id": "claim-method", "statement": "Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32463597", "locator": "sections[10] \"Statistical analysis\" paragraph 2", "quote": "Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package."}], "state": "complete"}, {"id": "claim-data-access", "statement": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32463597", "locator": "sections[3] \"Samples and genomics profile datasets\" paragraph 2", "quote": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32463597"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE29695"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE29695"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32463597", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/1759-7714.13486", "sha256": "sha256:eda5a7e49b0519320d10f539fc51027a9358d1067b0f97bb917a7bc4d74ae4d8", "bytes": 27688, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/1759-7714.13486", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7327682", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE29695", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE29695", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE29695", "version": null, "note": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM736670", "GSM736671", "GSM736672", "GSM736673", "GSM736674", "GSM736675", "GSM736676", "GSM736677", "GSM736678", "GSM736679", "GSM736680", "GSM736681", "GSM736682", "GSM736683", "GSM736684", "GSM736685", "GSM736686", "GSM736687", "GSM736688", "GSM736689", "GSM736690", "GSM736691", "GSM736692", "GSM736693", "GSM736694", "GSM736695", "GSM736696", "GSM736697", "GSM736698", "GSM736699", "GSM736700", "GSM736701", "GSM736702", "GSM736703", "GSM736704", "GSM736705", "GSM736706", "GSM736707", "GSM736708", "GSM736709", "GSM736710"], "sample_count": 41, "group_sizes": null, "group_sizes_basis": null, "platform": "8432", "taxon": "Homo sapiens", "title": "Gene Expression Analysis of Thymic Neoplasms", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32463597:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:329782353813830b04fca99fc8d0cccef24de7d0b3cb56d886fe418c1c647e2b", "bytes": 1202, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#tca13486-tbl-0001", "version": null, "note": "Primer sequences for real‐time PCR", "structure": {"pmcid": "PMC7327682", "section_index": 8, "section_title": "RNA extraction and real‐time PCR", "row_count": 17, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer sequences for real‐time PCR", "rows": [["Primers", "Sequences"], ["KITLG ‐ Forward", "5′‐ AGCCTTATACTGGAAGAAGAGAC ‐ 3′"], ["KITLG ‐ Reverse", "5′‐ GTTGATACAAGCCACAATTACAC ‐ 3′"], ["GRB2 ‐ Forward", "5′‐ TTCTCCCTCTCTGTCAAGTTTG ‐ 3′"], ["GRB2 ‐ Reverse", "5′‐ GTATGTCGGCTGCTGTGG ‐ 3′"], ["BRAF ‐ Forward", "5′‐ ATGCTGTGGTTCTTGTATCTTG ‐ 3′"], ["BRAF ‐ Reverse", "5′‐ GACTCCGCTCTCCTCTGG ‐ 3′"], ["MEK1 ‐ Forward", "5′‐ GAAGGAGATGCGGCTGAG ‐ 3′"], ["MEK1 ‐ Reverse", "5′‐ GAGGAGGCTCGTTGACTATG ‐ 3′"], ["MEK2 ‐ Forward", "5′‐ TCCTGGACTATATTGTGAACGAG ‐ 3′"], ["MEK2 ‐ Reverse", "5′‐ GTGTGGTTTGTGAGCATCTTC ‐ 3′"], ["ERK1 ‐ Forward", "5′‐ GACGGAGTATGTGGCTACG ‐ 3′"], ["ERK1 ‐ Reverse", "5′‐ CCAGGATGCCCAGAATGTG ‐ 3′"], ["ERK2 ‐ Forward", "5′‐ CCGAGTGACGAGCCCATC ‐ 3′"], ["ERK2 ‐ Reverse", "5′‐ GTCCTCTGAGCCCTTGTCC ‐ 3′"], ["GAPDH ‐ Forward", "5′‐GCTCTCTGCTCCTCCTGTTC‐ 3′"], ["GAPDH ‐ Reverse", "5′‐CGACCAAATCCGTTGACTCC‐ 3′"]], "row_count": 17, "column_count": 2, "numeric_cells": 16, "header_rows": 1, "locator": "section[8]/table-wrap[1]#tca13486-tbl-0001"}}, {"id": "asset:table:pmid:32463597:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:640f5a92b7d07854670d2760bc8d44b2aaef9f9a5c9cf9d30638426fdf059a93", "bytes": 846, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#tca13486-tbl-0002", "version": null, "note": "Primary antibodies for western blot analysis", "structure": {"pmcid": "PMC7327682", "section_index": 9, "section_title": "Western blot analysis", "row_count": 10, "column_count": 6}, "table": {"label": "Table 2", "caption": "Primary antibodies for western blot analysis", "rows": [["Antibody", "Manufacturer", "Product #", "Source", "Type", "Dilution"], ["KITLG", "Proteintech", "26 582‐1‐AP", "Rabbit", "Polyclonal", "1:800"], ["GRB2", "CST", "3239", "Rabbit", "Monoclonal", "1:1000"], ["BRAF", "Proteintech", "20 899‐1‐AP", "Rabbit", "Polyclonal", "1:800"], ["phospho‐BRAF", "CST", "2696", "Rabbit", "Polyclonal", "1:1000"], ["MEK1/2", "CST", "8727", "Rabbit", "Monoclonal", "1:1000"], ["phospho‐MEK1/2", "CST", "9154", "Rabbit", "Monoclonal", "1:1000"], ["ERK1/2", "CST", "4695", "Rabbit", "Monoclonal", "1:1000"], ["phospho‐ ERK1/2", "CST", "4370", "Rabbit", "Monoclonal", "1:2000"], ["GAPDH", "Proteintech", "60 004‐1‐Ig", "Mouse", "Monoclonal", "1:5000"]], "row_count": 10, "column_count": 6, "numeric_cells": 22, "header_rows": 1, "locator": "section[9]/table-wrap[1]#tca13486-tbl-0002"}}], "gaps": ["asset:data:geo:GSE29695 not downloaded", "asset:data:geo:GSE29695 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-3", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "limma"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE29695"], "resolved_accessions": ["GSE29695"], "statements": ["We obtained RNA‐seq gene expression version 2 (RNA Seq V2) level 3 data (Data Release 9.0, Release Date: October 24, 2017) from post‐surgery thymoma tissue samples from thymoma patients of each WHO type from the UCSC XENA website (http://xena.ucsc.edu/public). We performed the analysis of RNA‐seq data of 121 thymoma samples."], "basis": "The paper names GSE29695 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32463597", "data:geo:GSE29695", "asset:table:pmid:32463597:1", "asset:table:pmid:32463597:2"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE29695"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:20:08Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 22398, "completion_tokens": 2246, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32463597", "type": "paper", "label": "pmid:32463597"}, {"id": "source:pmid:32463597", "type": "manuscript", "label": "PMID 32463597 full text"}, {"id": "data:geo:GSE29695", "type": "dataset", "label": "GEO GSE29695"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32463597", "type": "paper", "label": "pmid:32463597"}, {"id": "source:pmid:32463597", "type": "manuscript", "label": "PMID 32463597 full text"}, {"id": "data:geo:GSE29695", "type": "dataset", "label": "GEO GSE29695"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32463597", "type": "extraction", "used": ["source:pmid:32463597"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE29695", "type": "accession_resolution", "used": ["data:geo:GSE29695"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32463597", "parent_hash": "sha256:495d936fa8c34e1b567ab2e26ac145468401df6f2ef9a066e9eee2c8fb6df8d1", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE29695 licence not read", "asset:data:geo:GSE29695 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["own the patent of this cell line. Cells were cultured in DMEM (Gibco) supplemented with 10% fetal bov"], "order_basis": "paper_text_order:3013", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["erformed using the R limma software package. qPCR and protein data were depicted as the mean ±"], "order_basis": "paper_text_order:3503", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Student's t‐test and multiple hypothesis correction were used to identify genome‐wide differences in gene, miRNA, and methylation profiles between the KITLGhigh and KITLGlow groups. All analyses were performed using the R limma software package."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T03:32:42+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}