{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32793465", "kind": "science-record", "revision": 6, "content_hash": "sha256:2269dcdd42d645c56cc17e5f20125ddae6ed84aa685752602e88a3e6b5145b08", "created_at": "2026-11-01T15:41:07Z", "updated_at": "2026-11-01T21:23:38Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of Aberrantly Methylated Differentially CpG Sites in Hepatocellular Carcinoma and Their Association With Patient Survival.", "doi": "10.3389/fonc.2020.01031", "pmid": "32793465", "authors": ["Renguo Guan", "Weimin Guo", "Weifeng Hong", "Ye Lin", "Xiongfeng Zou", "Ning Shi", "Dongyang Yang", "Yu Zhou", "Zhixiang Jian", "Haosheng Jin", "Weidong Lin", "Min Yu"], "journal": "Frontiers in oncology", "year": 2020, "abstract": "This study aimed to identify aberrantly methylated differentially methylated CpG sites (DMCs) and investigate their prognostic value in hepatocellular carcinoma (HCC). A total of 2,404 DMCs were selected from Gene Expression Omnibus (GEO) and validated by The Cancer Genome Atlas (TCGA). The TCGA cohort was divided into a training cohort and a validating cohort. First, the prognostic model based on six DMCs, including cg08351331, cg02910574, cg09947274, cg17589341, cg24652919, and cg26545968, was constructed based on the least absolute shrinkage and selection operator (LASSO) regression Cox analysis. The area under the curve (AUC) of the DMC-based model was 0.765 in the training cohort and 0.734 in the validating cohort. The accuracy of a model combining the DMC signature and American Joint Committee on Cancer (AJCC) stage, with an AUC of 0.795, was better than that of the DMCs or AJCC stage alone. Second, further analysis revealed that the methylation rate of cg08351331 was negatively associated with the expression of its relative gene, lipopolysaccharide-binding protein (LBP). Besides, the gene expression of LBP was significantly associated with poor overall survival in patients with hepatitis B virus (HBV) infection. Finally, these findings were confirmed by GSE57956 data and our own cohort. In conclusion, we established an accurate DMC-based prognostic model that could be combined with AJCC stage to improve the accuracy of prognostic prediction in HCC. Moreover, our preliminary data indicate that LBP may be a new key factor in HBV-induced HCC initiation through the regulation of its methylation.", "claims": [{"id": "claim-method", "statement": "Then, these survival-related DMCs were subjected to the least absolute shrinkage and selection operator (LASSO) regression Cox analysis (simulation times = 1,000) to identify a reliable DMC combination for HCC survival prediction.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32793465", "locator": "sections[6] \"Construction of the Prognosis Risk Model Based on DMCs\" paragraph 2", "quote": "Then, these survival-related DMCs were subjected to the least absolute shrinkage and selection operator (LASSO) regression Cox analysis (simulation times = 1,000) to identify a reliable DMC combination for HCC survival prediction."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32793465", "locator": "sections[17] \"Data Availability Statement\" paragraph 2", "quote": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32793465"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE37988"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE37988"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32793465", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fonc.2020.01031", "sha256": "sha256:d260bf67ce6ec982078d0a98d9892c40e6e25490e1361ffb44d68dcb172cffb7", "bytes": 55241, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fonc.2020.01031", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7390903", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE37988", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE37988", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE37988", "version": null, "note": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM931363", "GSM931364", "GSM931365", "GSM931366", "GSM931367", "GSM931368", "GSM931369", "GSM931370", "GSM931371", "GSM931372", "GSM931373", "GSM931374", "GSM931375", "GSM931376", "GSM931377", "GSM931378", "GSM931379", "GSM931380", "GSM931381", "GSM931382", "GSM931383", "GSM931384", "GSM931385", "GSM931386", "GSM931387", "GSM931388", "GSM931389", "GSM931390", "GSM931391", "GSM931392", "GSM931393", "GSM931394", "GSM931395", "GSM931396", "GSM931397", "GSM931398", "GSM931399", "GSM931400", "GSM931401", "GSM931402", "GSM931403", "GSM931404", "GSM931405", "GSM931406", "GSM931407", "GSM931408", "GSM931409", "GSM931410", "GSM931411", "GSM931412", "GSM931413", "GSM931414", "GSM931415", "GSM931416", "GSM931417", "GSM931418", "GSM931419", "GSM931420", "GSM931421", "GSM931422", "GSM931423", "GSM931424", "GSM931425", "GSM931426", "GSM931427", "GSM931428", "GSM931429", "GSM931430", "GSM931431", "GSM931432", "GSM931433", "GSM931434", "GSM931435", "GSM931436", "GSM931437", "GSM931438", "GSM931439", "GSM931440", "GSM931441", "GSM931442", "GSM931443", "GSM931444", "GSM931445", "GSM931446", "GSM931447", "GSM931448", "GSM931449", "GSM931450", "GSM931451", "GSM931452", "GSM931453", "GSM931454", "GSM931455", "GSM931456", "GSM931457", "GSM931458", "GSM931459", "GSM931460", "GSM931461", "GSM931462", "GSM931463", "GSM931464", "GSM931465", "GSM931466", "GSM931467", "GSM931468", "GSM931469", "GSM931470", "GSM931471", "GSM931472", "GSM931473", "GSM931474", "GSM931475", "GSM931476", "GSM931477", "GSM931478", "GSM931479", "GSM931480", "GSM931481", "GSM931482", "GSM931483", "GSM931484", "GSM931485", "GSM931486"], "sample_count": 124, "group_sizes": null, "group_sizes_basis": null, "platform": "8490", "taxon": "Homo sapiens", "title": "Methylation in Taiwanese HCC tumor and adjacent tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE54503", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE54503", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE54503", "version": null, "note": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1317042", "GSM1317043", "GSM1317044", "GSM1317045", "GSM1317046", "GSM1317047", "GSM1317048", "GSM1317049", "GSM1317050", "GSM1317051", "GSM1317052", "GSM1317053", "GSM1317054", "GSM1317055", "GSM1317056", "GSM1317057", "GSM1317058", "GSM1317059", "GSM1317060", "GSM1317061", "GSM1317062", "GSM1317063", "GSM1317064", "GSM1317065", "GSM1317066", "GSM1317067", "GSM1317068", "GSM1317069", "GSM1317070", "GSM1317071", "GSM1317072", "GSM1317073", "GSM1317074", "GSM1317075", "GSM1317076", "GSM1317077", "GSM1317078", "GSM1317079", "GSM1317080", "GSM1317081", "GSM1317082", "GSM1317083", "GSM1317084", "GSM1317085", "GSM1317086", "GSM1317087", "GSM1317088", "GSM1317089", "GSM1317090", "GSM1317091", "GSM1317092", "GSM1317093", "GSM1317094", "GSM1317095", "GSM1317096", "GSM1317097", "GSM1317098", "GSM1317099", "GSM1317100", "GSM1317101", "GSM1317102", "GSM1317103", "GSM1317104", "GSM1317105", "GSM1317106", "GSM1317107", "GSM1317108", "GSM1317109", "GSM1317110", "GSM1317111", "GSM1317112", "GSM1317113", "GSM1317114", "GSM1317115", "GSM1317116", "GSM1317117", "GSM1317118", "GSM1317119", "GSM1317120", "GSM1317121", "GSM1317122", "GSM1317123", "GSM1317124", "GSM1317125", "GSM1317126", "GSM1317127", "GSM1317128", "GSM1317129", "GSM1317130", "GSM1317131", "GSM1317132", "GSM1317133", "GSM1317134", "GSM1317135", "GSM1317136", "GSM1317137", "GSM1317138", "GSM1317139", "GSM1317140", "GSM1317141", "GSM1317142", "GSM1317143", "GSM1317144", "GSM1317145", "GSM1317146", "GSM1317147", "GSM1317148", "GSM1317149", "GSM1317150", "GSM1317151", "GSM1317152", "GSM1317153", "GSM1317154", "GSM1317155", "GSM1317156", "GSM1317157", "GSM1317158", "GSM1317159", "GSM1317160", "GSM1317161", "GSM1317162", "GSM1317163", "GSM1317164", "GSM1317165", "GSM1317166", "GSM1317167", "GSM1317168", "GSM1317169", "GSM1317170", "GSM1317171", "GSM1317172", "GSM1317173"], "sample_count": 132, "group_sizes": null, "group_sizes_basis": null, "platform": "13534", "taxon": "Homo sapiens", "title": "Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE57956", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE57956", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE57956", "version": null, "note": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1398525", "GSM1398526", "GSM1398527", "GSM1398528", "GSM1398529", "GSM1398530", "GSM1398531", "GSM1398532", "GSM1398533", "GSM1398534", "GSM1398535", "GSM1398536", "GSM1398537", "GSM1398538", "GSM1398539", "GSM1398540", "GSM1398541", "GSM1398542", "GSM1398543", "GSM1398544", "GSM1398545", "GSM1398546", "GSM1398547", "GSM1398548", "GSM1398549", "GSM1398550", "GSM1398551", "GSM1398552", "GSM1398553", "GSM1398554", "GSM1398555", "GSM1398556", "GSM1398557", "GSM1398558", "GSM1398559", "GSM1398560", "GSM1398561", "GSM1398562", "GSM1398563", "GSM1398564", "GSM1398565", "GSM1398566", "GSM1398567", "GSM1398568", "GSM1398569", "GSM1398570", "GSM1398571", "GSM1398572", "GSM1398573", "GSM1398574", "GSM1398575", "GSM1398576", "GSM1398577", "GSM1398578", "GSM1398579", "GSM1398580", "GSM1398581", "GSM1398582", "GSM1398583", "GSM1398584", "GSM1398585", "GSM1398586", "GSM1398587", "GSM1398588", "GSM1398589", "GSM1398590", "GSM1398591", "GSM1398592", "GSM1398593", "GSM1398594", "GSM1398595", "GSM1398596", "GSM1398597", "GSM1398598", "GSM1398599", "GSM1398600", "GSM1398601", "GSM1398602", "GSM1398603", "GSM1398604", "GSM1398605", "GSM1398606", "GSM1398607", "GSM1398608", "GSM1398609", "GSM1398610", "GSM1398611", "GSM1398612", "GSM1398613", "GSM1398614", "GSM1398615", "GSM1398616", "GSM1398617", "GSM1398618", "GSM1398619", "GSM1398620", "GSM1398621", "GSM1398622", "GSM1398623", "GSM1398624", "GSM1398625", "GSM1398626", "GSM1398627", "GSM1398628", "GSM1398629", "GSM1398630", "GSM1398631", "GSM1398632", "GSM1398633", "GSM1398634", "GSM1398635", "GSM1398636", "GSM1398637", "GSM1398638", "GSM1398639", "GSM1398640", "GSM1398641", "GSM1398642", "GSM1398643", "GSM1398644"], "sample_count": 120, "group_sizes": null, "group_sizes_basis": null, "platform": "8490", "taxon": "Homo sapiens", "title": "Methylation profile of Hepatocellular Carcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32793465:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fdbf6fd0a36bcb291036e8d0e05e3422430ef133ff55ed7c7007afbd8c782448", "bytes": 1446, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T1", "version": null, "note": "The detailed information of the six DMCs according to HumanMethylation450.", "structure": {"pmcid": "PMC7390903", "section_index": 14, "section_title": "Relationship of Methylation, Gene Expression, and Prognosis", "row_count": 7, "column_count": 7}, "table": {"label": "Table 1", "caption": "The detailed information of the six DMCs according to HumanMethylation450.", "rows": [["Name", "Forward_sequence", "Chromosome location", "Strand*", "Reference Gene", "Relation to gene content", "Relation to CpG island"], ["cg02910574", "AAAGTAGGAAGAAGCTAGAATACAAAGTTTTCCATCAGTTTTACCACGTGGAGCTGGAAG[CG]TTAAATATTTTAAACAACGGAGGTGCTGCCTGGGGCGGTAGTTCACACCTGTCCTCCCAG", "16", "F", "CHMP1A", "TSS1500", "S_Shore"], ["cg08351331", "CCGACAAGGGACTGCAGTATGGTAAGAAGCCACATCTGCTGGCTGGACTTGGCAAACCCA[CG]CTCCAGGCTGCTCTGGGTACAGTGGGGACAGGGAGTGGGGACACAGACCGGACCCTCTCC", "20", "R", "LBP", "Body", "_"], ["cg09947274", "ACTATCTTAGCCCAGTCAGGGAGCTCTGCTTCCTAGAAAGGCATCTTTCGCCAGTGGATT[CG]CCTCAAGGTTGAGGCCGCCATTGGAAGATGAAAAATTGCACTCCCTTGGTGTAGACAAAT", "2", "R", "CAD", "3′UTR", "N_Shore"], ["cg17589341", "CCAGGGGACCAGTTCCTTGGTGTTGCTTTGGCATTGATGCCTGAAGTGGGAGGAGAAAGC[CG]AGCCCACAAACACACAGAGCAGAGTGGGGCTCTGAGTATATAACTGTTAGGTGCCTCCCT", "18", "F", "SLC14A1", "TSS200;TSS200;TSS200", "_"], ["cg24652919", "GAGGTCAGCTAGAGCTAAAAATGGCACGATGAGGCAGGGCCTGAGGTCAGCTGTGAGGAC[CG]CCTGTGATTCTGCAGAAGGCCTGGCCAGTGGAGGAACCTACCTGAGTGGGGGCAGGGCTG", "16", "R", "HCFC1R1;THOC6", "Body;Body;Body;TSS1500; TSS1500", "N_Shore"], ["cg26545968", "GCCCTTTACGATGACCTAGTCCAACCCACTCATTGTACAGATTGGGAAACTGGGGCCCAG[CG]AGATTACTATTTAACAGCTTTGAAATGACTGCAGGAGGGAGAACACGAGGAAACATCCAA", "X", "F", "P2RY4", "TSS1500", "_"]], "row_count": 7, "column_count": 7, "numeric_cells": 17, "header_rows": 1, "locator": "section[14]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:32793465:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fb968885666e12eb5c65331475969bd617d14c4aeb9236725f2fdb0429b68710", "bytes": 2104, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#T2", "version": null, "note": "Prognostic value of LBP with different clinicopathological factors in the LIHC cohort of TCGA from Kaplan-Meier plotter database.", "structure": {"pmcid": "PMC7390903", "section_index": 15, "section_title": "The Prognostic Significance of LBP Is Dependent on the Hepatitis Virus Infection", "row_count": 37, "column_count": 8}, "table": {"label": "Table 2", "caption": "Prognostic value of LBP with different clinicopathological factors in the LIHC cohort of TCGA from Kaplan-Meier plotter database.", "rows": [["", "", "OS (n = 364)", "RFS (n = 316)"], ["", "", "Patient number", "P-value", "HR [95% CI]", "Patient number", "P-value", "HR [95% CI]"], ["Pathology"], ["Stage"], ["", "1 + 2", "253", "0.0062", "3.2 (1.33–7.69)", "227", "0.4262", "1.2 (0.77–1.88)"], ["", "3 + 4", "87", "0.0573", "0.56 (0.31–1.03)", "68", "", ""], ["Grade"], ["", "1", "55", "", "", "45", "", ""], ["", "2", "174", "0.0981", "1.57 (0.92–2.68)", "147", "0.3715", "1.25 (0.77–2.03)"], ["", "3", "118", "0.104", "1.65 (0.9–3.02)", "106", "0.1012", "0.63 (0.37–1.1)"], ["", "4", "12", "", "", "", "", ""], ["AJCC_T"], ["", "1", "180", "0.024", "1.97 (1.08–3.58)", "160", "0.3479", "1.31 (0.75–2.29)"], ["", "2", "90", "0.0288", "0.44 (0.21–0.94)", "79", "", ""], ["", "3", "78", "", "", "65", "", ""], ["", "4", "13", "", "", "6", "", ""], ["Vascular invasion"], ["", "None", "203", "0.1673", "1.43 (0.86–2.4)", "175", "0.1106", "1.49 (0.91–2.45)"], ["", "Micro", "90", "0.0451", "2.37 (0.99–5.64)", "81", "0.3381", "0.72 (0.36–1.42)"], ["", "Macro", "16", "", "", "14", "", ""], ["Patient"], ["Gender"], ["", "Male", "246", "0.124", "1.42 (0.91–2.21)", "208", "0.044", "0.64 (0.41–0.99)"], ["", "Female", "118", "0.0925", "0.6 (0.33–1.09)", "105", "0.2189", "1.47 (0.79–2.75)"], ["Race"], ["", "White", "181", "0.216", "0.72 (0.43–1.21)", "147", "0.1142", "0.67 (0.41–1.1)"], ["", "Black or African American", "17", "", "", "13", "", ""], ["", "Asian", "155", "0.0508", "1.83 (0.99–3.38)", "143", "0.1677", "0.69 (0.4–1.17)"], ["Sorafenib treatment"], ["", "Treated", "30", "", "", "22", "", ""], ["Risk factors"], ["Alcohol consumption"], ["", "Yes", "115", "0.1001", "0.57 (0.29–1.12)", "98", "0.1184", "0.61 (0.32–1.14)"], ["", "No", "202", "0.0332", "1.65 (1.04–2.62)", "183", "0.2877", "0.77 (0.47–1.25)"], ["Hepatitis virus"], ["", "Yes", "150", "0.005", "2.45 (1.28–4.67)", "138", "0.2678", "0.74 (0.44–1.26)"], ["", "No", "167", "0.0066", "0.52 (0.32–0.84)", "143", "0.1187", "0.66 (0.39–1.12)"]], "row_count": 37, "column_count": 8, "numeric_cells": 119, "header_rows": 2, "locator": "section[15]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:GSE37988 not downloaded", "asset:data:geo:GSE37988 licence not read", "asset:data:geo:GSE54503 not downloaded", "asset:data:geo:GSE54503 licence not read", "asset:data:geo:GSE57956 not downloaded", "asset:data:geo:GSE57956 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson correlation"}}, {"id": "method-2", "family": null, "specific": null, "label": "least absolute shrinkage and selection operator (LASSO) regression Cox analysis", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Then, these survival-related DMCs were subjected to the least absolute shrinkage and selection operator (LASSO) regression Cox analysis (simulation times = 1,000) to identify a reliable DMC combination for HCC survival prediction."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["pearson_r"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pearson."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE54503", "GSE57956", "GSE37988", "and GSE73003"], "resolved_accessions": ["GSE54503", "GSE57956", "GSE37988"], "statements": ["The datasets analyzed in this study can be found in the Cancer Genome Atlas (https://tcgadata.nci.nih.gov/tcga/); the NCBI Gene Expression Omnibus (GSE54503, GSE57956, GSE37988, and GSE73003)."], "basis": "The paper names GSE54503, GSE57956, GSE37988 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["pearson_r"], "assets": ["source:pmid:32793465", "data:geo:GSE37988", "asset:table:pmid:32793465:1", "asset:table:pmid:32793465:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE37988"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:22:03Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 39087, "completion_tokens": 1855, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32793465", "type": "paper", "label": "pmid:32793465"}, {"id": "source:pmid:32793465", "type": "manuscript", "label": "PMID 32793465 full text"}, {"id": "data:geo:GSE37988", "type": "dataset", "label": "GEO GSE37988"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32793465", "type": "paper", "label": "pmid:32793465"}, {"id": "source:pmid:32793465", "type": "manuscript", "label": "PMID 32793465 full text"}, {"id": "data:geo:GSE37988", "type": "dataset", "label": "GEO GSE37988"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32793465", "type": "extraction", "used": ["source:pmid:32793465"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE37988", "type": "accession_resolution", "used": ["data:geo:GSE37988"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32793465", "parent_hash": "sha256:b15e68da64af7741adcdfcc77c06e4e4dffcbe181cd84682c01e88c202bd7b8b", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE37988 licence not read", "asset:data:geo:GSE37988 not downloaded", "asset:data:geo:GSE54503 licence not read", "asset:data:geo:GSE54503 not downloaded", "asset:data:geo:GSE57956 licence not read", "asset:data:geo:GSE57956 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "methylation_array", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ni Kit (Qiagen, 51306, Hilden, Germany), and bisulfite was modified by using the EZ DNA Methylation", "e County, California, USA). Then, the sodium bisulfite conversion of genomic DNA was amplified usin"], "order_basis": "paper_text_order:2637", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["by the Applied Biosystems QuantStudio 7 Flex Real-Time PCR System, Shanghai, China. The methylation of"], "order_basis": "paper_text_order:3359", "id": "assay:2"}, {"role": "analysis", "definition_id": "correlation_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["pearson_r"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Pearson correlation"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T01:43:28+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}