{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32825936", "kind": "science-record", "revision": 6, "content_hash": "sha256:d4b549f6722d4f681ea8ac3889d6680c6bcddd736813fd092b49668c4dc4c652", "created_at": "2026-11-01T15:41:08Z", "updated_at": "2026-11-01T22:02:04Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of methylated-differentially expressed genes and pathways in esophageal squamous cell carcinoma.", "doi": "10.1016/j.prp.2020.153050", "pmid": "32825936", "authors": ["Liang Sang", "Zhanwu Yu", "Ang Wang", "Hao Li", "Xiantong Dai", "Liping Sun", "Hongxu Liu", "Yuan Yuan"], "journal": "Pathology, research and practice", "year": 2020, "abstract": "Methylation, as an epigenetic modification, can affect gene expression and play a role in the occurrence and development of cancer. This research is devoted to discover methylated-differentially expressed genes (MDEGs) in esophageal squamous cell carcinoma (ESCC) and explore special associated pathways. We downloaded GSE51287 methylation profiles and GSE26886 expression profiles from GEO DataSets, and performed a comprehensive bioinformatics analysis. Totally, 19 hypermethylated, lowly expressed genes (Hyper-LGs) were identified, and involved in regulation of cell proliferation, phosphorus metabolic process and protein kinase activity. Meanwhile, 17 hypomethylated, highly expressed genes (Hypo-HGs) were participated in collagen catabolic process, metallopeptidase and cytokine activity. Pathway analysis determined that Hyper-LGs were enriched in arachidonic acid metabolism pathway, while Hypo-HGs were primarily associated with the cytokine-cytokine receptor interaction pathway. IL 6, MMP3, MMP9, SPP1 were identified as hub genes based on the PPI network that combined 7 ranked methods included in cytoHubba, and verification was performed in human tissues. Our integrated analysis identified many novel genetic lesions in ESCC and provides a crucial molecular foundation to improve our understanding of ESCC. Hub genes, including IL 6, MMP3, MMP9 and SPP1, could be considered for use as aberrant methylation-based biomarkers to facilitate the accurate diagnosis and therapy of ESCC.", "claims": [{"id": "claim-method", "statement": "Differential expression between normal and ESCC tissue samples was identified using the online tool GEO2R (http://www.ncbi.nlm.nih.gov/geo/geo2r/) across experimental conditions in the GEO series. The multiple t-test was used to detect statistically significant genes, and the Benjamin & Hochberg false discovery rate method is selected.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32825936", "locator": "sections[4] \"Data process\" paragraph 2", "quote": "Differential expression between normal and ESCC tissue samples was identified using the online tool GEO2R (http://www.ncbi.nlm.nih.gov/geo/geo2r/) across experimental conditions in the GEO series. The multiple t-test was used to detect statistically significant genes, and the Benjamin & Hochberg false discovery rate method is selected."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The GSE51287 gene methylation microarray data comprise 98 ESCC and 93 normal tissue specimens (platform: GPL9183 Illumina GoldenGate Methylation Cancer Panel I); 9 ESCC and 19 normal squamous epithelial specimens are registered for GSE26886 (platform: GPL[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32825936", "locator": "sections[3] \"Microarray data\" paragraph 2", "quote": "The GSE51287 gene methylation microarray data comprise 98 ESCC and 93 normal tissue specimens (platform: GPL9183 Illumina GoldenGate Methylation Cancer Panel I); 9 ESCC and 19 normal squamous epithelial specimens are registered for GSE26886 (platform: GPL[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32825936"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE26886"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE26886"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32825936", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1016/j.prp.2020.153050", "sha256": "sha256:20f8e4ce506e217ad135f6eb991eafd89bec7e86fcf724b1f820a6976dbc04fb", "bytes": 36345, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1016/j.prp.2020.153050", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7283077", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE26886", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE26886", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE26886", "version": null, "note": "The GSE51287 gene methylation microarray data comprise 98 ESCC and 93 normal tissue specimens (platform: GPL9183 Illumina GoldenGate Methylation Cancer Panel I); 9 ESCC and 19 normal squamous epithelial specimens are registered for GSE26886 (platform: GPL[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE51287 gene methylation microarray data comprise 98 ESCC and 93 normal tissue specimens (platform: GPL9183 Illumina GoldenGate Methylation Cancer Panel I); 9 ESCC and 19 normal squamous epithelial specimens are registered for GSE26886 (platform: GPL[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM661721", "GSM661722", "GSM661723", "GSM661724", "GSM661725", "GSM661726", "GSM661727", "GSM661728", "GSM661729", "GSM661730", "GSM661731", "GSM661732", "GSM661733", "GSM661734", "GSM661735", "GSM661736", "GSM661737", "GSM661738", "GSM661739", "GSM661740", "GSM661741", "GSM661742", "GSM661743", "GSM661744", "GSM661745", "GSM661746", "GSM661747", "GSM661748", "GSM661749", "GSM661750", "GSM661751", "GSM661752", "GSM661753", "GSM661754", "GSM661755", "GSM661756", "GSM661757", "GSM661758", "GSM661759", "GSM661760", "GSM661761", "GSM661762", "GSM661763", "GSM661764", "GSM661765", "GSM661766", "GSM661767", "GSM661768", "GSM661769", "GSM661770", "GSM661771", "GSM661772", "GSM661773", "GSM661774", "GSM661775", "GSM661776", "GSM661777", "GSM661778", "GSM661779", "GSM661780", "GSM661781", "GSM661782", "GSM661783", "GSM661784", "GSM661785", "GSM661786", "GSM661787", "GSM661788", "GSM661789"], "sample_count": 69, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression profiling of Barrett's esophagus, adenocarcinoma, esophageal squamous epithelium and squamous cell carcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE51287", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE51287", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE51287", "version": null, "note": "The GSE51287 gene methylation microarray data comprise 98 ESCC and 93 normal tissue specimens (platform: GPL9183 Illumina GoldenGate Methylation Cancer Panel I); 9 ESCC and 19 normal squamous epithelial specimens are registered for GSE26886 (platform: GPL[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE51287 gene methylation microarray data comprise 98 ESCC and 93 normal tissue specimens (platform: GPL9183 Illumina GoldenGate Methylation Cancer Panel I); 9 ESCC and 19 normal squamous epithelial specimens are registered for GSE26886 (platform: GPL[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1241914", "GSM1241915", "GSM1241916", "GSM1241917", "GSM1241918", "GSM1241919", "GSM1241920", "GSM1241921", "GSM1241922", "GSM1241923", "GSM1241924", "GSM1241925", "GSM1241926", "GSM1241927", "GSM1241928", "GSM1241929", "GSM1241930", "GSM1241931", "GSM1241932", "GSM1241933", "GSM1241934", "GSM1241935", "GSM1241936", "GSM1241937", "GSM1241938", "GSM1241939", "GSM1241940", "GSM1241941", "GSM1241942", "GSM1241943", "GSM1241944", "GSM1241945", "GSM1241946", "GSM1241947", "GSM1241948", "GSM1241949", "GSM1241950", "GSM1241951", "GSM1241952", "GSM1241953", "GSM1241954", "GSM1241955", "GSM1241956", "GSM1241957", "GSM1241958", "GSM1241959", "GSM1241960", "GSM1241961", "GSM1241962", "GSM1241963", "GSM1241964", "GSM1241965", "GSM1241966", "GSM1241967", "GSM1241968", "GSM1241969", "GSM1241970", "GSM1241971", "GSM1241972", "GSM1241973", "GSM1241974", "GSM1241975", "GSM1241976", "GSM1241977", "GSM1241978", "GSM1241979", "GSM1241980", "GSM1241981", "GSM1241982", "GSM1241983", "GSM1241984", "GSM1241985", "GSM1241986", "GSM1241987", "GSM1241988", "GSM1241989", "GSM1241990", "GSM1241991", "GSM1241992", "GSM1241993", "GSM1241994", "GSM1241995", "GSM1241996", "GSM1241997", "GSM1241998", "GSM1241999", "GSM1242000", "GSM1242001", "GSM1242002", "GSM1242003", "GSM1242004", "GSM1242005", "GSM1242006", "GSM1242007", "GSM1242008", "GSM1242009", "GSM1242010", "GSM1242011", "GSM1242012", "GSM1242013", "GSM1242014", "GSM1242015", "GSM1242016", "GSM1242017", "GSM1242018", "GSM1242019", "GSM1242020", "GSM1242021", "GSM1242022", "GSM1242023", "GSM1242024", "GSM1242025", "GSM1242026", "GSM1242027", "GSM1242028", "GSM1242029", "GSM1242030", "GSM1242031", "GSM1242032", "GSM1242033", "GSM1242034", "GSM1242035", "GSM1242036", "GSM1242037", "GSM1242038", "GSM1242039", "GSM1242040", "GSM1242041", "GSM1242042", "GSM1242043", "GSM1242044", "GSM1242045", "GSM1242046", "GSM1242047", "GSM1242048", "GSM1242049", "GSM1242050", "GSM1242051", "GSM1242052", "GSM1242053", "GSM1242054", "GSM1242055", "GSM1242056", "GSM1242057", "GSM1242058", "GSM1242059", "GSM1242060", "GSM1242061", "GSM1242062", "GSM1242063", "GSM1242064", "GSM1242065", "GSM1242066", "GSM1242067", "GSM1242068", "GSM1242069", "GSM1242070", "GSM1242071", "GSM1242072", "GSM1242073", "GSM1242074", "GSM1242075", "GSM1242076", "GSM1242077", "GSM1242078", "GSM1242079", "GSM1242080", "GSM1242081", "GSM1242082", "GSM1242083", "GSM1242084", "GSM1242085", "GSM1242086", "GSM1242087", "GSM1242088", "GSM1242089", "GSM1242090", "GSM1242091", "GSM1242092", "GSM1242093", "GSM1242094", "GSM1242095", "GSM1242096", "GSM1242097", "GSM1242098", "GSM1242099", "GSM1242100", "GSM1242101", "GSM1242102", "GSM1242103", "GSM1242104", "GSM1242105", "GSM1242106", "GSM1242107", "GSM1242108", "GSM1242109", "GSM1242110", "GSM1242111", "GSM1242112", "GSM1242113", "GSM1242114", "GSM1242115", "GSM1242116", "GSM1242117", "GSM1242118", "GSM1242119", "GSM1242120", "GSM1242121", "GSM1242122", "GSM1242123", "GSM1242124", "GSM1242125", "GSM1242126", "GSM1242127", "GSM1242128", "GSM1242129", "GSM1242130", "GSM1242131", "GSM1242132", "GSM1242133", "GSM1242134", "GSM1242135", "GSM1242136", "GSM1242137", "GSM1242138", "GSM1242139", "GSM1242140", "GSM1242141", "GSM1242142", "GSM1242143", "GSM1242144", "GSM1242145", "GSM1242146", "GSM1242147", "GSM1242148", "GSM1242149", "GSM1242150", "GSM1242151", "GSM1242152", "GSM1242153", "GSM1242154", "GSM1242155", "GSM1242156", "GSM1242157", "GSM1242158", "GSM1242159", "GSM1242160", "GSM1242161", "GSM1242162", "GSM1242163", "GSM1242164", "GSM1242165", "GSM1242166", "GSM1242167", "GSM1242168", "GSM1242169", "GSM1242170", "GSM1242171", "GSM1242172", "GSM1242173", "GSM1242174", "GSM1242175", "GSM1242176", "GSM1242177", "GSM1242178", "GSM1242179", "GSM1242180", "GSM1242181", "GSM1242182", "GSM1242183", "GSM1242184", "GSM1242185", "GSM1242186", "GSM1242187", "GSM1242188", "GSM1242189", "GSM1242190", "GSM1242191", "GSM1242192", "GSM1242193", "GSM1242194", "GSM1242195", "GSM1242196", "GSM1242197", "GSM1242198", "GSM1242199", "GSM1242200", "GSM1242201"], "sample_count": 288, "group_sizes": null, "group_sizes_basis": null, "platform": "9183", "taxon": "Homo sapiens", "title": "Methylation profiles of esophageal squamous cell carcinoma patients and cancer-free individual in Taiwan.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32825936:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:cbaddf3d01aeb9e02a95fcb306283c02d34c47c96f44f6b95976a696c3c9281a", "bytes": 592, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#tbl0005", "version": null, "note": "BGS or MSP primer sequence.", "structure": {"pmcid": "PMC7283077", "section_index": 8, "section_title": "Verification of hub genes in human tissues", "row_count": 11, "column_count": 4}, "table": {"label": "Table 1", "caption": "BGS or MSP primer sequence.", "rows": [["Name", "Sequence", "method"], ["MMP9", "F", "GAATTTTGGGTTTTGGTTTTAG", "MSP"], ["R", "AAACTCTATCCTCTTTTTCCCTC"], ["MMP7", "F", "ATGGAGTTATTGGGTTAGAATT", "BGS"], ["R", "CCCTTCTTTAAATCTCCTTTTA", ""], ["MMP3", "F", "AATGGTTTTGTTGTTATTTGGAT", "BGS"], ["R", "TTACTCTAAAAACTCCCCACCT", ""], ["SPP1", "F", "TGGGGAAGTTTAAATTTTAAGG", "BGS"], ["R", "CCTACACAATCACCCACTAAA"], ["IL-6", "F", "TATTGAGATGTAAAGGAAGGAAGT", "BGS"], ["R", "TAAAAACATTAAAATCCCCAAA"]], "row_count": 11, "column_count": 4, "numeric_cells": 1, "header_rows": 1, "locator": "section[8]/table-wrap[1]#tbl0005"}}, {"id": "asset:table:pmid:32825936:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:217423467a39a2f8e19e7f7601c8f1feb7df849b3578d901b4e5a57ec2ce9fe3", "bytes": 280, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[2]#tbl0010", "version": null, "note": "PCR reaction conditions.", "structure": {"pmcid": "PMC7283077", "section_index": 8, "section_title": "Verification of hub genes in human tissues", "row_count": 5, "column_count": 3}, "table": {"label": "Table 2", "caption": "PCR reaction conditions.", "rows": [["", "94 °C", "5min"], ["40cyc", "94 °C", "20 s"], ["55 °C", "20 s"], ["72 °C", "30 s"], ["", "72 °C", "6min"]], "row_count": 5, "column_count": 3, "numeric_cells": 11, "header_rows": 1, "locator": "section[8]/table-wrap[2]#tbl0010"}}, {"id": "asset:table:pmid:32825936:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:787200912a4bf7d5702ce1fabbdd9296202fe447fc0db53c689084aeab1ce968", "bytes": 537, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[3]#tbl0015", "version": null, "note": "Realtime-PCR primer sequence.", "structure": {"pmcid": "PMC7283077", "section_index": 8, "section_title": "Verification of hub genes in human tissues", "row_count": 11, "column_count": 3}, "table": {"label": "Table 3", "caption": "Realtime-PCR primer sequence.", "rows": [["Name", "Sequence"], ["MMP9", "F", "GGGACGCAGACATCGTCATC"], ["R", "TCGTCATCGTCGAAATGGGC"], ["MMP7", "F", "GAGTGAGCTACAGTGGGAACA"], ["R", "CTATGACGCGGGAGTTTAACAT"], ["MMP3", "F", "CGGTTCCGCCTGTCTCAAG"], ["R", "CGCCAAAAGTGCCTGTCTT"], ["SPP1", "F", "CTCCATTGACTCGAACGACTC"], ["R", "CAGGTCTGCGAAACTTCTTAGAT"], ["IL-6", "F", "ACTCACCTCTTCAGAACGAATTG"], ["R", "CCATCTTTGGAAGGTTCAGGTTG"]], "row_count": 11, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[8]/table-wrap[3]#tbl0015"}}, {"id": "asset:table:pmid:32825936:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4d34f595ffbe3e3debe31172ace6cbcab37ae409499a5bc5d994892d46488e29", "bytes": 309, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[4]#tbl0020", "version": null, "note": "Realtime-PCR reaction conditions.", "structure": {"pmcid": "PMC7283077", "section_index": 8, "section_title": "Verification of hub genes in human tissues", "row_count": 6, "column_count": 3}, "table": {"label": "Table 4", "caption": "Realtime-PCR reaction conditions.", "rows": [["", "95 °C", "30 s"], ["40cyc", "95 °C", "10 s"], ["56 °C", "20 s"], ["72 °C", "30 s"], ["", "melting curve"], ["", "4 °C", "Hold"]], "row_count": 6, "column_count": 3, "numeric_cells": 10, "header_rows": 1, "locator": "section[8]/table-wrap[4]#tbl0020"}}, {"id": "asset:table:pmid:32825936:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:bf0a012589fe348f9069937b8cb1b1121bec322bfe2a4e246734ff97bc42e435", "bytes": 2669, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#tbl0025", "version": null, "note": "GO enrichment analysis of MDEGs related to ESCC.", "structure": {"pmcid": "PMC7283077", "section_index": 11, "section_title": "GO functional enrichment analysis", "row_count": 29, "column_count": 6}, "table": {"label": "Table 5", "caption": "GO enrichment analysis of MDEGs related to ESCC.", "rows": [["Category", "Term", "Count", "%", "PValue"], ["Hyper-LGs", "GOTERM_BP_FAT", "GO:0006468∼protein amino acid phosphorylation", "6", "31.58", "1.44E-03"], ["", "GOTERM_BP_FAT", "GO:0042127∼regulation of cell proliferation", "6", "31.58", "2.99E-03"], ["", "GOTERM_BP_FAT", "GO:0016310∼phosphorylation", "6", "31.58", "3.21E-03"], ["", "GOTERM_BP_FAT", "GO:0046777∼protein amino acid autophosphorylation", "3", "15.79", "5.59E-03"], ["", "GOTERM_BP_FAT", "GO:0006793∼phosphorus metabolic process", "6", "31.58", "7.41E-03"], ["", "GOTERM_CC_FAT", "GO:0012505∼endomembrane system", "4", "21.05", "4.12E-02"], ["", "GOTERM_CC_FAT", "GO:0044459∼plasma membrane part", "6", "31.58", "5.79E-02"], ["", "GOTERM_MF_FAT", "GO:0004672∼protein kinase activity", "6", "31.58", "8.44E-04"], ["", "GOTERM_MF_FAT", "GO:0004713∼protein tyrosine kinase activity", "4", "21.05", "1.22E-03"], ["", "GOTERM_MF_FAT", "GO:0004714∼transmembrane receptor protein tyrosine kinase activity", "3", "15.79", "3.39E-03"], ["", "GOTERM_MF_FAT", "GO:0005021∼vascular endothelial growth factor receptor activity", "2", "10.53", "1.04E-02"], ["", "GOTERM_MF_FAT", "GO:0005524∼ATP binding", "6", "31.58", "3.64E-02"], [""], ["Hypo-HGs", "GOTERM_BP_FAT", "GO:0030574∼collagen catabolic process", "4", "22.22", "1.53E-06"], ["", "GOTERM_BP_FAT", "GO:0044243∼multicellular organismal catabolic process", "4", "22.22", "3.47E-06"], ["", "GOTERM_BP_FAT", "GO:0032963∼collagen metabolic process", "4", "22.22", "4.37E-06"], ["", "GOTERM_BP_FAT", "GO:0044259∼multicellular organismal macromolecule metabolic process", "4", "22.22", "5.98E-06"], ["", "GOTERM_BP_FAT", "GO:0044236∼multicellular organismal metabolic process", "4", "22.22", "1.03E-05"], ["", "GOTERM_CC_FAT", "GO:0044421∼extracellular region part", "10", "55.56", "1.03E-06"], ["", "GOTERM_CC_FAT", "GO:0005615∼extracellular space", "9", "50.00", "1.03E-06"], ["", "GOTERM_CC_FAT", "GO:0005576∼extracellular region", "10", "55.56", "4.21E-04"], ["", "GOTERM_CC_FAT", "GO:0005578∼proteinaceous extracellular matrix", "5", "27.78", "7.09E-04"], ["", "GOTERM_CC_FAT", "GO:0031012∼extracellular matrix", "5", "27.78", "9.39E-04"], ["", "GOTERM_MF_FAT", "GO:0004222∼metalloendopeptidase activity", "4", "22.22", "2.59E-04"], ["", "GOTERM_MF_FAT", "GO:0008237∼metallopeptidase activity", "4", "22.22", "1.35E-03"], ["", "GOTERM_MF_FAT", "GO:0004175∼endopeptidase activity", "4", "22.22", "1.01E-02"], ["", "GOTERM_MF_FAT", "GO:0005509∼calcium ion binding", "5", "27.78", "2.29E-02"], ["", "GOTERM_MF_FAT", "GO:0005125∼cytokine activity", "3", "16.67", "2.35E-02"]], "row_count": 29, "column_count": 6, "numeric_cells": 108, "header_rows": 1, "locator": "section[11]/table-wrap[1]#tbl0025"}}, {"id": "asset:table:pmid:32825936:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:544c305ab19b62f3ae6ccc6fc15a798ea3c7e4e7e1464b78ce70a0ad7556d01f", "bytes": 529, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#tbl0030", "version": null, "note": "KEGG pathway analysis of MDEGs related to ESCC.", "structure": {"pmcid": "PMC7283077", "section_index": 12, "section_title": "KEGG pathway analysis", "row_count": 5, "column_count": 6}, "table": {"label": "Table 6", "caption": "KEGG pathway analysis of MDEGs related to ESCC.", "rows": [["Category", "Term", "Count", "%", "PValue"], ["Hyper-LGs", "KEGG_PATHWAY", "hsa00590:Arachidonic acid metabolism", "2", "10.53", "9.49E-02"], [""], ["Hypo-HGs", "KEGG_PATHWAY", "hsa04620:Toll-like receptor signaling pathway", "3", "16.67", "1.58E-02"], ["", "KEGG_PATHWAY", "hsa04060:Cytokine-cytokine receptor interaction", "3", "16.67", "9.06E-02"]], "row_count": 5, "column_count": 6, "numeric_cells": 12, "header_rows": 1, "locator": "section[12]/table-wrap[1]#tbl0030"}}, {"id": "asset:table:pmid:32825936:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:83cbc1cf95ec13a6228f8f9126a3164b7ef99a497cbd900c991df71c89f7985a", "bytes": 574, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#tbl0035", "version": null, "note": "Hub genes for Hypo-HGs ranked in cytoHubba.", "structure": {"pmcid": "PMC7283077", "section_index": 13, "section_title": "PPI network construction and cytoHubba analysis", "row_count": 7, "column_count": 8}, "table": {"label": "Table 7", "caption": "Hub genes for Hypo-HGs ranked in cytoHubba.", "rows": [["gene symbols", "Ranking methods in cytoHubba"], ["MCC", "DMNC", "MNC", "Degree", "EPC", "Closeness", "Radiality"], ["IL6", "1572", "0.42", "13", "13", "4.49", "13.50", "3.21"], ["MMP9", "1568", "0.53", "11", "11", "4.26", "12.33", "3.00"], ["MMP3", "1560", "0.67", "9", "9", "4.05", "11.33", "2.86"], ["MMP7", "1560", "0.67", "9", "9", "3.99", "11.33", "2.86"], ["SPP1", "1448", "0.54", "10", "10", "4.15", "11.83", "2.93"]], "row_count": 7, "column_count": 8, "numeric_cells": 35, "header_rows": 2, "locator": "section[13]/table-wrap[1]#tbl0035"}}, {"id": "asset:table:pmid:32825936:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d3261b418ff28e793feebeb62583aa476c46bd245f2daeae558737855ca1233b", "bytes": 1073, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#tbl0040", "version": null, "note": "Human tissue verification for hub genes.", "structure": {"pmcid": "PMC7283077", "section_index": 15, "section_title": "Verification in human tissues", "row_count": 17, "column_count": 5}, "table": {"label": "Table 8", "caption": "Human tissue verification for hub genes.", "rows": [["gene", "mRNA expression", "Methylation"], ["Median(25 %,75 %)a", "P value", "Median(25 %,75 %)", "P value"], ["MMP3", "", "0.290", "", "0.885"], ["Tumor", "3.700(4.020, 2.809)", "", "0.784(0.695, 0.825)", ""], ["Non-tumor", "4.326(5.601, 2.996)", "", "0.786(0.753, 0.870)", ""], ["MMP9", "", "0.096", "", "0.131"], ["Tumor", "2.757(3.192, 2.659)", "", "0.191(0.120, 0.539)", ""], ["Non-tumor", "3.265(3.574, 2.851)", "", "0.455(0.407, 0.546)", ""], ["MMP7", "", "0.510", "", "0.261"], ["Tumor", "3.796(4.243, 3.219)", "", "0.918(0.894, 0.959)", ""], ["Non-tumor", "3.016(4.999, 2.363)", "", "0.934(0.918, 0.951)", ""], ["SPP1", "", "0.033", "", "0.108"], ["Tumor", "2.411(3.244, 2.297)", "", "0.786(0.722, 0.866)", ""], ["Non-tumor", "3.552(4.330, 3.315)", "", "0.849(0.824, 0.882)", ""], ["IL-6", "", "0.345", "", "0.520"], ["Tumor", "4.083(4.533, 3.779)", "", "0.847(0.834, 0.910)", ""], ["Non-tumor", "4.608(5.253, 3.883)", "", "0.892(0.834, 0.932)", ""]], "row_count": 17, "column_count": 5, "numeric_cells": 33, "header_rows": 2, "locator": "section[15]/table-wrap[1]#tbl0040"}}], "gaps": ["asset:data:geo:GSE26886 not downloaded", "asset:data:geo:GSE26886 licence not read", "asset:data:geo:GSE51287 not downloaded", "asset:data:geo:GSE51287 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "PPI"}}, {"id": "method-2", "family": null, "specific": null, "label": "Multiple t-test with Benjamin–Hochberg false discovery rate adjustment, applied using GEO2R", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differential expression between normal and ESCC tissue samples was identified using the online tool GEO2R (http://www.ncbi.nlm.nih.gov/geo/geo2r/) across experimental conditions in the GEO series. The multiple t-test was used to detect statistically significant genes, and the Benjamin & Hochberg false discovery rate method is selected."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE51287", "GSE26886"], "resolved_accessions": ["GSE51287", "GSE26886"], "statements": ["The GSE51287 gene methylation microarray data comprise 98 ESCC and 93 normal tissue specimens (platform: GPL9183 Illumina GoldenGate Methylation Cancer Panel I); 9 ESCC and 19 normal squamous epithelial specimens are registered for GSE26886 (platform: GPL[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array)."], "basis": "The paper names GSE51287, GSE26886 in Gene Expression Omnibus (GEO) DataSets and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:32825936", "data:geo:GSE26886", "asset:table:pmid:32825936:1", "asset:table:pmid:32825936:2", "asset:table:pmid:32825936:3", "asset:table:pmid:32825936:4", "asset:table:pmid:32825936:5", "asset:table:pmid:32825936:6", "asset:table:pmid:32825936:7", "asset:table:pmid:32825936:8"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE26886"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:22:03Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 29933, "completion_tokens": 2014, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32825936", "type": "paper", "label": "pmid:32825936"}, {"id": "source:pmid:32825936", "type": "manuscript", "label": "PMID 32825936 full text"}, {"id": "data:geo:GSE26886", "type": "dataset", "label": "GEO GSE26886"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32825936", "type": "paper", "label": "pmid:32825936"}, {"id": "source:pmid:32825936", "type": "manuscript", "label": "PMID 32825936 full text"}, {"id": "data:geo:GSE26886", "type": "dataset", "label": "GEO GSE26886"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32825936", "type": "extraction", "used": ["source:pmid:32825936"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE26886", "type": "accession_resolution", "used": ["data:geo:GSE26886"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32825936", "parent_hash": "sha256:08768a55631337b28d8fa426df2d427f48c61d2a039de381a36da5ac093472ca", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE26886 licence not read", "asset:data:geo:GSE26886 not downloaded", "asset:data:geo:GSE51287 licence not read", "asset:data:geo:GSE51287 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["PPI"], "order_basis": "analysis_only", "id": "assay:1"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T01:22:38+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}