{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33312407", "kind": "science-record", "revision": 6, "content_hash": "sha256:13d41e32b53f759dc633f815331f31440a50e298f2f1d85cf8f53313d444fcd7", "created_at": "2026-11-01T15:41:19Z", "updated_at": "2026-11-01T21:24:17Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Glutathione metabolism is essential for self-renewal and chemoresistance of pancreatic cancer stem cells.", "doi": "10.4252/wjsc.v12.i11.1410", "pmid": "33312407", "authors": ["Petra Jagust", "Sonia Alcalá", "Bruno Sainz Jr", "Christopher Heeschen", "Patricia Sancho"], "journal": "World journal of stem cells", "year": 2020, "abstract": "BACKGROUND: Cellular metabolism regulates stemness in health and disease. A reduced redox state is essential for self-renewal of normal and cancer stem cells (CSCs). However, while stem cells rely on glycolysis, different CSCs, including pancreatic CSCs, favor mitochondrial metabolism as their dominant energy-producing pathway. This suggests that powerful antioxidant networks must be in place to detoxify mitochondrial reactive oxygen species (ROS) and maintain stemness in oxidative CSCs. Since glutathione metabolism is critical for normal stem cell function and CSCs from breast, liver and gastric cancer show increased glutathione content, we hypothesized that pancreatic CSCs also rely on this pathway for ROS detoxification.\nAIM: To investigate the role of glutathione metabolism in pancreatic CSCs.\nMETHODS: Primary pancreatic cancer cells of patient-derived xenografts (PDXs) were cultured in adherent or CSC-enriching sphere conditions to determine the role of glutathione metabolism in stemness. Real-time polymerase chain reaction (PCR) was used to validate RNAseq results involving glutathione metabolism genes in adherent vs spheres, as well as the expression of pluripotency-related genes following treatment. Public TCGA and GTEx RNAseq data from pancreatic cancer vs normal tissue samples were analyzed using the webserver GEPIA2. The glutathione-sensitive fluorescent probe monochlorobimane was used to determine glutathione content by fluorimetry or flow cytometry. Pharmacological inhibitors of glutathione synthesis and recycling [buthionine-sulfoximine (BSO) and 6-Aminonicotinamide (6-AN), respectively] were used to investigate the impact of glutathione depletion on CSC-enriched cultures. Staining with propidium iodide (cell cycle), Annexin-V (apoptosis) and CD133 (CSC content) were determined by flow cytometry. Self-renewal was assessed by sphere formation assay and response to gemcitabine treatment was used as a readout for chemoresistance.\nRESULTS: Analysis of our previously published RNAseq dataset E-MTAB-3808 revealed up-regulation of genes involved in the KEGG (Kyoto Encyclopedia of Genes and Genomes) Pathway Glutathione Metabolism in CSC-enriched cultures compared to their differentiated counterparts. Consistently, in pancreatic cancer patient samples the expression of most of these up-regulated genes positively correlated with a stemness signature defined by NANOG, KLF4, SOX2 and OCT4 expression (P < 10-5). Moreover, 3 of the upregulated genes (MGST1, GPX8, GCCT) were associated with reduced disease-free survival in patients [Hazard ratio (HR) 2.2-2.5; P = 0.03-0.0054], suggesting a critical role for this pathway in pancreatic cancer progression. CSC-enriched sphere cultures also showed increased expression of different glutathione metabolism-related genes, as well as enhanced glutathione content in its reduced form (GSH). Glutathione depletion with BSO induced cell cycle arrest and apoptosis in spheres, and diminished the expression of stemness genes. Moreover, treatment with either BSO or the glutathione recycling inhibitor 6-AN inhibited self-renewal and the expression of the CSC marker CD133. GSH content in spheres positively correlated with intrinsic resistance to gemcitabine treatment in different PDXs r = 0.96, P = 5.8 × 1011). Additionally, CD133+ cells accumulated GSH in response to gemcitabine, which was abrogated by BSO treatment (P < 0.05). Combined treatment with BSO and gemcitabine-induced apoptosis in CD133+ cells to levels comparable to CD133- cells and significantly diminished self-renewal (P < 0.05), suggesting that chemoresistance of CSCs is partially dependent on GSH metabolism.\nCONCLUSION: Our data suggest that pancreatic CSCs depend on glutathione metabolism. Pharmacological targeting of this pathway showed that high GSH content is essential to maintain CSC functionality in terms of self-renewal and chemoresistance.", "claims": [{"id": "claim-data-access", "statement": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33312407", "locator": "sections[33] \"Data sharing statement\" paragraph 2", "quote": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33312407"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:E-MTAB-3808"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {"hazard_ratio": "Hazard ratio was calculated using th"}, "inputs": ["data:geo:E-MTAB-3808"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33312407", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.4252/wjsc.v12.i11.1410", "sha256": "sha256:b83ff33ead4738016b79ab369c70731888887cba9f3fabb1b2e7bae266e63bb8", "bytes": 55838, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.4252/wjsc.v12.i11.1410", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7705467", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:E-MTAB-3808", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=E-MTAB-3808", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "E-MTAB-3808", "version": null, "note": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": null, "resolution_checked_at": "2026-10-31T18:28:59Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33312407:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0ffde8107480532d8c5cee6994b7e56a442c23cef6d13103ac76fdcbc44136ab", "bytes": 1187, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#T1", "version": null, "note": "List of utilized primers", "structure": {"pmcid": "PMC7705467", "section_index": 7, "section_title": "RNA preparation and real-time polymerase chain reaction", "row_count": 37, "column_count": 2}, "table": {"label": "Table 1", "caption": "List of utilized primers", "rows": [["Gene", "Primer"], ["HPRT", ""], ["Forward", "TGACCTTGATTTATTTTGCATACC"], ["Reverse", "CGAGCAAGACGTTCAGTCCT"], ["GCLC", ""], ["Forward", "GCCGCTGAGCTGGGAGGAAA"], ["Reverse", "ATTCCACCTCATCGCCCCACT"], ["GPX1", ""], ["Forward", "TATCGAGAATGTGGCGTCCC"], ["Reverse", "GATGCCCAAACTGGTTGCAC"], ["GPX2", ""], ["Forward", "GGACATCAGGAGAACTGTCAGA"], ["Reverse", "TCAGGTAGGCGAAGACAGGA"], ["GGT1", ""], ["Forward", "CAACCTGCCCACAGTGAAGA"], ["Reverse", "TTCTTGGCCTCCATGACTGC"], ["GGT2", ""], ["Forward", "CCCTTCTTTCAGTGGGAGGG"], ["Reverse", "ATGCTGTCACCTTTGTGGCT"], ["GSTM1", ""], ["Forward", "AGGAAAAGAAGTACACGATGGG"], ["Reverse", "TTGCTCTGGGTGATCTTGTG"], ["GSTA1", ""], ["Forward", "CAACCTGCCCACAGTGAAGA"], ["Reverse", "TTCTTGGCCTCCATGACTGC"], ["GSTA2", ""], ["Forward", "CCCTTCTTTCAGTGGGAGGG"], ["Reverse", "ATGCTGTCACCTTTGTGGCT"], ["GSTA", ""], ["Forward", "TCCGTGAGATGGGTTTTAGC"], ["Reverse", "CTGTACCAACTTCATCCCGTC"], ["IDH1", ""], ["Forward", "CAAGTGACGGAACCCAAAAG"], ["Reverse", "ACCCTTAGACAGAGCCATTTG"], ["IDH2", ""], ["Forward", "ACAACACCGACGAGTCCATC"], ["Reverse", "GCCCATCGTAGGCTTTCAGT"]], "row_count": 37, "column_count": 2, "numeric_cells": 0, "header_rows": 1, "locator": "section[7]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33312407:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b1875a216e5f94e76e99978e1ec261be33e9732f56c47d26c88805b39f5cedde", "bytes": 814, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#T2", "version": null, "note": "RNAseq reveals that glutathione metabolism genes are up-regulated in cancer stem cell-enriched cultures from pancreatic cancer patient-derived xenografts", "structure": {"pmcid": "PMC7705467", "section_index": 16, "section_title": "Connection of glutathione metabolism with stemness in human pancreatic cancer samples", "row_count": 6, "column_count": 5}, "table": {"label": "Table 2", "caption": "RNAseq reveals that glutathione metabolism genes are up-regulated in cancer stem cell-enriched cultures from pancreatic cancer patient-derived xenografts", "rows": [["PDX", "GGTs", "GSTs", "GPXs", "Synthesis and recycling"], ["PDX185", "GGT1, GGT2, GGT3P, GGT6, GGT7", "GSTA1, GSTA2, GSTT1, MGST2, MGST3", "GPX2, GPX3", "GCLC, GSR, PGD, IDH1"], ["PDX215", "GGT1, GGT2, GGT7, GGT8P", "GSTA1, GSTA4, GSTM2, GSTM4, MGST2", "", "OPLAH, IDH1"], ["PDX253", "GGT1, GGT2, GGT3P, GGT6", "GSTA1, GSTA2, GSTA4, MGST1, MGST2, MGST3", "GPX2, GPX8", "GSR, IDH1"], ["PDX354", "", "GSTA1, GSTA2, MGST1, GSTM2", "GPX3, GPX8", "GCLC, GGCT, IDH1"], ["PDX265", "", "GSTA4, GSTM1, GSTM2, GSTM4", "GPX2", "GGCT, PGD, IDH1, IDH2"]], "row_count": 6, "column_count": 5, "numeric_cells": 5, "header_rows": 1, "locator": "section[16]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:E-MTAB-3808 not downloaded", "asset:data:geo:E-MTAB-3808 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {"hazard_ratio": "Hazard ratio was calculated using th"}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "Cox Proportional Hazards"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["cox_ph"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: cox_proportional_hazards."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["E-MTAB-3808"], "resolved_accessions": ["E-MTAB-3808"], "statements": ["RNAseq dataset E-MTAB-3808 is available at https://www.ebi.ac.uk/arrayexpress/."], "basis": "The paper names E-MTAB-3808 in Array Express and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["cox_ph"], "assets": ["source:pmid:33312407", "data:geo:E-MTAB-3808", "asset:table:pmid:33312407:1", "asset:table:pmid:33312407:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:E-MTAB-3808"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:18:35Z", "independence": "single_reader"}, "evidence_check": {"method": "absent", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 43662, "completion_tokens": 1965, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33312407", "type": "paper", "label": "pmid:33312407"}, {"id": "source:pmid:33312407", "type": "manuscript", "label": "PMID 33312407 full text"}, {"id": "data:geo:E-MTAB-3808", "type": "dataset", "label": "GEO E-MTAB-3808"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33312407", "type": "paper", "label": "pmid:33312407"}, {"id": "source:pmid:33312407", "type": "manuscript", "label": "PMID 33312407 full text"}, {"id": "data:geo:E-MTAB-3808", "type": "dataset", "label": "GEO E-MTAB-3808"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33312407", "type": "extraction", "used": ["source:pmid:33312407"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-E-MTAB-3808", "type": "accession_resolution", "used": ["data:geo:E-MTAB-3808"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33312407", "parent_hash": "sha256:d2f604c8fb6c4f2947c9bde536263b3163c0ce62df1e91b1488ad3e88cad1f88", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:E-MTAB-3808 licence not read", "asset:data:geo:E-MTAB-3808 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "clinical_cohort", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["METHODS: Primary pancreatic cancer cells of patient-derived xenografts (PDXs) were cultured in adherent", "e flow cytometry histograms of the indicated patient-derived xenograft models; B: Correlation of genes th", "ell-enriched cultures from pancreatic cancer patient-derived xenografts We have previously demonstrated t", "n-CSCs in primary pancreatic cancer cells of patient-derived xenografts were carried out by culturing in"], "order_basis": "paper_text_order:915", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ls of patient-derived xenografts (PDXs) were cultured in adherent or CSC-enriching sphere conditions", "B-3808 comparing 5 different PDAC PDX models cultured in differentiating (adherent) or CSC-enriching"], "order_basis": "paper_text_order:953", "id": "assay:2"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ermine glutathione content by fluorimetry or flow cytometry. Pharmacological inhibitors of glutathione s", ") and CD133 (CSC content) were determined by flow cytometry. Self-renewal was assessed by sphere formati", "tures vs adherent cultures, as determined by flow cytometry. Representative flow cytometry histograms of", "determined by flow cytometry. Representative flow cytometry histograms of the indicated patient-derived"], "order_basis": "paper_text_order:1532", "id": "assay:3"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["th propidium iodide (cell cycle), Annexin-V (apoptosis) and CD133 (CSC content) were determined by", "etion with BSO induced cell cycle arrest and apoptosis in spheres, and diminished the expression of", "d treatment with BSO and gemcitabine-induced apoptosis in CD133+ cells to levels comparable to CD13", "orobimane), cell cycle (propidium iodide) or apoptosis (Annexin-V) were determined by fluorimetry o"], "order_basis": "paper_text_order:1833", "id": "assay:4"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ression analyses were performed by RNAseq or real-time PCR. Public TCGA and GTEx RNAseq data from pancr"], "order_basis": "paper_text_order:7739", "id": "assay:5"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["cox_ph"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Cox Proportional Hazards"], "order_basis": "consumes_earlier_output", "id": "assay:6"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:52:36+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}