{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33622336", "kind": "science-record", "revision": 8, "content_hash": "sha256:fd692b0ebef479335215c409aeeb97761e8362265cbd341a8f014e1754604512", "created_at": "2026-11-01T15:41:26Z", "updated_at": "2026-11-01T22:46:10Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of key pathways and genes in polycystic ovary syndrome via integrated bioinformatics analysis and prediction of small therapeutic molecules.", "doi": "10.1186/s12958-021-00706-3", "pmid": "33622336", "authors": ["Praveenkumar Devarbhavi", "Lata Telang", "Basavaraj Vastrad", "Anandkumar Tengli", "Chanabasayya Vastrad", "Iranna Kotturshetti"], "journal": "Reproductive biology and endocrinology : RB&E", "year": 2021, "abstract": "To enhance understanding of polycystic ovary syndrome (PCOS) at the molecular level; this investigation intends to examine the genes and pathways associated with PCOS by using an integrated bioinformatics analysis. Based on the expression profiling by high throughput sequencing data GSE84958 derived from the Gene Expression Omnibus (GEO) database, the differentially expressed genes (DEGs) between PCOS samples and normal controls were identified. We performed a functional enrichment analysis. A protein-protein interaction (PPI) network, miRNA- target genes and TF - target gene networks, were constructed and visualized, with which the hub gene nodes were identified. Validation of hub genes was performed by using receiver operating characteristic (ROC) and RT-PCR. Small drug molecules were predicted by using molecular docking. A total of 739 DEGs were identified, of which 360 genes were up regulated and 379 genes were down regulated. GO enrichment analysis revealed that up regulated genes were mainly involved in peptide metabolic process, organelle envelope and RNA binding and the down regulated genes were significantly enriched in plasma membrane bounded cell projection organization, neuron projection and DNA-binding transcription factor activity, RNA polymerase II-specific. REACTOME pathway enrichment analysis revealed that the up regulated genes were mainly enriched in translation and respiratory electron transport and the down regulated genes were mainly enriched in generic transcription pathway and transmembrane transport of small molecules. The top 10 hub genes (SAA1, ADCY6, POLR2K, RPS15, RPS15A, CTNND1, ESR1, NEDD4L, KNTC1 and NGFR) were identified from PPI network, miRNA - target gene network and TF - target gene network. The modules analysis showed that genes in modules were mainly associated with the transport of respiratory electrons and signaling NGF, respectively. We find a series of crucial genes along with the pathways that were most closely related with PCOS initiation and advancement. Our investigations provide a more detailed molecular mechanism for the progression of PCOS, detail information on the potential biomarkers and therapeutic targets.", "claims": [{"id": "claim-method", "statement": "The limma [11] in R bioconductor package was used to analyze the DEGs between PCOS samples and normal control samples in the expression profiling by high throughput sequencing data of GSE84958. The adjusted P-value and [logFC] were calculated. The Benjamini & Hochberg false discovery rate method was used as a correction factor for the adjusted P-value in limma [12].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33622336", "locator": "sections[4] \"Identification of DEGs\" paragraph 2", "quote": "The limma [11] in R bioconductor package was used to analyze the DEGs between PCOS samples and normal control samples in the expression profiling by high throughput sequencing data of GSE84958. The adjusted P-value and [logFC] were calculated. The Benjamini & Hochberg false discovery rate method was used as a correction factor for the adjusted P-value in limma [12]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets supporting the conclusions of this article are available in the GEO (http://www.ncbi.nlm.nih.gov/geo) repository. [(GSE84958) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84958)]", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33622336", "locator": "sections[25] \"notes\" paragraph 1", "quote": "The datasets supporting the conclusions of this article are available in the GEO (http://www.ncbi.nlm.nih.gov/geo) repository. [(GSE84958) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84958)]"}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33622336"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE84958"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {"fdr_threshold": "with Benjamini–Hochberg false discovery rate correction"}, "inputs": ["data:geo:GSE84958"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33622336", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12958-021-00706-3", "sha256": "sha256:8417c66f86fdaad7480e2c76172ad52b9bde0835e13adba9f74e4d7988bf6e71", "bytes": 100732, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12958-021-00706-3", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7901211", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE84958", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84958", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE84958", "version": null, "note": "The datasets supporting the conclusions of this article are available in the GEO (http://www.ncbi.nlm.nih.gov/geo) repository. [(GSE84958) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84958)]", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets supporting the conclusions of this article are available in the GEO (http://www.ncbi.nlm.nih.gov/geo) repository. [(GSE84958) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84958)]", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2254708", "GSM2254709", "GSM2254710", "GSM2254711", "GSM2254712", "GSM2254713", "GSM2254714", "GSM2254715", "GSM2254716", "GSM2254717", "GSM2254718", "GSM2254719", "GSM2254720", "GSM2254721", "GSM2254722", "GSM2254723", "GSM2254724", "GSM2254725", "GSM2254726", "GSM2254727", "GSM2254728", "GSM2254729", "GSM2254730", "GSM2254731", "GSM2254732", "GSM2254733", "GSM2254734", "GSM2254735", "GSM2254736", "GSM2254737", "GSM2254738", "GSM2254739", "GSM2254740", "GSM2254741", "GSM2254742", "GSM2254743", "GSM2254744", "GSM2254745", "GSM2254746", "GSM2254747", "GSM2254748", "GSM2254749", "GSM2254750", "GSM2254751", "GSM2254752", "GSM2254753", "GSM2254754", "GSM2254755", "GSM2254756", "GSM2254757", "GSM2254758", "GSM2254759", "GSM2254760"], "sample_count": 53, "group_sizes": null, "group_sizes_basis": null, "platform": "16791", "taxon": "Homo sapiens", "title": "AKR1C3-mediated adipose androgen generation fuels an adverse metabolic phenotype in polycystic ovary syndrome (PCOS)", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33622336:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:44d0cf3e60aece51e25b4742155ec584b2693f0aeda578626302871d955b2349", "bytes": 70045, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#Tab2", "version": null, "note": "The statistical metrics for key differentially expressed genes (DEGs)", "structure": {"pmcid": "PMC7901211", "section_index": 4, "section_title": "Identification of DEGs", "row_count": 740, "column_count": 7}, "table": {"label": "Table 2", "caption": "The statistical metrics for key differentially expressed genes (DEGs)", "rows": [["Gene Symbol", "logFC", "p Value", "adj. P.Val", "t value", "Regulation", "Gene Name"], ["SAA2", "4.381364", "3.5E-07", "0.00095", "5.718643", "Up", "serum amyloid A2"], ["PLOD2", "4.201209", "5.64E-07", "0.001025", "5.593469", "Up", "procollagen-lysine,2-oxoglutarate 5-dioxygenase 2"], ["ABI3BP", "4.13442", "2.07E-07", "0.000779", "5.856015", "Up", "ABI family member 3 binding protein"], ["RPPH1", "4.09338", "7.43E-06", "0.002243", "4.901502", "Up", "ribonuclease P RNA component H1"], ["C7orf50", "4.074966", "4.01E-07", "0.00095", "5.683289", "Up", "chromosome 7 open reading frame 50"], ["RMRP", "3.989952", "7.74E-06", "0.002243", "4.890252", "Up", "RNA component of mitochondrial RNA processing endoribonuclease"], ["BNIP3", "3.899781", "2.99E-07", "0.00095", "5.760151", "Up", "BCL2 interacting protein 3"], ["POLE4", "3.874065", "6.35E-07", "0.001025", "5.562056", "Up", "DNA polymerase epsilon 4, accessory subunit"], ["RHBDD2", "3.854997", "4.02E-06", "0.001884", "5.068914", "Up", "rhomboid domain containing 2"], ["F13A1", "3.806046", "1.82E-06", "0.001545", "5.283097", "Up", "coagulation factor XIII A chain"], ["SIVA1", "3.784719", "7.02E-07", "0.001025", "5.535746", "Up", "SIVA1 apoptosis inducing factor"], ["TMEM54", "3.721", "1.5E-09", "1.98E-05", "7.116347", "Up", "transmembrane protein 54"], ["SBDS", "3.630263", "1.28E-05", "0.002885", "4.75139", "Up", "SBDS ribosome maturation factor"], ["CERS2", "3.600241", "1.32E-06", "0.001336", "5.368773", "Up", "ceramide synthase 2"], ["PLA2G2A", "3.575964", "6.92E-07", "0.001025", "5.539611", "Up", "phospholipase A2 group IIA"], ["SAA1", "3.551756", "0.000565", "0.017754", "3.640098", "Up", "serum amyloid A1"], ["PHB2", "3.526406", "1.39E-05", "0.003049", "4.728928", "Up", "prohibitin 2"], ["LSM14A", "3.514098", "2.94E-06", "0.001776", "5.153832", "Up", "LSM14A mRNA processing body assembly factor"], ["MRPL20", "3.513535", "4.93E-05", "0.005042", "4.370518", "Up", "mitochondrial ribosomal protein L20"], ["NEDD8", "3.493441", "7.9E-06", "0.002265", "4.884608", "Up", "NEDD8 ubiquitin like modifier"], ["LRRC59", "3.487927", "5.07E-08", "0.000334", "6.219575", "Up", "leucine rich repeat containing 59"], ["NAA38", "3.483141", "0.000119", "0.008042", "4.113375", "Up", "N (alpha)-acetyltransferase 38, NatC auxiliary subunit"], ["R3HDM4", "3.472879", "0.000181", "0.009987", "3.989599", "Up", "R3H domain containing 4"], ["PI4KB", "3.463829", "2.36E-05", "0.003497", "4.579687", "Up", "phosphatidylinositol 4-kinase beta"], ["RPS27L", "3.462436", "6.2E-05", "0.005556", "4.304481", "Up", "ribosomal protein S27 like"], ["UBL5", "3.458582", "4.83E-05", "0.005015", "4.376605", "Up", "ubiquitin like 5"], ["S100A1", "3.431536", "0.000323", "0.013388", "3.813673", "Up", "S100 calcium binding protein A1"], ["TEAD3", "3.414631", "1.1E-08", "9.64E-05", "6.611182", "Up", "TEA domain transcription factor 3"], ["PRELID1", "3.395554", "1.51E-05", "0.003137", "4.706077", "Up", "PRELI domain containing 1"], ["SNCG", "3.381526", "0.001426", "0.0285", "3.342577", "Up", "synuclein gamma"], ["NDUFAF3", "3.380114", "3.84E-05", "0.00453", "4.442043", "Up", "NADH:ubiquinoneoxidoreductase complex assembly factor 3"], ["LOC101926960", "3.379084", "8.99E-05", "0.006783", "4.196554", "Up", "uncharacterized LOC101926960"], ["MRAP", "3.376232", "0.000186", "0.010117", "3.981504", "Up", "melanocortin 2 receptor accessory protein"], ["EIF1AX", "3.363678", "3.15E-05", "0.004025", "4.498903", "Up", "eukaryotic translation initiation factor 1A X-linked"], ["FIS1", "3.36153", "0.000316", "0.01319", "3.819875", "Up", "fission, mitochondrial 1"], ["LSM4", "3.342924", "2.22E-06", "0.001669", "5.229869", "Up", "LSM4 homolog, U6 small nuclear RNA and mRNA degradation associated"], ["MRPL24", "3.341155", "8.03E-05", "0.006322", "4.229412", "Up", "mitochondrial ribosomal protein L24"], ["ZNF32", "3.328313", "2.03E-06", "0.001623", "5.253128", "Up", "zinc finger protein 32"], ["SAP18", "3.320223", "3.41E-05", "0.004196", "4.47629", "Up", "Sin3A associated protein 18"], ["ZFAND6", "3.310728", "6.93E-05", "0.005946", "4.272145", "Up", "zinc finger AN1-type containing 6"], ["PLCG2", "3.309309", "2.45E-05", "0.003542", "4.570246", "Up", "phospholipase C gamma 2"], ["COA4", "3.297112", "1.12E-06", "0.001179", "5.412446", "Up", "cytochrome c oxidase assembly factor 4 homolog"], ["GTF3A", "3.27873", "0.000407", "0.015016", "3.742231", "Up", "general transcription factor IIIA"], ["SMIM19", "3.278578", "1.23E-05", "0.002829", "4.763305", "Up", "small integral membrane protein 19"], ["DYNLL2", "3.274028", "1.21E-05", "0.002818", "4.76751", "Up", "dynein light chain LC8-type 2"], ["WSB2", "3.272902", "0.000138", "0.008726", "4.070129", "Up", "WD repeat and SOCS box containing 2"], ["MMAB", "3.272634", "2.33E-05", "0.003497", "4.583501", "Up", "metabolism of cobalamin associated B"], ["COX5B", "3.250497", "8.68E-05", "0.006676", "4.206576", "Up", "cytochrome c oxidase subunit 5B"], ["ZNF706", "3.247455", "1.57E-05", "0.003137", "4.695098", "Up", "zinc finger protein 706"], ["SUMO3", "3.244703", "1.07E-05", "0.002689", "4.799887", "Up", "small ubiquitin like modifier 3"], ["ZHX1", "3.244233", "2.98E-05", "0.003952", "4.514129", "Up", "zinc fingers and homeoboxes 1"], ["DCAF6", "3.218358", "7.16E-05", "0.005962", "4.263031", "Up", "DDB1 and CUL4 associated factor 6"], ["NDUFA2", "3.202606", "0.00011", "0.007611", "4.136503", "Up", "NADH:ubiquinoneoxidoreductase subunit A2"], ["COMT", "3.194553", "7.49E-06", "0.002243", "4.899155", "Up", "catechol-O-methyltransferase"], ["USP24", "3.193685", "7.7E-06", "0.002243", "4.891689", "Up", "ubiquitin specific peptidase 24"], ["CLEC3B", "3.192924", "0.000932", "0.023147", "3.480824", "Up", "C-type lectin domain family 3 member B"], ["S100A16", "3.181908", "2.08E-05", "0.00341", "4.615343", "Up", "S100 calcium binding protein A16"], ["PIH1D1", "3.168542", "3.25E-06", "0.001776", "5.126645", "Up", "PIH1 domain containing 1"], ["PEX2", "3.15767", "6.91E-05", "0.005946", "4.273176", "Up", "peroxisomal biogenesis factor 2"], ["BCCIP", "3.156384", "5.08E-06", "0.002061", "5.005401", "Up", "BRCA2 and CDKN1A interacting protein"], ["UCHL1", "3.144433", "0.000603", "0.018411", "3.61943", "Up", "ubiquitin C-terminal hydrolase L1"], ["CCND2", "3.137527", "0.000795", "0.021152", "3.531905", "Up", "cyclin D2"], ["MTDH", "3.134009", "8.58E-05", "0.006622", "4.210031", "Up", "metadherin"], ["ATP6V1D", "3.1239", "0.0001", "0.007145", "4.164159", "Up", "ATPase H+ transporting V1 subunit D"], ["BOD1", "3.11664", "6.28E-06", "0.002168", "4.947675", "Up", "biorientation of chromosomes in cell division 1"], ["MRPL12", "3.114756", "7.59E-05", "0.006143", "4.245866", "Up", "mitochondrial ribosomal protein L12"], ["FOXN3", "3.113552", "0.000114", "0.007817", "4.126313", "Up", "forkhead box N3"], ["POLR3GL", "3.098647", "0.000131", "0.008485", "4.084894", "Up", "RNA polymerase III subunit G like"], ["ALKBH7", "3.098442", "0.000306", "0.012934", "3.830063", "Up", "alkB homolog 7"], ["CDV3", "3.096327", "0.000108", "0.007553", "4.141317", "Up", "CDV3 homolog"], ["ZSCAN16-AS1", "3.095847", "7.34E-07", "0.001025", "5.523754", "Up", "ZSCAN16 antisense RNA 1"], ["S100A13", "3.091633", "5.32E-05", "0.005263", "4.348914", "Up", "S100 calcium binding protein A13"], ["GFPT1", "3.085405", "5.33E-05", "0.005263", "4.348282", "Up", "glutamine--fructose-6-phosphate transaminase 1"], ["CCSER2", "3.079066", "3.98E-05", "0.004552", "4.431771", "Up", "coiled-coil serine rich protein 2"], ["PET100", "3.05957", "0.000152", "0.009259", "4.041067", "Up", "PET100 cytochrome c oxidase chaperone"], ["POLR2J", "3.05183", "0.000358", "0.014077", "3.781554", "Up", "RNA polymerase II subunit J"], ["SF3B6", "3.047526", "0.000179", "0.009929", "3.992753", "Up", "splicing factor 3b subunit 6"], ["TSPAN17", "3.044512", "7.59E-06", "0.002243", "4.895829", "Up", "tetraspanin 17"], ["ECSIT", "3.043372", "1.61E-05", "0.003137", "4.688241", "Up", "ECSIT signaling integrator"], ["TMED4", "3.041199", "2.05E-05", "0.00341", "4.620554", "Up", "transmembrane p24 trafficking protein 4"], ["ROMO1", "3.039801", "0.000339", "0.013645", "3.798806", "Up", "reactive oxygen species modulator 1"], ["SCARNA2", "3.037947", "0.000602", "0.018408", "3.619837", "Up", "small Cajal body-specific RNA 2"], ["RDX", "3.036218", "1.11E-05", "0.002709", "4.790401", "Up", "radixin"], ["ATP6AP2", "3.032219", "0.000537", "0.01724", "3.656205", "Up", "ATPase H+ transporting accessory protein 2"], ["MRPS6", "3.031793", "0.001246", "0.026775", "3.386766", "Up", "mitochondrial ribosomal protein S6"], ["MAD2L1BP", "3.030044", "1.83E-05", "0.003308", "4.651088", "Up", "MAD2L1 binding protein"], ["NNAT", "3.01612", "0.001284", "0.027046", "3.376953", "Up", "neuronatin"], ["SNX8", "3.011952", "2.11E-05", "0.00341", "4.611584", "Up", "sorting nexin 8"], ["ITGAV", "3.006812", "0.000168", "0.009643", "4.011701", "Up", "integrin subunit alpha V"], ["TBCA", "3.005083", "8.86E-05", "0.006772", "4.200708", "Up", "tubulin folding cofactor A"], ["SNAPIN", "3.00314", "6.24E-05", "0.005556", "4.30272", "Up", "SNAP associated protein"], ["TIMM8B", "2.999367", "0.000105", "0.007409", "4.149862", "Up", "translocase of inner mitochondrial membrane 8 homolog B"], ["TADA3", "2.994876", "4.72E-05", "0.005", "4.38301", "Up", "transcriptional adaptor 3"], ["HLA-DPB1", "2.992346", "0.000391", "0.014705", "3.754948", "Up", "major histocompatibility complex, class II, DP beta 1"], ["MGP", "2.989607", "0.000677", "0.019612", "3.583067", "Up", "matrix Gla protein"], ["LAMTOR4", "2.985466", "0.000916", "0.022949", "3.486633", "Up", "late endosomal/lysosomal adaptor, MAPK and MTOR activator 4"], ["BTF3L4", "2.981702", "8.91E-05", "0.006776", "4.199218", "Up", "basic transcription factor 3 like 4"], ["TMX2", "2.979038", "0.000153", "0.009259", "4.040171", "Up", "thioredoxin related transmembrane protein 2"], ["CFL2", "2.977258", "3.16E-05", "0.004025", "4.497382", "Up", "cofilin 2"], ["FAM149A", "2.975549", "6.83E-05", "0.005946", "4.276377", "Up", "family with sequence similarity 149 member A"], ["DTYMK", "2.966972", "0.000289", "0.012546", "3.847791", "Up", "deoxythymidylate kinase"], ["MT1X", "2.96256", "0.000442", "0.015758", "3.716594", "Up", "metallothionein 1X"], ["TSG101", "2.95913", "0.00027", "0.012156", "3.868591", "Up", "tumor susceptibility 101"], ["CPED1", "2.957683", "0.000497", "0.016679", "3.680123", "Up", "cadherin like and PC-esterase domain containing 1"], ["EXOC5", "2.949442", "0.000271", "0.012156", "3.867668", "Up", "exocyst complex component 5"], ["BCYRN1", "2.947993", "1.57E-05", "0.003137", "4.695075", "Up", "brain cytoplasmic RNA 1"], ["ANXA4", "2.947244", "2.18E-05", "0.00341", "4.602361", "Up", "annexin A4"], ["DPP7", "2.946214", "8.92E-05", "0.006776", "4.198665", "Up", "dipeptidyl peptidase 7"], ["SYVN1", "2.942727", "6.24E-05", "0.005556", "4.302587", "Up", "synoviolin 1"], ["NDUFA13", "2.941729", "0.000735", "0.020483", "3.556961", "Up", "NADH:ubiquinoneoxidoreductase subunit A13"], ["C9orf16", "2.940481", "0.000406", "0.014994", "3.743119", "Up", "chromosome 9 open reading frame 16"], ["AMDHD2", "2.940188", "2.53E-05", "0.00358", "4.5612", "Up", "amidohydrolase domain containing 2"], ["KLHL12", "2.939522", "2.85E-05", "0.003867", "4.527463", "Up", "kelch like family member 12"], ["EIF2D", "2.938722", "0.000261", "0.011982", "3.878331", "Up", "eukaryotic translation initiation factor 2D"], ["NDUFB2", "2.935453", "7.75E-05", "0.006191", "4.239855", "Up", "NADH:ubiquinoneoxidoreductase subunit B2"], ["GLRX3", "2.93158", "0.001019", "0.024195", "3.452028", "Up", "glutaredoxin 3"], ["THRSP", "2.927803", "0.00402", "0.04933", "2.990471", "Up", "thyroid hormone responsive"], ["SLC25A11", "2.925157", "0.000548", "0.017445", "3.649379", "Up", "solute carrier family 25 member 11"], ["NDFIP1", "2.924945", "8E-05", "0.006317", "4.230473", "Up", "Nedd4 family interacting protein 1"], ["UBAC1", "2.919604", "0.000143", "0.008978", "4.058832", "Up", "UBA domain containing 1"], ["SETD3", "2.915915", "0.000233", "0.011326", "3.913355", "Up", "SET domain containing 3, actin histidinemethyltransferase"], ["UQCRH", "2.914264", "0.000206", "0.010586", "3.950821", "Up", "ubiquinol-cytochrome c reductase hinge protein"], ["LMBRD1", "2.91352", "0.000153", "0.009259", "4.039227", "Up", "LMBR1 domain containing 1"], ["C1S", "2.913138", "9.66E-05", "0.007077", "4.175345", "Up", "complement C1s"], ["YIPF6", "2.909794", "0.000398", "0.014783", "3.74923", "Up", "Yip1 domain family member 6"], ["COX4I1", "2.908785", "0.000397", "0.014772", "3.749898", "Up", "cytochrome c oxidase subunit 4I1"], ["NBN", "2.90833", "3.91E-06", "0.001884", "5.076794", "Up", "nibrin"], ["TAF7", "2.908109", "0.000345", "0.013777", "3.793503", "Up", "TATA-box binding protein associated factor 7"], ["ANAPC13", "2.904023", "0.002551", "0.038877", "3.147704", "Up", "anaphase promoting complex subunit 13"], ["LYVE1", "2.902347", "0.001203", "0.026382", "3.398322", "Up", "lymphatic vessel endothelial hyaluronan receptor 1"], ["PSMD14", "2.901936", "0.000247", "0.011699", "3.89503", "Up", "proteasome 26S subunit, non-ATPase 14"], ["FAM32A", "2.900891", "0.000535", "0.01724", "3.657406", "Up", "family with sequence similarity 32 member A"], ["UROS", "2.900315", "0.00024", "0.011528", "3.904656", "Up", "uroporphyrinogen III synthase"], ["OST4", "2.898201", "0.002022", "0.034115", "3.226353", "Up", "oligosaccharyltransferase complex subunit 4, non-catalytic"], ["RBBP7", "2.897646", "0.000946", "0.023286", "3.476066", "Up", "RB binding protein 7, chromatin remodeling factor"], ["PRG4", "2.897614", "4.83E-05", "0.005015", "4.376505", "Up", "proteoglycan 4"], ["COX7A2", "2.896609", "0.000818", "0.021597", "3.522952", "Up", "cytochrome c oxidase subunit 7A2"], ["HMGCL", "2.895335", "0.000179", "0.009929", "3.993321", "Up", "3-hydroxy-3-methylglutaryl-CoA lyase"], ["FAM3A", "2.894614", "8.47E-05", "0.006573", "4.213715", "Up", "family with sequence similarity 3 member A"], ["BAK1", "2.892595", "2.69E-05", "0.00371", "4.543614", "Up", "BCL2 antagonist/killer 1"], ["ELOVL6", "2.8913", "7.93E-05", "0.006283", "4.232941", "Up", "ELOVL fatty acid elongase 6"], ["CHCHD2", "2.888344", "0.000193", "0.010317", "3.970255", "Up", "coiled-coil-helix-coiled-coil-helix domain containing 2"], ["PRMT1", "2.886326", "0.000236", "0.01142", "3.909722", "Up", "protein arginine methyltransferase 1"], ["HCFC1R1", "2.88509", "0.000187", "0.010126", "3.979988", "Up", "host cell factor C1 regulator 1"], ["RPS8", "2.88263", "0.000763", "0.02086", "3.545152", "Up", "ribosomal protein S8"], ["JMJD8", "2.880095", "0.000466", "0.016117", "3.700249", "Up", "jumonji domain containing 8"], ["VPS28", "2.868412", "0.00038", "0.014539", "3.763185", "Up", "VPS28 subunit of ESCRT-I"], ["EIF5", "2.867934", "0.00037", "0.014306", "3.772157", "Up", "eukaryotic translation initiation factor 5"], ["ADCY6", "2.866913", "0.000145", "0.009003", "4.055897", "Up", "adenylatecyclase 6"], ["NDUFC2", "2.865496", "0.001531", "0.029477", "3.319099", "Up", "NADH:ubiquinoneoxidoreductase subunit C2"], ["PIGS", "2.862467", "0.002273", "0.036573", "3.186856", "Up", "phosphatidylinositol glycan anchor biosynthesis class S"], ["C1QA", "2.861687", "0.000816", "0.021594", "3.523683", "Up", "complement C1q A chain"], ["FDX1", "2.861442", "0.000394", "0.014749", "3.752127", "Up", "ferredoxin 1"], ["RBX1", "2.85968", "0.000974", "0.023505", "3.466607", "Up", "ring-box 1"], ["TRIB1", "2.8594", "3.17E-05", "0.004025", "4.496868", "Up", "tribblespseudokinase 1"], ["COX6B1", "2.858458", "0.000469", "0.01616", "3.698433", "Up", "cytochrome c oxidase subunit 6B1"], ["MDFI", "2.857869", "0.000277", "0.012363", "3.860877", "Up", "MyoD family inhibitor"], ["RASD1", "2.855883", "0.00079", "0.021079", "3.533796", "Up", "ras related dexamethasone induced 1"], ["SLC40A1", "2.854864", "0.003422", "0.045502", "3.046747", "Up", "solute carrier family 40 member 1"], ["POLR2K", "2.854222", "0.001838", "0.032468", "3.258347", "Up", "RNA polymerase II subunit K"], ["CYB5B", "2.852742", "9.79E-05", "0.00709", "4.171566", "Up", "cytochrome b5 type B"], ["C1orf115", "2.850887", "0.001855", "0.03266", "3.255182", "Up", "chromosome 1 open reading frame 115"], ["EIF3L", "2.846772", "0.000651", "0.019135", "3.595545", "Up", "eukaryotic translation initiation factor 3 subunit L"], ["TMEM219", "2.834679", "0.001098", "0.025262", "3.427919", "Up", "transmembrane protein 219"], ["UQCR11", "2.833847", "0.000542", "0.017312", "3.652923", "Up", "ubiquinol-cytochrome c reductase, complex III subunit XI"], ["AGFG1", "2.83177", "8.83E-05", "0.006771", "4.201612", "Up", "ArfGAP with FG repeats 1"], ["MRPS15", "2.831483", "0.000629", "0.018848", "3.606346", "Up", "mitochondrial ribosomal protein S15"], ["UBE2E1", "2.82743", "0.00062", "0.018805", "3.610605", "Up", "ubiquitin conjugating enzyme E2 E1"], ["NQO1", "2.827398", "3.12E-05", "0.004025", "4.50132", "Up", "NAD(P) H quinone dehydrogenase 1"], ["MORF4L1", "2.825223", "0.000145", "0.009003", "4.055546", "Up", "mortality factor 4 like 1"], ["TM7SF3", "2.823384", "0.0001", "0.007145", "4.165181", "Up", "transmembrane 7 superfamily member 3"], ["RPL35A", "2.822157", "0.000266", "0.012089", "3.87247", "Up", "ribosomal protein L35a"], ["TMEM160", "2.812975", "0.000317", "0.01319", "3.819678", "Up", "transmembrane protein 160"], ["LSM3", "2.809963", "0.000282", "0.012404", "3.854606", "Up", "LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated"], ["PHB", "2.808084", "0.000258", "0.011974", "3.881731", "Up", "prohibitin"], ["MRPS21", "2.805911", "0.000295", "0.012696", "3.841189", "Up", "mitochondrial ribosomal protein S21"], ["TMEM256", "2.804853", "0.003453", "0.045785", "3.04363", "Up", "transmembrane protein 256"], ["MRPS12", "2.804789", "0.000223", "0.011092", "3.925752", "Up", "mitochondrial ribosomal protein S12"], ["PLTP", "2.803513", "0.000258", "0.011965", "3.882486", "Up", "phospholipid transfer protein"], ["TNPO2", "2.794461", "0.000852", "0.022167", "3.509567", "Up", "transportin 2"], ["SKIL", "2.793991", "1.01E-05", "0.002625", "4.815964", "Up", "SKI like proto-oncogene"], ["SEC11A", "2.784473", "0.001174", "0.026198", "3.406284", "Up", "SEC11 homolog A, signal peptidase complex subunit"], ["RPS10", "2.783754", "0.000749", "0.020638", "3.550811", "Up", "ribosomal protein S10"], ["APOD", "2.777795", "0.00264", "0.039615", "3.136112", "Up", "apolipoprotein D"], ["RAB4A", "2.777311", "0.000182", "0.01001", "3.987809", "Up", "RAB4A, member RAS oncogene family"], ["RBMX", "2.774453", "6.17E-05", "0.005556", "4.306198", "Up", "RNA binding motif protein X-linked"], ["ARFIP2", "2.772975", "0.000459", "0.016062", "3.705244", "Up", "ADP ribosylation factor interacting protein 2"], ["CPE", "2.770836", "0.001392", "0.028193", "3.350337", "Up", "carboxypeptidase E"], ["TCTN3", "2.770597", "8.94E-05", "0.006776", "4.198026", "Up", "tectonic family member 3"], ["YWHAH", "2.77017", "0.000866", "0.02234", "3.504563", "Up", "tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta"], ["PLXNA1", "2.769986", "1.66E-05", "0.003137", "4.67951", "Up", "plexin A1"], ["AK1", "2.767903", "0.000273", "0.012251", "3.864784", "Up", "adenylate kinase 1"], ["ORMDL1", "2.767548", "7.27E-05", "0.005968", "4.258602", "Up", "ORMDL sphingolipid biosynthesis regulator 1"], ["SLTM", "2.767084", "0.000706", "0.020072", "3.569499", "Up", "SAFB like transcription modulator"], ["PSMC5", "2.760402", "0.00097", "0.023505", "3.468114", "Up", "proteasome 26S subunit, ATPase 5"], ["UHMK1", "2.759638", "0.000128", "0.008394", "4.09178", "Up", "U2AF homology motif kinase 1"], ["AIFM1", "2.757223", "7.05E-05", "0.005956", "4.267206", "Up", "apoptosis inducing factor mitochondria associated 1"], ["TATDN1", "2.756526", "0.000672", "0.019534", "3.585379", "Up", "TatDDNase domain containing 1"], ["COX6C", "2.753983", "0.000372", "0.014337", "3.769771", "Up", "cytochrome c oxidase subunit 6C"], ["GIPC1", "2.753721", "0.000335", "0.013596", "3.802772", "Up", "GIPC PDZ domain containing family member 1"], ["RPS21", "2.753031", "0.000158", "0.009439", "4.030076", "Up", "ribosomal protein S21"], ["CCDC85B", "2.752819", "0.001517", "0.029361", "3.322182", "Up", "coiled-coil domain containing 85B"], ["UAP1", "2.74977", "0.001158", "0.026017", "3.410666", "Up", "UDP-N-acetylglucosaminepyrophosphorylase 1"], ["POFUT1", "2.742386", "0.000309", "0.012965", "3.827384", "Up", "protein O-fucosyltransferase 1"], ["C3AR1", "2.736533", "2.1E-05", "0.00341", "4.613724", "Up", "complement C3a receptor 1"], ["SRP72", "2.734833", "5.43E-05", "0.005283", "4.342922", "Up", "signal recognition particle 72"], ["ABHD17A", "2.734708", "0.001052", "0.024558", "3.441677", "Up", "abhydrolase domain containing 17A"], ["TOMM7", "2.730177", "0.001231", "0.026634", "3.390625", "Up", "translocase of outer mitochondrial membrane 7"], ["ANP32B", "2.728749", "0.00161", "0.030287", "3.302334", "Up", "acidic nuclear phosphoprotein 32 family member B"], ["TMEM230", "2.728085", "0.001136", "0.025784", "3.416807", "Up", "transmembrane protein 230"], ["NABP2", "2.7271", "0.000369", "0.014306", "3.772639", "Up", "nucleic acid binding protein 2"], ["CDC27", "2.726993", "0.001334", "0.027538", "3.364495", "Up", "cell division cycle 27"], ["FAM20B", "2.723814", "0.000841", "0.021962", "3.513811", "Up", "FAM20B glycosaminoglycan xylosylkinase"], ["ETF1", "2.7213", "0.000538", "0.01724", "3.655315", "Up", "eukaryotic translation termination factor 1"], ["GRHPR", "2.720938", "0.000857", "0.022226", "3.507777", "Up", "glyoxylate and hydroxypyruvatereductase"], ["DERL2", "2.720492", "0.000154", "0.009266", "4.038321", "Up", "derlin 2"], ["RPL36A", "2.720487", "0.000898", "0.02272", "3.492922", "Up", "ribosomal protein L36a"], ["C19orf53", "2.718168", "0.000499", "0.016701", "3.678807", "Up", "chromosome 19 open reading frame 53"], ["GTF2A2", "2.716967", "0.000389", "0.014658", "3.756692", "Up", "general transcription factor IIA subunit 2"], ["GADD45B", "2.716143", "0.000261", "0.011982", "3.878655", "Up", "growth arrest and DNA damage inducible beta"], ["CDIPT", "2.714923", "0.00013", "0.00844", "4.088275", "Up", "CDP-diacylglycerol--inositol 3-phosphatidyltransferase"], ["COX6A1", "2.712855", "0.000535", "0.01724", "3.657442", "Up", "cytochrome c oxidase subunit 6A1"], ["SRSF6", "2.711655", "0.000694", "0.019868", "3.575141", "Up", "serine and arginine rich splicing factor 6"], ["SCARB1", "2.709938", "0.00054", "0.017244", "3.654526", "Up", "scavenger receptor class B member 1"], ["ASAP3", "2.709641", "3.15E-05", "0.004025", "4.498522", "Up", "ArfGAP with SH3 domain, ankyrin repeat and PH domain 3"], ["RNASE1", "2.702048", "0.00234", "0.037096", "3.177048", "Up", "ribonuclease A family member 1, pancreatic"], ["NAPRT", "2.701", "0.000937", "0.023198", "3.479213", "Up", "nicotinatephosphoribosyltransferase"], ["UQCRQ", "2.698312", "0.000786", "0.021056", "3.535632", "Up", "ubiquinol-cytochrome c reductase complex III subunit VII"], ["COX7C", "2.697196", "0.000888", "0.022598", "3.496307", "Up", "cytochrome c oxidase subunit 7C"], ["PSMB1", "2.694976", "0.000391", "0.014705", "3.754384", "Up", "proteasome 20S subunit beta 1"], ["ECH1", "2.694774", "0.002021", "0.034115", "3.226513", "Up", "enoyl-CoA hydratase 1"], ["RPS15A", "2.694313", "0.000873", "0.022405", "3.502067", "Up", "ribosomal protein S15a"], ["ERH", "2.693982", "9.3E-05", "0.006902", "4.186545", "Up", "ERH mRNA splicing and mitosis factor"], ["PSMD3", "2.69342", "0.000362", "0.014114", "3.77823", "Up", "proteasome 26S subunit, non-ATPase 3"], ["MRPS24", "2.689672", "2.97E-06", "0.001776", "5.150884", "Up", "mitochondrial ribosomal protein S24"], ["HSD17B10", "2.689486", "0.000184", "0.010093", "3.984586", "Up", "hydroxysteroid 17-beta dehydrogenase 10"], ["ICMT", "2.68742", "0.001623", "0.030348", "3.299776", "Up", "isoprenylcysteine carboxyl methyltransferase"], ["COX8A", "2.68611", "0.00082", "0.021597", "3.521817", "Up", "cytochrome c oxidase subunit 8A"], ["RPS23", "2.683611", "0.001311", "0.027304", "3.370125", "Up", "ribosomal protein S23"], ["TMEM165", "2.683585", "0.000309", "0.012965", "3.827632", "Up", "transmembrane protein 165"], ["TMEM97", "2.683426", "1.54E-06", "0.001401", "5.327084", "Up", "transmembrane protein 97"], ["COX7A2L", "2.680847", "0.0015", "0.029177", "3.325736", "Up", "cytochrome c oxidase subunit 7A2 like"], ["FAM89B", "2.67751", "0.003528", "0.046326", "3.036153", "Up", "family with sequence similarity 89 member B"], ["SMAD5", "2.676775", "0.0005", "0.016701", "3.678519", "Up", "SMAD family member 5"], ["CCNC", "2.675154", "0.002737", "0.040448", "3.123787", "Up", "cyclin C"], ["CDC42EP2", "2.672348", "0.000165", "0.009593", "4.016925", "Up", "CDC42 effector protein 2"], ["UQCRC1", "2.67139", "3.96E-05", "0.004552", "4.433447", "Up", "ubiquinol-cytochrome c reductase core protein 1"], ["COPS7A", "2.671383", "0.001825", "0.032315", "3.260743", "Up", "COP9 signalosome subunit 7A"], ["CCDC80", "2.670347", "0.003064", "0.042867", "3.085018", "Up", "coiled-coil domain containing 80"], ["PSMB4", "2.669349", "0.000572", "0.017831", "3.636053", "Up", "proteasome 20S subunit beta 4"], ["EIF6", "2.664726", "0.000227", "0.011159", "3.920651", "Up", "eukaryotic translation initiation factor 6"], ["PFDN5", "2.657659", "0.001117", "0.025474", "3.422216", "Up", "prefoldin subunit 5"], ["AFF1", "2.657404", "0.00036", "0.014077", "3.78051", "Up", "AF4/FMR2 family member 1"], ["UQCRFS1", "2.656808", "0.000434", "0.01563", "3.722419", "Up", "ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1"], ["TYROBP", "2.652926", "0.0038", "0.047966", "3.010176", "Up", "TYRO protein tyrosine kinase binding protein"], ["ANAPC5", "2.650988", "0.000463", "0.016091", "3.702541", "Up", "anaphase promoting complex subunit 5"], ["TRMT112", "2.643049", "0.001145", "0.025902", "3.414206", "Up", "tRNAmethyltransferase subunit 11-2"], ["ARF5", "2.641389", "0.002168", "0.035481", "3.202951", "Up", "ADP ribosylation factor 5"], ["POLR1D", "2.64106", "0.000197", "0.010419", "3.963486", "Up", "RNA polymerase I and III subunit D"], ["SNX9", "2.639558", "0.000559", "0.017629", "3.643451", "Up", "sorting nexin 9"], ["NDUFS5", "2.634939", "0.000625", "0.018808", "3.608112", "Up", "NADH:ubiquinoneoxidoreductase subunit S5"], ["KDSR", "2.634609", "0.00089", "0.022598", "3.495893", "Up", "3-ketodihydrosphingosine reductase"], ["KRTCAP2", "2.634197", "0.001854", "0.032651", "3.255495", "Up", "keratinocyte associated protein 2"], ["RPAIN", "2.632929", "0.00075", "0.020638", "3.55055", "Up", "RPA interacting protein"], ["OXCT1", "2.63204", "0.003122", "0.043255", "3.078538", "Up", "3-oxoacid CoA-transferase 1"], ["CAPNS1", "2.631695", "0.000733", "0.020454", "3.557742", "Up", "calpain small subunit 1"], ["SERPINH1", "2.631035", "0.000261", "0.011982", "3.878996", "Up", "serpin family H member 1"], ["TNIP2", "2.630856", "0.000242", "0.011614", "3.901038", "Up", "TNFAIP3 interacting protein 2"], ["RASSF3", "2.62826", "0.004015", "0.049293", "2.990897", "Up", "Ras association domain family member 3"], ["RPL27", "2.626854", "0.001008", "0.024036", "3.455675", "Up", "ribosomal protein L27"], ["ARHGAP12", "2.624075", "0.0007", "0.019959", "3.572316", "Up", "Rho GTPase activating protein 12"], ["PRPF31", "2.623671", "0.000129", "0.008399", "4.090841", "Up", "pre-mRNA processing factor 31"], ["KLB", "2.623223", "0.001365", "0.027884", "3.356946", "Up", "klotho beta"], ["TMX4", "2.618625", "0.00108", "0.024945", "3.433183", "Up", "thioredoxin related transmembrane protein 4"], ["NQO2", "2.617727", "0.002855", "0.041527", "3.109292", "Up", "N-ribosyldihydronicotinamide:quinonereductase 2"], ["NME2", "2.617495", "0.002462", "0.038092", "3.159908", "Up", "NME/NM23 nucleoside diphosphate kinase 2"], ["SLC25A26", "2.616798", "1.27E-05", "0.002881", "4.754142", "Up", "solute carrier family 25 member 26"], ["TOMM5", "2.615408", "0.003222", "0.043977", "3.067588", "Up", "translocase of outer mitochondrial membrane 5"], ["ETFB", "2.614762", "0.001976", "0.033674", "3.234172", "Up", "electron transfer flavoprotein subunit beta"], ["MOAP1", "2.614239", "0.000133", "0.008495", "4.081606", "Up", "modulator of apoptosis 1"], ["NACC1", "2.613132", "1.23E-05", "0.002829", "4.761618", "Up", "nucleus accumbens associated 1"], ["NAGLU", "2.612492", "0.000258", "0.011965", "3.882494", "Up", "N-acetyl-alpha-glucosaminidase"], ["XRCC5", "2.611431", "0.000462", "0.016091", "3.703217", "Up", "X-ray repair cross complementing 5"], ["RPL35", "2.610712", "0.000229", "0.011194", "3.918588", "Up", "ribosomal protein L35"], ["KRCC1", "2.608947", "9.22E-05", "0.006864", "4.189205", "Up", "lysine rich coiled-coil 1"], ["PSMB7", "2.608925", "0.001141", "0.025828", "3.415417", "Up", "proteasome 20S subunit beta 7"], ["RPS29", "2.608914", "0.001176", "0.026198", "3.405623", "Up", "ribosomal protein S29"], ["SNRPD2", "2.604428", "0.000499", "0.016701", "3.679267", "Up", "small nuclear ribonucleoprotein D2 polypeptide"], ["RSL24D1", "2.604123", "0.001206", "0.026399", "3.397372", "Up", "ribosomal L24 domain containing 1"], ["RBM3", "2.602465", "0.000751", "0.020661", "3.549857", "Up", "RNA binding motif protein 3"], ["RPL14", "2.598328", "0.002801", "0.041085", "3.115761", "Up", "ribosomal protein L14"], ["DBI", "2.593769", "0.001225", "0.026608", "3.392185", "Up", "diazepam binding inhibitor, acyl-CoA binding protein"], ["RPL13A", "2.592976", "0.000949", "0.023287", "3.474966", "Up", "ribosomal protein L13a"], ["NAB1", "2.591638", "0.000791", "0.021082", "3.533288", "Up", "NGFI-A binding protein 1"], ["STX10", "2.590276", "0.003718", "0.047358", "3.01781", "Up", "syntaxin 10"], ["SLC35E1", "2.589777", "0.000244", "0.011642", "3.898916", "Up", "solute carrier family 35 member E1"], ["GCHFR", "2.586356", "0.00154", "0.029477", "3.317136", "Up", "GTP cyclohydrolase I feedback regulator"], ["WIPI1", "2.586044", "0.001049", "0.024512", "3.442577", "Up", "WD repeat domain, phosphoinositide interacting 1"], ["TMEM50A", "2.586036", "0.001551", "0.029566", "3.314827", "Up", "transmembrane protein 50A"], ["NELFB", "2.585911", "0.000623", "0.018805", "3.609156", "Up", "negative elongation factor complex member B"], ["MRPL9", "2.582693", "0.000637", "0.019003", "3.60222", "Up", "mitochondrial ribosomal protein L9"], ["DIP2C", "2.577846", "1.51E-06", "0.001401", "5.333124", "Up", "disco interacting protein 2 homolog C"], ["PFDN1", "2.577843", "0.001923", "0.033201", "3.243123", "Up", "prefoldin subunit 1"], ["PCYT2", "2.574996", "0.000343", "0.013741", "3.795229", "Up", "phosphate cytidylyltransferase 2, ethanolamine"], ["RPL29", "2.574629", "0.000911", "0.022881", "3.488378", "Up", "ribosomal protein L29"], ["RPL30", "2.574242", "0.000917", "0.022969", "3.486043", "Up", "ribosomal protein L30"], ["EMC4", "2.572361", "0.00205", "0.034257", "3.221746", "Up", "ER membrane protein complex subunit 4"], ["RPL24", "2.571676", "0.002479", "0.038185", "3.157525", "Up", "ribosomal protein L24"], ["RPS15", "2.570516", "0.001711", "0.031119", "3.282153", "Up", "ribosomal protein S15"], ["SMARCD2", "2.569052", "0.000525", "0.017152", "3.66321", "Up", "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2"], ["C9orf78", "2.568679", "9.48E-05", "0.007003", "4.180864", "Up", "chromosome 9 open reading frame 78"], ["BLOC1S1", "2.568295", "0.001664", "0.03072", "3.291398", "Up", "biogenesis of lysosomal organelles complex 1 subunit 1"], ["ATP9A", "2.567757", "0.000243", "0.011614", "3.900357", "Up", "ATPase phospholipid transporting 9A (putative)"], ["MS4A4A", "2.566919", "5.96E-05", "0.005493", "4.316129", "Up", "membrane spanning 4-domains A4A"], ["AFAP1L1", "2.565706", "0.002187", "0.035677", "3.199902", "Up", "actin filament associated protein 1 like 1"], ["CDKN2B", "2.565157", "0.000599", "0.018321", "3.621709", "Up", "cyclin dependent kinase inhibitor 2B"], ["IFI27", "2.563118", "0.00371", "0.047358", "3.01863", "Up", "interferon alpha inducible protein 27"], ["MED4", "2.555663", "0.001188", "0.026311", "3.402174", "Up", "mediator complex subunit 4"], ["DPH5", "2.553328", "3.71E-05", "0.004462", "4.452413", "Up", "diphthamide biosynthesis 5"], ["WIZ", "2.550083", "0.000617", "0.018752", "3.612543", "Up", "WIZ zinc finger"], ["PEX19", "2.549485", "0.003066", "0.042867", "3.084727", "Up", "peroxisomal biogenesis factor 19"], ["RABGEF1", "2.547097", "0.001793", "0.032062", "3.266518", "Up", "RAB guanine nucleotide exchange factor 1"], ["SLC9A3R1", "2.544376", "0.000906", "0.022852", "3.490141", "Up", "SLC9A3 regulator 1"], ["ANO6", "2.541247", "0.00097", "0.023505", "3.468073", "Up", "anoctamin 6"], ["RPLP0", "2.539879", "0.000147", "0.009101", "4.051259", "Up", "ribosomal protein lateral stalk subunit P0"], ["EZH1", "2.538446", "0.000787", "0.021056", "3.535293", "Up", "enhancer of zeste 1 polycomb repressive complex 2 subunit"], ["PSKH1", "2.53776", "0.001027", "0.024288", "3.449585", "Up", "protein serine kinase H1"], ["RPL34", "2.53733", "0.000646", "0.0191", "3.597964", "Up", "ribosomal protein L34"], ["NDUFS4", "2.53691", "0.000267", "0.012096", "3.871781", "Up", "NADH:ubiquinoneoxidoreductase subunit S4"], ["BANF1", "2.535865", "0.000572", "0.017831", "3.636063", "Up", "barrier to autointegration factor 1"], ["MRPL54", "2.533785", "0.000952", "0.023287", "3.473973", "Up", "mitochondrial ribosomal protein L54"], ["CKS1B", "2.533771", "0.000911", "0.022881", "3.488195", "Up", "CDC28 protein kinase regulatory subunit 1B"], ["TMEM184B", "2.532583", "1.67E-05", "0.003137", "4.676649", "Up", "transmembrane protein 184B"], ["PSMD10", "2.530765", "0.00053", "0.01724", "3.660242", "Up", "proteasome 26S subunit, non-ATPase 10"], ["RPS5", "2.529965", "0.000597", "0.018297", "3.622831", "Up", "ribosomal protein S5"], ["CUL4A", "2.529656", "0.001663", "0.03072", "3.291653", "Up", "cullin 4A"], ["MFAP5", "2.527961", "0.000821", "0.021597", "3.521542", "Up", "microfibril associated protein 5"], ["SNTA1", "2.526907", "0.000372", "0.014337", "3.770146", "Up", "syntrophin alpha 1"], ["RPS20", "2.52651", "0.002839", "0.041407", "3.111181", "Up", "ribosomal protein S20"], ["RSL1D1", "2.524784", "0.000405", "0.014978", "3.743879", "Up", "ribosomal L1 domain containing 1"], ["RPS24", "2.523665", "0.002187", "0.035677", "3.200019", "Up", "ribosomal protein S24"], ["ICAM2", "2.52328", "0.00175", "0.031637", "3.274701", "Up", "intercellular adhesion molecule 2"], ["B4GALT2", "2.522208", "0.001703", "0.031013", "3.283844", "Up", "beta-1,4-galactosyltransferase 2"], ["NUDT16", "2.521704", "0.001545", "0.029527", "3.315981", "Up", "nudix hydrolase 16"], ["PFN2", "2.519815", "0.001062", "0.024764", "3.438594", "Up", "profilin 2"], ["RAB10", "2.519714", "0.003057", "0.04281", "3.085745", "Up", "RAB10, member RAS oncogene family"], ["SF3B5", "2.519177", "0.003604", "0.046771", "3.028686", "Up", "splicing factor 3b subunit 5"], ["TCEAL8", "2.516685", "0.003486", "0.04603", "3.040293", "Up", "transcription elongation factor A like 8"], ["CD99L2", "2.51621", "0.001957", "0.03358", "3.23728", "Up", "CD99 molecule like 2"], ["SUCLG1", "2.514671", "0.001177", "0.026198", "3.405243", "Up", "succinate-CoA ligase alpha subunit"], ["LAMA2", "2.514019", "0.000535", "0.01724", "3.657403", "Up", "laminin subunit alpha 2"], ["EIF3E", "2.511931", "0.000766", "0.020887", "3.543592", "Up", "eukaryotic translation initiation factor 3 subunit E"], ["BCL7B", "2.511858", "0.000361", "0.014084", "3.779795", "Up", "BAF chromatin remodeling complex subunit BCL7B"], ["SEPHS2", "2.511732", "0.000202", "0.010561", "3.955986", "Up", "selenophosphatesynthetase 2"], ["LOXL2", "2.511606", "0.000883", "0.022598", "3.498175", "Up", "lysyl oxidase like 2"], ["PMM1", "2.511461", "0.00143", "0.02855", "3.341501", "Up", "phosphomannomutase 1"], ["DNPH1", "2.50873", "0.002905", "0.041811", "3.103319", "Up", "2'-deoxynucleoside 5'-phosphate N-hydrolase 1"], ["RARRES2", "2.504265", "0.003791", "0.047902", "3.011021", "Up", "retinoic acid receptor responder 2"], ["COA3", "2.50271", "0.001102", "0.025262", "3.426827", "Up", "cytochrome c oxidase assembly factor 3"], ["MRPS34", "2.502001", "0.000919", "0.022981", "3.485574", "Up", "mitochondrial ribosomal protein S34"], ["SLC30A7", "-3.56691", "4.14E-07", "0.00095", "-5.67461", "Down", "solute carrier family 30 member 7"], ["VTI1A", "-3.31043", "1.05E-07", "0.000478", "-6.03155", "Down", "vesicle transport through interaction with t-SNAREs 1A"], ["ERG", "-3.30133", "2.32E-05", "0.003497", "-4.58491", "Down", "ETS transcription factor ERG"], ["ZFYVE1", "-3.18784", "1.03E-06", "0.001179", "-5.43378", "Down", "zinc finger FYVE-type containing 1"], ["AAK1", "-3.1737", "2.73E-06", "0.001776", "-5.17359", "Down", "AP2 associated kinase 1"], ["URB2", "-3.16731", "8.19E-07", "0.00108", "-5.49481", "Down", "URB2 ribosome biogenesis homolog"], ["IGIP", "-3.12032", "5.55E-05", "0.005363", "-4.33643", "Down", "IgA inducing protein"], ["ITIH4", "-2.9168", "3.51E-06", "0.001852", "-5.10571", "Down", "inter-alpha-trypsin inhibitor heavy chain 4"], ["LOC646214", "-2.85088", "0.000346", "0.013805", "-3.79234", "Down", "p21 protein (Cdc42/Rac)-activated kinase 2 pseudogene"], ["ZNF486", "-2.84793", "1.14E-05", "0.002738", "-4.78297", "Down", "zinc finger protein 486"], ["TET3", "-2.81596", "1.11E-06", "0.001179", "-5.41343", "Down", "tetmethylcytosinedioxygenase 3"], ["HECW2", "-2.8127", "3.17E-05", "0.004025", "-4.49639", "Down", "HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2"], ["LPXN", "-2.80145", "3.07E-06", "0.001776", "-5.14246", "Down", "leupaxin"], ["GOSR1", "-2.79883", "1.73E-05", "0.003174", "-4.66687", "Down", "golgi SNAP receptor complex member 1"], ["PDPR", "-2.78381", "4.99E-05", "0.005058", "-4.36736", "Down", "pyruvate dehydrogenase phosphatase regulatory subunit"], ["TNKS", "-2.74917", "9.17E-05", "0.006848", "-4.19071", "Down", "tankyrase"], ["ECD", "-2.73445", "0.000348", "0.013823", "-3.79107", "Down", "ecdysoneless cell cycle regulator"], ["ABCC5", "-2.72387", "1.16E-05", "0.002752", "-4.77862", "Down", "ATP binding cassette subfamily C member 5"], ["STXBP5", "-2.71632", "0.000176", "0.009858", "-3.99744", "Down", "syntaxin binding protein 5"], ["WDR19", "-2.69898", "0.000615", "0.018721", "-3.61344", "Down", "WD repeat domain 19"], ["SARM1", "-2.69717", "1.19E-09", "1.98E-05", "-7.17529", "Down", "sterile alpha and TIR motif containing 1"], ["TRAF5", "-2.66677", "0.000107", "0.007492", "-4.14579", "Down", "TNF receptor associated factor 5"], ["SYNE2", "-2.663", "5.87E-05", "0.005493", "-4.32047", "Down", "spectrin repeat containing nuclear envelope protein 2"], ["CFP", "-2.6567", "0.000675", "0.019585", "-3.58386", "Down", "complement factor properdin"], ["ANKRD20A9P", "-2.64322", "0.001714", "0.031148", "-3.28161", "Down", "ankyrin repeat domain 20 family member A9, pseudogene"], ["FAT4", "-2.63099", "0.000494", "0.016631", "-3.68187", "Down", "FAT atypical cadherin 4"], ["HIVEP1", "-2.62581", "8.18E-05", "0.006387", "-4.22422", "Down", "HIVEP zinc finger 1"], ["SNAP47", "-2.61436", "0.000216", "0.010911", "-3.93599", "Down", "synaptosome associated protein 47"], ["DMRT2", "-2.61357", "0.000161", "0.009544", "-4.02349", "Down", "doublesex and mab-3 related transcription factor 2"], ["GEMIN5", "-2.60553", "3.51E-05", "0.004269", "-4.46757", "Down", "gem nuclear organelle associated protein 5"], ["LOC643406", "-2.59315", "0.000435", "0.015643", "-3.72139", "Down", "uncharacterized LOC643406"], ["OBSCN", "-2.58615", "0.000237", "0.011453", "-3.90744", "Down", "obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF"], ["ATP13A1", "-2.57902", "6.26E-05", "0.005556", "-4.3019", "Down", "ATPase 13A1"], ["LOC105372795", "-2.56184", "2.46E-06", "0.001776", "-5.2015", "Down", "uncharacterized LOC105372795"], ["PXMP4", "-2.55289", "0.000508", "0.016883", "-3.67316", "Down", "peroxisomal membrane protein 4"], ["FAS", "-2.51889", "0.000221", "0.011049", "-3.92874", "Down", "Fas cell surface death receptor"], ["MGAM", "-2.5179", "0.001226", "0.026608", "-3.39213", "Down", "maltase-glucoamylase"], ["ERCC6L2", "-2.49433", "0.000462", "0.016091", "-3.70269", "Down", "ERCC excision repair 6 like 2"], ["MFAP3", "-2.48427", "9.78E-05", "0.00709", "-4.17183", "Down", "microfibril associated protein 3"], ["TPD52", "-2.48206", "0.001319", "0.027418", "-3.36809", "Down", "tumor protein D52"], ["PPP1R3B", "-2.47428", "0.001536", "0.029477", "-3.31797", "Down", "protein phosphatase 1 regulatory subunit 3B"], ["PTGDR", "-2.46695", "4.33E-07", "0.00095", "-5.66312", "Down", "prostaglandin D2 receptor"], ["AHSP", "-2.45099", "4.99E-06", "0.002061", "-5.01026", "Down", "alpha hemoglobin stabilizing protein"], ["ODF2", "-2.44884", "0.000531", "0.01724", "-3.65942", "Down", "outer dense fiber of sperm tails 2"], ["MAU2", "-2.44852", "0.002675", "0.039958", "-3.1315", "Down", "MAU2 sister chromatid cohesion factor"], ["PTOV1-AS2", "-2.44504", "8.73E-06", "0.002428", "-4.85721", "Down", "PTOV1 antisense RNA 2"], ["SLCO4A1", "-2.42489", "9.04E-05", "0.006791", "-4.19486", "Down", "solute carrier organic anion transporter family member 4A1"], ["RAP1GAP2", "-2.41727", "0.000428", "0.015491", "-3.72656", "Down", "RAP1 GTPase activating protein 2"], ["GUSBP11", "-2.41706", "1.72E-05", "0.003165", "-4.66966", "Down", "GUSB pseudogene 11"], ["CHST14", "-2.40289", "6.43E-06", "0.002175", "-4.94093", "Down", "carbohydrate sulfotransferase 14"], ["SMYD4", "-2.3923", "0.000889", "0.022598", "-3.49612", "Down", "SET and MYND domain containing 4"], ["CACNA2D4", "-2.38689", "1.62E-05", "0.003137", "-4.6856", "Down", "calcium voltage-gated channel auxiliary subunit alpha2delta 4"], ["ERO1A", "-2.3862", "0.001273", "0.026966", "-3.37975", "Down", "endoplasmic reticulum oxidoreductase 1 alpha"], ["ATRNL1", "-2.37103", "1.84E-05", "0.003308", "-4.64955", "Down", "attractin like 1"], ["ATL1", "-2.37076", "0.000548", "0.017445", "-3.64947", "Down", "atlastinGTPase 1"], ["EPHB4", "-2.36058", "0.000451", "0.015882", "-3.71047", "Down", "EPH receptor B4"], ["AOC4P", "-2.35367", "3.9E-06", "0.001884", "-5.07705", "Down", "amine oxidase copper containing 4, pseudogene"], ["SLC25A13", "-2.34818", "0.000134", "0.008515", "-4.07881", "Down", "solute carrier family 25 member 13"], ["FAM13B", "-2.34187", "0.003334", "0.044854", "-3.05577", "Down", "family with sequence similarity 13 member B"], ["TRAK1", "-2.33457", "0.000883", "0.022598", "-3.49834", "Down", "trafficking kinesin protein 1"], ["ABI3", "-2.3343", "0.000274", "0.012278", "-3.8636", "Down", "ABI family member 3"], ["SEMA6B", "-2.33392", "4.57E-05", "0.004952", "-4.39248", "Down", "semaphorin 6B"], ["METTL21A", "-2.33362", "0.002789", "0.040954", "-3.11724", "Down", "methyltransferase like 21A"], ["ZNF778", "-2.33087", "3.93E-06", "0.001884", "-5.07521", "Down", "zinc finger protein 778"], ["PDE4B", "-2.32078", "0.000786", "0.021056", "-3.5357", "Down", "phosphodiesterase 4B"], ["NDC1", "-2.31958", "0.000208", "0.010631", "-3.94732", "Down", "NDC1 transmembranenucleoporin"], ["SLC9A7", "-2.31311", "0.001151", "0.025956", "-3.41266", "Down", "solute carrier family 9 member A7"], ["NLGN2", "-2.31264", "7.89E-05", "0.006274", "-4.23441", "Down", "neuroligin 2"], ["IKZF4", "-2.30922", "0.000113", "0.007788", "-4.12818", "Down", "IKAROS family zinc finger 4"], ["MAST3", "-2.3067", "0.001042", "0.024428", "-3.44474", "Down", "microtubule associated serine/threonine kinase 3"], ["SAP25", "-2.30632", "0.000324", "0.013394", "-3.81298", "Down", "Sin3A associated protein 25"], ["ZNF213-AS1", "-2.30592", "3.03E-06", "0.001776", "-5.14592", "Down", "ZNF213 antisense RNA 1 (head to head)"], ["ADAMTS13", "-2.30408", "2.03E-06", "0.001623", "-5.25359", "Down", "ADAM metallopeptidase with thrombospondin type 1 motif 13"], ["CDH19", "-2.30007", "9.85E-06", "0.002623", "-4.82394", "Down", "cadherin 19"], ["DOCK9", "-2.28015", "0.002517", "0.038469", "-3.15239", "Down", "dedicator of cytokinesis 9"], ["PARP10", "-2.27632", "0.003654", "0.047012", "-3.0239", "Down", "poly (ADP-ribose) polymerase family member 10"], ["LOC648987", "-2.27592", "2.87E-06", "0.001776", "-5.16", "Down", "uncharacterized LOC648987"], ["GIMAP8", "-2.27461", "0.001512", "0.029333", "-3.32309", "Down", "GTPase, IMAP family member 8"], ["COL8A1", "-2.27216", "0.00307", "0.042867", "-3.08427", "Down", "collagen type VIII alpha 1 chain"], ["MYO7A", "-2.26997", "5.89E-06", "0.002131", "-4.96524", "Down", "myosin VIIA"], ["SLC25A35", "-2.26394", "4.18E-05", "0.004645", "-4.41821", "Down", "solute carrier family 25 member 35"], ["ESR1", "-2.25478", "0.000772", "0.020954", "-3.54124", "Down", "estrogen receptor 1"], ["FAM71F2", "-2.25074", "5.55E-06", "0.002118", "-4.98153", "Down", "family with sequence similarity 71 member F2"], ["ZNF493", "-2.24829", "0.000671", "0.019525", "-3.58587", "Down", "zinc finger protein 493"], ["CEP135", "-2.24319", "1.89E-05", "0.003342", "-4.64292", "Down", "centrosomal protein 135"], ["CEP126", "-2.24051", "0.001032", "0.024341", "-3.44789", "Down", "centrosomal protein 126"], ["ASTN2", "-2.23592", "0.001156", "0.026012", "-3.41115", "Down", "astrotactin 2"], ["IPP", "-2.22612", "0.000101", "0.007163", "-4.16214", "Down", "intracisternal A particle-promoted polypeptide"], ["TANGO6", "-2.2248", "0.000418", "0.015262", "-3.73417", "Down", "transport and golgi organization 6 homolog"], ["ZXDC", "-2.22107", "0.001926", "0.033211", "-3.24265", "Down", "ZXD family zinc finger C"], ["TMCO4", "-2.21386", "0.000912", "0.022891", "-3.48775", "Down", "transmembrane and coiled-coil domains 4"], ["WSCD1", "-2.20938", "1.36E-05", "0.003004", "-4.73545", "Down", "WSC domain containing 1"], ["PLXNB3", "-2.20331", "0.000194", "0.010359", "-3.96765", "Down", "plexin B3"], ["SPAST", "-2.19723", "0.003713", "0.047358", "-3.01835", "Down", "spastin"], ["LRSAM1", "-2.19647", "0.00028", "0.012403", "-3.85725", "Down", "leucine rich repeat and sterile alpha motif containing 1"], ["BANP", "-2.19578", "0.002678", "0.039958", "-3.13116", "Down", "BTG3 associated nuclear protein"], ["SCAF4", "-2.1951", "0.001471", "0.028954", "-3.33217", "Down", "SR-related CTD associated factor 4"], ["SDCCAG8", "-2.19392", "0.001272", "0.026966", "-3.38007", "Down", "serologically defined colon cancer antigen 8"], ["KCNQ1OT1", "-2.19178", "0.002417", "0.037819", "-3.16609", "Down", "KCNQ1 opposite strand/antisense transcript 1"], ["CD82", "-2.18167", "0.001254", "0.026814", "-3.38461", "Down", "CD82 molecule"], ["KIAA0754", "-2.17697", "0.000994", "0.023761", "-3.46018", "Down", "KIAA0754"], ["PTPRN2", "-2.17646", "0.00099", "0.023704", "-3.46132", "Down", "protein tyrosine phosphatase receptor type N2"], ["MYLK-AS1", "-2.16901", "0.000153", "0.009259", "-4.03959", "Down", "MYLK antisense RNA 1"], ["PLXDC1", "-2.16377", "0.001307", "0.027262", "-3.37099", "Down", "plexin domain containing 1"], ["TDRD5", "-2.15738", "4.87E-05", "0.005015", "-4.37413", "Down", "tudor domain containing 5"], ["LCAT", "-2.15173", "0.000278", "0.012383", "-3.85932", "Down", "lecithin-cholesterol acyltransferase"], ["PRDM11", "-2.15109", "6.78E-07", "0.001025", "-5.54474", "Down", "PR/SET domain 11"], ["RASIP1", "-2.14799", "0.000745", "0.02059", "-3.55262", "Down", "Ras interacting protein 1"], ["SPN", "-2.14456", "0.002682", "0.039958", "-3.13065", "Down", "sialophorin"], ["SHISA9", "-2.14372", "0.00386", "0.048313", "-3.0047", "Down", "shisa family member 9"], ["ANKRD6", "-2.14267", "0.003628", "0.046875", "-3.0264", "Down", "ankyrin repeat domain 6"], ["MAK", "-2.13779", "2.41E-05", "0.003515", "-4.57405", "Down", "male germ cell associated kinase"], ["EPHA4", "-2.13565", "0.000848", "0.022087", "-3.51135", "Down", "EPH receptor A4"], ["UBR5-AS1", "-2.12673", "2.81E-05", "0.003842", "-4.53078", "Down", "UBR5 antisense RNA 1"], ["CTC1", "-2.12661", "0.003144", "0.043426", "-3.07609", "Down", "CST telomere replication complex component 1"], ["NPHP4", "-2.12045", "7.65E-05", "0.006152", "-4.24347", "Down", "nephrocystin 4"], ["RFX3", "-2.11961", "0.000286", "0.012464", "-3.85121", "Down", "regulatory factor X3"], ["PLD1", "-2.10857", "0.000478", "0.016343", "-3.69227", "Down", "phospholipase D1"], ["ZNF474", "-2.10767", "3.19E-06", "0.001776", "-5.13193", "Down", "zinc finger protein 474"], ["LCK", "-2.10338", "0.000224", "0.011092", "-3.92537", "Down", "LCK proto-oncogene, Src family tyrosine kinase"], ["ZCCHC4", "-2.10229", "0.002042", "0.034193", "-3.22302", "Down", "zinc finger CCHC-type containing 4"], ["PRPS2", "-2.09872", "0.001319", "0.027418", "-3.3681", "Down", "phosphoribosyl pyrophosphate synthetase 2"], ["TAF4B", "-2.09126", "0.000171", "0.009664", "-4.00627", "Down", "TATA-box binding protein associated factor 4b"], ["CDC42BPA", "-2.08947", "0.001389", "0.028155", "-3.3511", "Down", "CDC42 binding protein kinase alpha"], ["LINC01230", "-2.0891", "0.00033", "0.013567", "-3.80731", "Down", "long intergenic non-protein coding RNA 1230"], ["CPAMD8", "-2.08813", "0.000302", "0.012829", "-3.83385", "Down", "C3 and PZP like alpha-2-macroglobulin domain containing 8"], ["PARP9", "-2.08698", "0.001921", "0.033188", "-3.24363", "Down", "poly (ADP-ribose) polymerase family member 9"], ["ZFYVE27", "-2.08654", "0.000479", "0.016343", "-3.69181", "Down", "zinc finger FYVE-type containing 27"], ["IWS1", "-2.08516", "0.002881", "0.041667", "-3.10619", "Down", "interacts with SUPT6H, CTD assembly factor 1"], ["MMRN1", "-2.08143", "0.000451", "0.015882", "-3.7104", "Down", "multimerin 1"], ["ST20-AS1", "-2.07521", "6.76E-06", "0.00223", "-4.92723", "Down", "ST20 antisense RNA 1"], ["CALCR", "-2.07464", "5.03E-05", "0.005083", "-4.36486", "Down", "calcitonin receptor"], ["KAT7", "-2.06821", "0.003226", "0.043983", "-3.06718", "Down", "lysine acetyltransferase 7"], ["ARHGAP22", "-2.05873", "4.78E-06", "0.002061", "-5.02181", "Down", "Rho GTPase activating protein 22"], ["TMEM199", "-2.05777", "0.002257", "0.036467", "-3.18933", "Down", "transmembrane protein 199"], ["NTN1", "-2.05766", "0.000168", "0.009643", "-4.01109", "Down", "netrin 1"], ["LAMA5", "-2.05607", "0.002141", "0.035221", "-3.20706", "Down", "laminin subunit alpha 5"], ["SPNS3", "-2.05195", "2.18E-05", "0.00341", "-4.60239", "Down", "sphingolipid transporter 3 (putative)"], ["NEDD4L", "-2.04969", "0.001542", "0.029477", "-3.31678", "Down", "NEDD4 like E3 ubiquitin protein ligase"], ["BSN", "-2.04855", "2.9E-05", "0.003871", "-4.52186", "Down", "bassoon presynaptic cytomatrix protein"], ["TMED8", "-2.04722", "7.63E-06", "0.002243", "-4.89431", "Down", "transmembrane p24 trafficking protein family member 8"], ["STRBP", "-2.04479", "0.003521", "0.046281", "-3.03684", "Down", "spermatid perinuclear RNA binding protein"], ["ATP13A4", "-2.04282", "5.91E-05", "0.005493", "-4.3185", "Down", "ATPase 13A4"], ["KLC2", "-2.03984", "0.001017", "0.024181", "-3.45276", "Down", "kinesin light chain 2"], ["RLF", "-2.03665", "0.001889", "0.032833", "-3.2492", "Down", "rearranged L-myc fusion"], ["TTF1", "-2.03264", "0.002608", "0.03937", "-3.14019", "Down", "transcription termination factor 1"], ["TMEM79", "-2.0311", "5.41E-05", "0.005279", "-4.34419", "Down", "transmembrane protein 79"], ["ZCCHC2", "-2.02905", "0.002297", "0.036735", "-3.18334", "Down", "zinc finger CCHC-type containing 2"], ["ANKRD13B", "-2.02722", "0.001008", "0.024036", "-3.45558", "Down", "ankyrin repeat domain 13B"], ["IFT122", "-2.02015", "0.002868", "0.041571", "-3.10772", "Down", "intraflagellar transport 122"], ["MAP 3K14", "-2.01534", "0.003484", "0.046026", "-3.0405", "Down", "mitogen-activated protein kinase kinasekinase 14"], ["SPATA6L", "-2.01191", "3.29E-05", "0.004116", "-4.48594", "Down", "spermatogenesis associated 6 like"], ["SCOC-AS1", "-2.01128", "0.00093", "0.023147", "-3.48171", "Down", "SCOC antisense RNA 1"], ["LMO7", "-2.00579", "0.000573", "0.017831", "-3.63573", "Down", "LIM domain 7"], ["MEX3B", "-1.99674", "2.01E-05", "0.00341", "-4.6259", "Down", "mex-3 RNA binding family member B"], ["IQCK", "-1.99382", "0.00025", "0.011782", "-3.89149", "Down", "IQ motif containing K"], ["GPATCH1", "-1.9934", "0.000126", "0.008296", "-4.09746", "Down", "G-patch domain containing 1"], ["HPS4", "-1.98942", "0.002434", "0.037832", "-3.16378", "Down", "HPS4 biogenesis of lysosomal organelles complex 3 subunit 2"], ["FGFR3", "-1.98496", "1.56E-05", "0.003137", "-4.6955", "Down", "fibroblast growth factor receptor 3"], ["GABRA4", "-1.98306", "0.000116", "0.007921", "-4.1216", "Down", "gamma-aminobutyric acid type A receptor alpha4 subunit"], ["TMEM116", "-1.97917", "0.000648", "0.0191", "-3.5967", "Down", "transmembrane protein 116"], ["CTU1", "-1.97326", "4.92E-06", "0.002061", "-5.01408", "Down", "cytosolic thiouridylase subunit 1"], ["PPIEL", "-1.9687", "0.002144", "0.035221", "-3.20669", "Down", "peptidylprolylisomerase E like pseudogene"], ["FUT11", "-1.965", "0.000688", "0.019806", "-3.57787", "Down", "fucosyltransferase 11"], ["TOP3A", "-1.96066", "0.00295", "0.04205", "-3.098", "Down", "DNA topoisomerase III alpha"], ["C22orf34", "-1.95954", "0.000251", "0.011782", "-3.89083", "Down", "chromosome 22 open reading frame 34"], ["ASIC3", "-1.95737", "4.65E-05", "0.005", "-4.38764", "Down", "acid sensing ion channel subunit 3"], ["SNPH", "-1.95235", "0.002152", "0.035284", "-3.20546", "Down", "syntaphilin"], ["ZNF547", "-1.95217", "0.000487", "0.016474", "-3.68677", "Down", "zinc finger protein 547"], ["FEZ1", "-1.94468", "0.000873", "0.022405", "-3.50206", "Down", "fasciculation and elongation protein zeta 1"], ["ENTPD5", "-1.94339", "0.000264", "0.012058", "-3.87463", "Down", "ectonucleoside triphosphate diphosphohydrolase 5 (inactive)"], ["LOC729683", "-1.94235", "2.6E-05", "0.00365", "-4.55269", "Down", "uncharacterized LOC729683"], ["S1PR5", "-1.94099", "8.19E-05", "0.006387", "-4.22381", "Down", "sphingosine-1-phosphate receptor 5"], ["ZNF300P1", "-1.93492", "0.000171", "0.009664", "-4.00596", "Down", "zinc finger protein 300 pseudogene 1"], ["UNC13C", "-1.93485", "0.000438", "0.015649", "-3.7196", "Down", "unc-13 homolog C"], ["LOC101928370", "-1.93447", "2.11E-06", "0.001634", "-5.24334", "Down", "uncharacterized LOC101928370"], ["ZNF555", "-1.92846", "0.000376", "0.014411", "-3.76684", "Down", "zinc finger protein 555"], ["GADD45G", "-1.92497", "0.001994", "0.03385", "-3.23101", "Down", "growth arrest and DNA damage inducible gamma"], ["KCNC1", "-1.92247", "2.19E-05", "0.00341", "-4.60096", "Down", "potassium voltage-gated channel subfamily C member 1"], ["CARD14", "-1.91822", "6.28E-06", "0.002168", "-4.9474", "Down", "caspase recruitment domain family member 14"], ["STK36", "-1.91359", "0.003625", "0.046875", "-3.0267", "Down", "serine/threonine kinase 36"], ["TRIB3", "-1.91164", "0.00031", "0.012992", "-3.82577", "Down", "tribblespseudokinase 3"], ["ZNF124", "-1.9092", "0.000271", "0.012156", "-3.86767", "Down", "zinc finger protein 124"], ["MPZL3", "-1.90884", "0.000298", "0.012703", "-3.83854", "Down", "myelin protein zero like 3"], ["TOR4A", "-1.90324", "0.00029", "0.012546", "-3.84663", "Down", "torsin family 4 member A"], ["MIR3916", "-1.90072", "4.48E-06", "0.002039", "-5.03938", "Down", "microRNA 3916"], ["ZNF334", "-1.89919", "6.18E-06", "0.002168", "-4.9521", "Down", "zinc finger protein 334"], ["TTLL3", "-1.89535", "0.000105", "0.007409", "-4.1499", "Down", "tubulin tyrosine ligase like 3"], ["ZKSCAN3", "-1.89411", "0.001595", "0.030071", "-3.30542", "Down", "zinc finger with KRAB and SCAN domains 3"], ["PAPLN", "-1.88842", "0.001527", "0.029477", "-3.31986", "Down", "papilin, proteoglycan like sulfated glycoprotein"], ["KNTC1", "-1.88703", "0.000207", "0.01061", "-3.94852", "Down", "kinetochore associated 1"], ["SLC1A7", "-1.88316", "0.000163", "0.009559", "-4.01961", "Down", "solute carrier family 1 member 7"], ["BCL9", "-1.87682", "0.00158", "0.029935", "-3.30857", "Down", "BCL9 transcription coactivator"], ["ZNF496", "-1.87502", "0.00041", "0.015068", "-3.74029", "Down", "zinc finger protein 496"], ["LNX2", "-1.87272", "0.003479", "0.045998", "-3.04098", "Down", "ligand of numb-protein X 2"], ["DNAJC18", "-1.8714", "0.000203", "0.010561", "-3.95515", "Down", "DnaJ heat shock protein family (Hsp40) member C18"], ["ZNF114", "-1.86888", "6.34E-05", "0.0056", "-4.29807", "Down", "zinc finger protein 114"], ["VWA3B", "-1.86543", "3.01E-05", "0.003964", "-4.51187", "Down", "von Willebrand factor A domain containing 3B"], ["ARNTL2", "-1.86522", "0.002029", "0.034127", "-3.22522", "Down", "aryl hydrocarbon receptor nuclear translocator like 2"], ["NGFR", "-1.85434", "0.000295", "0.012696", "-3.84106", "Down", "nerve growth factor receptor"], ["CLEC1A", "-1.85306", "0.001166", "0.026095", "-3.40829", "Down", "C-type lectin domain family 1 member A"], ["ZNF687", "-1.85305", "0.003658", "0.047012", "-3.02347", "Down", "zinc finger protein 687"], ["ZNF69", "-1.85271", "2.47E-05", "0.003545", "-4.56704", "Down", "zinc finger protein 69"], ["MTF1", "-1.85038", "0.000974", "0.023505", "-3.46684", "Down", "metal regulatory transcription factor 1"], ["ZNF154", "-1.84509", "0.00012", "0.008053", "-4.11197", "Down", "zinc finger protein 154"], ["SLAMF6", "-1.84139", "0.00019", "0.010241", "-3.9745", "Down", "SLAM family member 6"], ["TMEM255B", "-1.8379", "5.28E-05", "0.005263", "-4.35097", "Down", "transmembrane protein 255B"], ["HLA-H", "-1.83482", "0.002773", "0.040755", "-3.11929", "Down", "major histocompatibility complex, class I, H (pseudogene)"], ["KBTBD7", "-1.82918", "0.000254", "0.011836", "-3.88686", "Down", "kelch repeat and BTB domain containing 7"], ["CDC20B", "-1.82896", "6.91E-05", "0.005946", "-4.2731", "Down", "cell division cycle 20B"], ["SLC44A5", "-1.82893", "1.48E-05", "0.003137", "-4.71193", "Down", "solute carrier family 44 member 5"], ["MEN1", "-1.8227", "0.001593", "0.030071", "-3.30582", "Down", "menin 1"], ["SCNN1D", "-1.82156", "0.003912", "0.048656", "-3.00003", "Down", "sodium channel epithelial 1 delta subunit"], ["PFAS", "-1.81549", "0.002896", "0.041776", "-3.10436", "Down", "phosphoribosylformylglycinamidine synthase"], ["EVA1C", "-1.81455", "0.001419", "0.028438", "-3.34407", "Down", "eva-1 homolog C"], ["TIAM2", "-1.80764", "6.94E-05", "0.005946", "-4.27171", "Down", "TIAM Rac1 associated GEF 2"], ["HLA-F-AS1", "-1.80482", "0.002916", "0.041853", "-3.10204", "Down", "HLA-F antisense RNA 1"], ["TRAPPC9", "-1.80093", "0.00091", "0.022881", "-3.48851", "Down", "trafficking protein particle complex 9"], ["APCDD1L", "-1.80071", "1.64E-05", "0.003137", "-4.68254", "Down", "APC down-regulated 1 like"], ["CYTIP", "-1.79864", "0.001215", "0.026482", "-3.39492", "Down", "cytohesin 1 interacting protein"], ["NUTM1", "-1.79716", "2.14E-05", "0.00341", "-4.60821", "Down", "NUT midline carcinoma family member 1"], ["ARHGAP39", "-1.79263", "0.000319", "0.013245", "-3.81744", "Down", "Rho GTPase activating protein 39"], ["SPTB", "-1.79073", "0.001482", "0.028982", "-3.32988", "Down", "spectrin beta, erythrocytic"], ["ZNF469", "-1.78919", "7.59E-05", "0.006143", "-4.24571", "Down", "zinc finger protein 469"], ["AZIN1-AS1", "-1.78541", "1.92E-05", "0.003347", "-4.63776", "Down", "AZIN1 antisense RNA 1"], ["BCL2L11", "-1.78395", "0.001862", "0.032689", "-3.25392", "Down", "BCL2 like 11"], ["CLDN1", "-1.78076", "0.000331", "0.013573", "-3.80619", "Down", "claudin 1"], ["ZNF836", "-1.77956", "6.7E-06", "0.00223", "-4.92984", "Down", "zinc finger protein 836"], ["APBA1", "-1.77749", "0.002859", "0.041537", "-3.10878", "Down", "amyloid beta precursor protein binding family A member 1"], ["C8orf37", "-1.77616", "0.000155", "0.009321", "-4.03521", "Down", "chromosome 8 open reading frame 37"], ["LOC391322", "-1.77531", "9.16E-06", "0.00249", "-4.84394", "Down", "D-dopachrometautomerase-like"], ["SPATA2L", "-1.77449", "0.002137", "0.035219", "-3.2077", "Down", "spermatogenesis associated 2 like"], ["GLIS1", "-1.7719", "2.07E-05", "0.00341", "-4.61666", "Down", "GLIS family zinc finger 1"], ["LOC389765", "-1.76734", "7.38E-07", "0.001025", "-5.5224", "Down", "kinesin family member 27 pseudogene"], ["DENND2C", "-1.76558", "1.69E-05", "0.003137", "-4.67437", "Down", "DENN domain containing 2C"], ["MFAP3L", "-1.76481", "0.003083", "0.042962", "-3.08279", "Down", "microfibril associated protein 3 like"], ["TREML1", "-1.76402", "5.96E-05", "0.005493", "-4.31615", "Down", "triggering receptor expressed on myeloid cells like 1"], ["DNHD1", "-1.76398", "0.001285", "0.027046", "-3.37662", "Down", "dynein heavy chain domain 1"], ["SETD6", "-1.75933", "5.78E-05", "0.005462", "-4.32489", "Down", "SET domain containing 6, protein lysine methyltransferase"], ["TTC34", "-1.75712", "4.74E-05", "0.005", "-4.38193", "Down", "tetratricopeptide repeat domain 34"], ["SARDH", "-1.74727", "0.000444", "0.015767", "-3.71564", "Down", "sarcosine dehydrogenase"], ["ZNF385C", "-1.74659", "5.06E-06", "0.002061", "-5.00645", "Down", "zinc finger protein 385C"], ["NEXN-AS1", "-1.74174", "0.001791", "0.03205", "-3.26688", "Down", "NEXN antisense RNA 1"], ["CDHR3", "-1.741", "5.08E-05", "0.00511", "-4.36224", "Down", "cadherin related family member 3"], ["SPRYD4", "-1.7362", "0.00381", "0.048018", "-3.00934", "Down", "SPRY domain containing 4"], ["ZSCAN25", "-1.73514", "0.000224", "0.011092", "-3.92529", "Down", "zinc finger and SCAN domain containing 25"], ["FAM157C", "-1.73405", "3.95E-05", "0.004552", "-4.43393", "Down", "family with sequence similarity 157 member C"], ["ARSG", "-1.73192", "0.000264", "0.012045", "-3.8757", "Down", "arylsulfatase G"], ["GLI2", "-1.72398", "8.75E-06", "0.002428", "-4.85662", "Down", "GLI family zinc finger 2"], ["NSUN7", "-1.72112", "0.000383", "0.014539", "-3.76087", "Down", "NOP2/Sun RNA methyltransferase family member 7"], ["BMP3", "-1.71974", "0.00051", "0.016932", "-3.67185", "Down", "bone morphogenetic protein 3"], ["PPT2", "-1.71813", "1.01E-05", "0.002625", "-4.81647", "Down", "palmitoyl-protein thioesterase 2"], ["CCNJL", "-1.7168", "0.00297", "0.042241", "-3.0957", "Down", "cyclin J like"], ["C3orf70", "-1.71506", "1.17E-05", "0.002752", "-4.77652", "Down", "chromosome 3 open reading frame 70"], ["FBF1", "-1.71426", "0.002996", "0.042479", "-3.09265", "Down", "Fas binding factor 1"], ["SEC14L2", "-1.70866", "7.5E-05", "0.006105", "-4.24929", "Down", "SEC14 like lipid binding 2"], ["YPEL4", "-1.70708", "0.000495", "0.016631", "-3.68141", "Down", "yippee like 4"], ["PCDH11Y", "-1.70054", "0.00111", "0.025344", "-3.42438", "Down", "protocadherin 11 Y-linked"], ["AFAP1L2", "-1.68648", "4.19E-05", "0.004645", "-4.41718", "Down", "actin filament associated protein 1 like 2"], ["ZNF674-AS1", "-1.6796", "0.001198", "0.026347", "-3.39966", "Down", "ZNF674 antisense RNA 1 (head to head)"], ["KCNQ4", "-1.67351", "1.12E-05", "0.002709", "-4.78912", "Down", "potassium voltage-gated channel subfamily Q member 4"], ["SULT1B1", "-1.67126", "9.73E-05", "0.00709", "-4.17312", "Down", "sulfotransferase family 1B member 1"], ["MORN1", "-1.66843", "0.000538", "0.01724", "-3.6552", "Down", "MORN repeat containing 1"], ["PCDH17", "-1.66757", "7.41E-05", "0.006068", "-4.25287", "Down", "protocadherin 17"], ["FOXP2", "-1.66727", "0.000941", "0.023272", "-3.47788", "Down", "forkhead box P2"], ["XYLB", "-1.66722", "0.001703", "0.031013", "-3.28371", "Down", "xylulokinase"], ["CTNNA3", "-1.66694", "0.000163", "0.009544", "-4.02144", "Down", "catenin alpha 3"], ["NLRP6", "-1.66633", "0.000524", "0.017152", "-3.66377", "Down", "NLR family pyrin domain containing 6"], ["SLC16A13", "-1.66401", "0.000624", "0.018805", "-3.60875", "Down", "solute carrier family 16 member 13"], ["GLI3", "-1.6638", "0.003245", "0.044179", "-3.06511", "Down", "GLI family zinc finger 3"], ["SYNJ2", "-1.66358", "0.000209", "0.010651", "-3.94618", "Down", "synaptojanin 2"], ["C2orf15", "-1.6617", "0.000283", "0.012404", "-3.85419", "Down", "chromosome 2 open reading frame 15"], ["SCIMP", "-1.65716", "0.002226", "0.036099", "-3.19403", "Down", "SLP adaptor and CSK interacting membrane protein"], ["KIR2DL4", "-1.6566", "0.000227", "0.01115", "-3.92146", "Down", "killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 4"], ["FHL3", "-1.65441", "0.00305", "0.042759", "-3.08659", "Down", "four and a half LIM domains 3"], ["OVGP1", "-1.65215", "1.12E-06", "0.001179", "-5.41243", "Down", "oviductal glycoprotein 1"], ["N4BP3", "-1.65201", "0.000581", "0.017987", "-3.63113", "Down", "NEDD4 binding protein 3"], ["ELOVL7", "-1.64755", "3.88E-05", "0.00453", "-4.43907", "Down", "ELOVL fatty acid elongase 7"], ["ESRG", "-1.64744", "0.001428", "0.028535", "-3.34192", "Down", "embryonic stem cell related"], ["ACTA2-AS1", "-1.64552", "0.000128", "0.008394", "-4.09176", "Down", "ACTA2 antisense RNA 1"], ["CNKSR3", "-1.64218", "7.19E-05", "0.005962", "-4.26146", "Down", "CNKSR family member 3"], ["ZNF347", "-1.63729", "0.002754", "0.040644", "-3.12164", "Down", "zinc finger protein 347"], ["SGMS1-AS1", "-1.6362", "3.3E-06", "0.001776", "-5.12249", "Down", "SGMS1 antisense RNA 1"], ["ZKSCAN2", "-1.63535", "4.67E-05", "0.005", "-4.38616", "Down", "zinc finger with KRAB and SCAN domains 2"], ["AMIGO1", "-1.63486", "0.000936", "0.023198", "-3.47947", "Down", "adhesion molecule with Ig like domain 1"], ["ZC3H10", "-1.63262", "0.001463", "0.028876", "-3.33409", "Down", "zinc finger CCCH-type containing 10"], ["MUC17", "-1.62593", "0.000109", "0.007553", "-4.14108", "Down", "mucin 17, cell surface associated"], ["ZNF559-ZNF177", "-1.62399", "6.21E-05", "0.005556", "-4.30427", "Down", "ZNF559-ZNF177 readthrough"], ["NUTM2D", "-1.62355", "0.000228", "0.011159", "-3.92008", "Down", "NUT family member 2D"], ["ABCB4", "-1.62247", "3.99E-06", "0.001884", "-5.07099", "Down", "ATP binding cassette subfamily B member 4"], ["LOC100652768", "-1.61749", "0.000307", "0.012935", "-3.82956", "Down", "uncharacterized LOC100652768"], ["C8orf58", "-1.61509", "5.62E-06", "0.002118", "-4.97786", "Down", "chromosome 8 open reading frame 58"], ["WRAP73", "-1.61325", "4.07E-06", "0.001884", "-5.06554", "Down", "WD repeat containing, antisense to TP73"], ["SLC24A4", "-1.61174", "2.06E-05", "0.00341", "-4.61911", "Down", "solute carrier family 24 member 4"], ["LENG8-AS1", "-1.61071", "2.39E-05", "0.003497", "-4.57709", "Down", "LENG8 antisense RNA 1"], ["C2orf66", "-1.60563", "1.03E-05", "0.002643", "-4.81096", "Down", "chromosome 2 open reading frame 66"], ["SMIM10L2A", "-1.60523", "9.09E-05", "0.006806", "-4.19335", "Down", "small integral membrane protein 10 like 2A"], ["CYP1B1-AS1", "-1.60433", "0.000107", "0.007513", "-4.14419", "Down", "CYP1B1 antisense RNA 1"], ["CTNND1", "-1.60088", "0.000109", "0.007568", "-4.13895", "Down", "catenin delta 1"], ["ADCY10P1", "-1.60028", "4.19E-05", "0.004645", "-4.4176", "Down", "ADCY10 pseudogene 1"], ["LOC100130298", "-1.59936", "3.39E-05", "0.004196", "-4.47779", "Down", "hCG1816373-like"], ["FLJ42627", "-1.59816", "0.001285", "0.027046", "-3.37677", "Down", "uncharacterized LOC645644"], ["CRISPLD1", "-1.59815", "0.000698", "0.019931", "-3.57312", "Down", "cysteine rich secretory protein LCCL domain containing 1"], ["MESTIT1", "-1.59755", "1.51E-06", "0.001401", "-5.33225", "Down", "MEST intronic transcript 1, antisense RNA"], ["ASPG", "-1.59743", "0.001369", "0.027894", "-3.35594", "Down", "asparaginase"], ["PRICKLE2-AS1", "-1.59631", "0.000336", "0.013596", "-3.80182", "Down", "PRICKLE2 antisense RNA 1"], ["LINC00865", "-1.59557", "2.66E-05", "0.00371", "-4.54615", "Down", "long intergenic non-protein coding RNA 865"], ["LINC01001", "-1.59556", "1.77E-06", "0.001545", "-5.29009", "Down", "long intergenic non-protein coding RNA 1001"], ["GRK4", "-1.59417", "1.69E-05", "0.003137", "-4.67411", "Down", "G protein-coupled receptor kinase 4"], ["ZNF300", "-1.59305", "5.6E-05", "0.005391", "-4.33388", "Down", "zinc finger protein 300"], ["CADM3-AS1", "-1.59265", "7.19E-05", "0.005962", "-4.26163", "Down", "CADM3 antisense RNA 1"], ["SIT1", "-1.59069", "0.000397", "0.014772", "-3.75003", "Down", "signaling threshold regulating transmembrane adaptor 1"], ["LINC01138", "-1.59045", "0.001479", "0.028971", "-3.33042", "Down", "long intergenic non-protein coding RNA 1138"], ["DNAH5", "-1.5878", "0.000268", "0.012109", "-3.87093", "Down", "dynein axonemal heavy chain 5"], ["FAM155B", "-1.58584", "2.87E-05", "0.003871", "-4.52525", "Down", "family with sequence similarity 155 member B"], ["SLC5A4", "-1.58234", "3.27E-06", "0.001776", "-5.12479", "Down", "solute carrier family 5 member 4"], ["ZNF573", "-1.58059", "6.33E-06", "0.002168", "-4.94541", "Down", "zinc finger protein 573"], ["RCAN3", "-1.5793", "2.89E-05", "0.003871", "-4.52291", "Down", "RCAN family member 3"], ["DNAH3", "-1.57822", "0.000296", "0.012696", "-3.83989", "Down", "dynein axonemal heavy chain 3"], ["UBXN10", "-1.57771", "1.9E-05", "0.003343", "-4.64092", "Down", "UBX domain protein 10"], ["CLEC4A", "-1.57555", "0.003924", "0.048741", "-2.99895", "Down", "C-type lectin domain family 4 member A"], ["RFFL", "-1.57423", "0.000171", "0.009664", "-4.00626", "Down", "ring finger and FYVE like domain containing E3 ubiquitin protein ligase"], ["TMEM130", "-1.57294", "0.000437", "0.015643", "-3.72015", "Down", "transmembrane protein 130"], ["KCNMB4", "-1.57256", "0.003907", "0.048656", "-3.0005", "Down", "potassium calcium-activated channel subfamily M regulatory beta subunit 4"], ["LINC00924", "-1.57057", "0.000165", "0.009593", "-4.01761", "Down", "long intergenic non-protein coding RNA 924"], ["EREG", "-1.57034", "0.000125", "0.008283", "-4.09939", "Down", "epiregulin"], ["URAD", "-1.56639", "0.000704", "0.020012", "-3.5708", "Down", "ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase"], ["SLC22A15", "-1.56367", "0.000564", "0.017736", "-3.64079", "Down", "solute carrier family 22 member 15"], ["ADRA2B", "-1.56339", "0.000592", "0.018192", "-3.62512", "Down", "adrenoceptor alpha 2B"], ["CDH26", "-1.56317", "0.00033", "0.013567", "-3.80719", "Down", "cadherin 26"], ["ZNF596", "-1.5628", "0.000227", "0.01115", "-3.92153", "Down", "zinc finger protein 596"], ["NYAP1", "-1.55572", "3.9E-05", "0.004533", "-4.43763", "Down", "neuronal tyrosine phosphorylated phosphoinositide-3-kinase adaptor 1"], ["SFRP5", "-1.55537", "0.000468", "0.016151", "-3.699", "Down", "secreted frizzled related protein 5"], ["LOC101929574", "-1.55461", "0.001368", "0.027894", "-3.35602", "Down", "uncharacterized LOC101929574"], ["RNF207", "-1.54999", "7.31E-06", "0.002243", "-4.90599", "Down", "ring finger protein 207"], ["NRL", "-1.54936", "2.58E-05", "0.003634", "-4.55549", "Down", "neural retina leucine zipper"], ["ANGPTL6", "-1.54763", "0.00025", "0.011782", "-3.89133", "Down", "angiopoietin like 6"], ["ALOX15", "-1.54749", "0.000145", "0.009003", "-4.0563", "Down", "arachidonate 15-lipoxygenase"], ["CHEK2", "-1.54682", "0.001992", "0.03385", "-3.23132", "Down", "checkpoint kinase 2"], ["ZNF543", "-1.54508", "0.00303", "0.042657", "-3.08876", "Down", "zinc finger protein 543"], ["ZNF717", "-1.54439", "0.000156", "0.009363", "-4.03319", "Down", "zinc finger protein 717"], ["FASLG", "-1.54428", "0.001265", "0.026877", "-3.38181", "Down", "Fas ligand"], ["LILRA3", "-1.5435", "1.84E-05", "0.003308", "-4.65038", "Down", "leukocyte immunoglobulin like receptor A3"], ["NEK10", "-1.54346", "0.00012", "0.008053", "-4.11146", "Down", "NIMA related kinase 10"], ["MIR1914", "-1.543", "0.000489", "0.016519", "-3.68532", "Down", "microRNA 1914"], ["BATF3", "-1.54097", "0.000518", "0.017057", "-3.667", "Down", "basic leucine zipper ATF-like transcription factor 3"], ["AVIL", "-1.54065", "0.000332", "0.013573", "-3.80487", "Down", "advillin"], ["KLK10", "-1.54034", "7.07E-05", "0.005956", "-4.26664", "Down", "kallikrein related peptidase 10"], ["ZNF689", "-1.53954", "0.003253", "0.04422", "-3.06429", "Down", "zinc finger protein 689"], ["MKLN1-AS", "-1.53911", "0.00209", "0.0347", "-3.2153", "Down", "MKLN1 antisense RNA"], ["LOC100128398", "-1.53652", "0.002092", "0.034722", "-3.21487", "Down", "uncharacterized LOC100128398"], ["LRP1-AS", "-1.53646", "4.89E-05", "0.005015", "-4.37323", "Down", "LRP1 antisense RNA"], ["NPIPA1", "-1.5363", "0.003113", "0.043191", "-3.07949", "Down", "nuclear pore complex interacting protein family member A1"], ["NLRP2", "-1.53625", "0.00031", "0.012977", "-3.82661", "Down", "NLR family pyrin domain containing 2"], ["MMEL1", "-1.5346", "0.000336", "0.013596", "-3.80163", "Down", "membrane metalloendopeptidase like 1"], ["SPDYE5", "-1.53457", "0.000116", "0.007921", "-4.12051", "Down", "speedy/RINGO cell cycle regulator family member E5"], ["CCL28", "-1.5342", "5.69E-05", "0.005435", "-4.32942", "Down", "C-C motif chemokine ligand 28"], ["KLHDC1", "-1.53297", "0.000501", "0.016732", "-3.67754", "Down", "kelch domain containing 1"], ["FRMPD1", "-1.53279", "4.28E-05", "0.004701", "-4.41134", "Down", "FERM and PDZ domain containing 1"], ["LINC00211", "-1.53271", "0.00019", "0.010241", "-3.97414", "Down", "long intergenic non-protein coding RNA 211"], ["ATP6V1G2", "-1.53264", "0.000799", "0.021227", "-3.53045", "Down", "ATPase H+ transporting V1 subunit G2"], ["PRIMA1", "-1.53113", "0.000786", "0.021056", "-3.53546", "Down", "proline rich membrane anchor 1"], ["NPTX1", "-1.52859", "0.000253", "0.011808", "-3.88811", "Down", "neuronal pentraxin 1"], ["LOC101928107", "-1.5272", "0.0003", "0.012783", "-3.83612", "Down", "uncharacterized LOC101928107"], ["GFRA3", "-1.5245", "8.59E-06", "0.002428", "-4.86161", "Down", "GDNF family receptor alpha 3"], ["LOC101929595", "-1.51972", "1.12E-05", "0.002709", "-4.78841", "Down", "uncharacterized LOC101929595"], ["FLJ37453", "-1.51859", "7.55E-06", "0.002243", "-4.8971", "Down", "uncharacterized LOC729614"], ["MACC1", "-1.51799", "0.000573", "0.017831", "-3.6354", "Down", "MET transcriptional regulator MACC1"], ["LINC00607", "-1.51637", "2.68E-05", "0.00371", "-4.5447", "Down", "long intergenic non-protein coding RNA 607"], ["FAM86B1", "-1.5153", "0.000332", "0.013573", "-3.80528", "Down", "family with sequence similarity 86 member B1"], ["MIR4477B", "-1.51191", "2.05E-05", "0.00341", "-4.62019", "Down", "microRNA 4477b"], ["CNNM2", "-1.50798", "0.001668", "0.03072", "-3.29062", "Down", "cyclin and CBS domain divalent metal cation transport mediator 2"], ["SKA1", "-1.50659", "0.00086", "0.02226", "-3.50665", "Down", "spindle and kinetochore associated complex subunit 1"], ["ABRACL", "-1.50603", "0.001136", "0.025784", "-3.41701", "Down", "ABRA C-terminal like"], ["LINC00954", "-1.50484", "0.000652", "0.019135", "-3.59472", "Down", "long intergenic non-protein coding RNA 954"], ["ZBP1", "-1.50412", "0.002141", "0.035221", "-3.20719", "Down", "Z-DNA binding protein 1"], ["ZNF528", "-1.50042", "0.000464", "0.016097", "-3.70168", "Down", "zinc finger protein 528"], ["ACTG1P4", "-1.50023", "0.000252", "0.011803", "-3.88932", "Down", "actin gamma 1 pseudogene 4"], ["MYO10", "-1.50014", "0.003103", "0.043113", "-3.08058", "Down", "myosin X"]], "row_count": 740, "column_count": 7, "numeric_cells": 3763, "header_rows": 1, "locator": "section[13]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:33622336:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b05de603893be1d8efd12e537f53ea5636f28381cb8e98bca17139dbaf06e918", "bytes": 5269, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab3", "version": null, "note": "The enriched GO terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC7901211", "section_index": 5, "section_title": "GO and pathway enrichment of DEGs in PCOS", "row_count": 15, "column_count": 9}, "table": {"label": "Table 3", "caption": "The enriched GO terms of the up and down regulated differentially expressed genes", "rows": [["GO ID", "CATEGORY", "GO Name", "P Value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["GO:0006518", "BP", "peptide metabolic process", "1.51E-13", "2.66E-11", "2.37E-10", "6.37E-10", "52", "RPL24,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,RPLP0,MRPL12,MRPS12,RPS5,RPS8,ETF1,RPS10,EIF3E,RPS15,RPS15A,SRP72,RPS20,RPS21,RPS23,RPS24,RPS29,EIF6,EIF3L,MRPS21,MRPL24,MRPL20,COA3,RBM3,TRMT112,MRPL54,CPE,RPL14,RPS27L,EIF2D,DPH5,EIF1AX,ATP6AP2,ZNF706,SEC11A,MRPS24,UHMK1,EIF5,MRPS15,MRPS6,MRPS34,LSM14A,RPL35,RPL13A,MRPL9,RSL24D1"], ["GO:0006886", "BP", "intracellular protein transport", "6.75E-12", "8.16E-10", "7.28E-09", "2.86E-08", "66", "GIPC1,SNAPIN,RPL24,TCTN3,RPL27,RPL30,RPL29,RPL34,ROMO1,RPL35A,RPL36A,RPLP0,RPS5,RPS8,RPS10,RPS15,RPS15A,PHB2,SRP72,RPS20,HMGCL,RPS21,RPS23,RPS24,RPS29,ARFIP2,TOMM5,EIF6,RAB10,ATP6V1D,SNX8,PEX19,AGFG1,PEX2,ZFAND6,RABGEF1,SNX9,RAB4A,PMM1,TOMM7,SRSF6,ANP32B,RPAIN,TNPO2,DERL2,FIS1,RPL14,APOD,ECH1,IFI27,YWHAH,TMED4,ARF5,NDUFA13,EXOC5,EIF2D,UBL5,TIMM8B,ICMT,UHMK1,DYNLL2,VPS28,RPL35,SYVN1,RPL13A,STX10"], ["GO:0031967", "CC", "organelle envelope", "2.36E-19", "1.71E-17", "1.20E-16", "1.47E-16", "72", "ROMO1,PRELID1,MRPL12,MRPS12,PET100,BAK1,PHB2,LRRC59,HMGCL,GCHFR,COA4,NDUFA2,SLC25A26,BLOC1S1,ECSIT,SUCLG1,NDUFB2,TOMM5,NDUFC2,BANF1,MOAP1,NDUFS4,NDUFS5,PHB,BNIP3,PI4KB,FDX1,MRPS21,AGFG1,SLC25A11,TMEM97,UQCRC1,UQCRFS1,UQCRH,UQCR11,NME2,MRPL24,CERS2,MRPL20,TOMM7,COA3,COX4I1,COX5B,DTYMK,ANXA4,COX6A1,NDUFAF3,COX6B1,MRPL54,COX6C,COX7A2,COX7C,COX8A,FIS1,IFI27,MAD2L1BP,CCND2,NDUFA13,CYB5B,TMEM256,TIMM8B,AIFM1,MRPS24,MRPS15,CHCHD2,MRPS6,MRPS34,COX7A2L,UQCRQ,HSD17B10,MTDH,MRPL9"], ["GO:1902494", "CC", "catalytic complex", "1.31E-12", "5.84E-11", "4.09E-10", "8.17E-10", "67", "PRPF31,DCAF6,ERH,SAP18,OST4,PSMB1,PSMB4,ETFB,PSMB7,PSMC5,PSMD3,PSMD10,NDUFA2,EZH1,SUCLG1,NDUFB2,NDUFC2,NDUFS4,NDUFS5,LSM3,CKS1B,TSPAN17,SLC9A3R1,UBE2E1,RBMX,MORF4L1,PEX2,AK1,PRMT1,UQCRC1,UQCRFS1,UQCRH,TAF7,ANAPC5,TADA3,ANAPC13,RBX1,CUL4A,POLR3GL,RBBP7,PIGS,POLR2J,POLR2K,DERL2,BCCIP,POLE4,NAA38,CCNC,CCND2,RMRP,NDUFA13,POLR1D,GTF2A2,ORMDL1,SEC11A,SF3B6,DYNLL2,SMARCD2,UQCRQ,HSD17B10,KLHL12,SYVN1,CDC27,PSMD14,SNRPD2,RPPH1,KRTCAP2"], ["GO:0003723", "MF", "RNA binding", "1.66E-10", "4.49E-08", "3.30E-07", "1.45E-07", "76", "RPL24,PRPF31,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,ERH,RPLP0,MRPL12,MRPS12,SAP18,RSL1D1,RPS5,RPS8,ETF1,RPS10,EIF3E,RPS15,RPS15A,SRP72,RPS20,LRRC59,RPS21,RPS23,RPS24,SUCLG1,EIF6,LSM3,RBMX,EIF3L,MRPS21,NQO1,AGFG1,LSM4,PRMT1,SLC25A11,TBCA,MRPL20,NUDT16,SRSF6,S100A16,GLRX3,RBBP7,RBM3,MRPL54,NELFB,BCCIP,RDX,RPL14,C7orf50,XRCC5,SERPINH1,RPS27L,EIF2D,GTF3A,FAM32A,EIF1AX,SBDS,SF3B6,MRPS24,UHMK1,EIF5,MRPS15,SLTM,MRPS6,LSM14A,HSD17B10,RPL35,RPL13A,SNRPD2,MTDH,MRPL9,SF3B5,RSL24D1"], ["GO:0008134", "MF", "transcription factor binding", "1.05E-02", "1.83E-01", "1.00E+00", "1.00E+00", "23", "NAB1,PHB2,PSMC5,FAM89B,NBN,PSMD10,MDFI,TAF7,SETD3,TADA3,RBX1,WIPI1,ANXA4,TEAD3,IFI27,YWHAH,GTF2A2,MED4,ICMT,CHCHD2,HSD17B10,MTDH,TRIB1"], ["Down regulated genes"], ["GO:0120036", "BP", "plasma membrane bounded cell projection organization", "7.28E-05", "2.19E-02", "1.94E-01", "2.91E-01", "49", "EPHB4,STK36,MAK,SPAST,ZFYVE27,TTLL3,MYO7A,MYO10,SDCCAG8,SPTB,SARM1,RAP1GAP2,NPHP4,GFRA3,AMIGO1,HECW2,GLI2,GLI3,SYNE2,WRAP73,NGFR,NTN1,NLGN2,FGFR3,PLD1,CEP126,NYAP1,DNAH5,UBXN10,PLXNB3,SEMA6B,FAT4,NPTX1,NEDD4L,STXBP5,FBF1,LAMA5,RFFL,ODF2,FAS,RFX3,ATL1,TRAK1,WDR19,FEZ1,AVIL,CEP135,IFT122,EPHA4"], ["GO:0000902", "BP", "cell morphogenesis", "3.10E-03", "1.93E-01", "1.00E+00", "1.00E+00", "31", "EPHB4,CDH26,SPAST,ZFYVE27,MYO7A,MYO10,CDHR3,SPTB,SARM1,GFRA3,AMIGO1,HECW2,GLI2,GLI3,NGFR,NTN1,FGFR3,NYAP1,PLXNB3,SEMA6B,NPTX1,NEDD4L,STXBP5,LAMA5,CDH19,ATL1,TRAK1,WDR19,FEZ1,C8orf37,EPHA4"], ["GO:0043005", "CC", "neuron projection", "3.65E-05", "7.26E-03", "5.00E-02", "2.00E-02", "46", "EPHB4,MAK,PDE4B,SNPH,SPAST,ZFYVE27,MYO7A,MYO10,ESR1,SDCCAG8,SARM1,RAP1GAP2,N4BP3,NPHP4,SNAP47,TIAM2,AMIGO1,KCNC1,PTPRN2,SYNJ2,NGFR,NLGN2,BSN,NPTX1,CALCR,PLXDC1,STXBP5,ERO1A,GRK4,AAK1,APBA1,KLC2,VTI1A,FAS,ATL1,TRAK1,WDR19,SHISA9,FEZ1,KCNQ4,AVIL,UNC13C,IFT122,CTNND1,EPHA4,GABRA4"], ["GO:0030054", "CC", "cell junction", "3.04E-03", "8.34E-02", "5.74E-01", "1.00E+00", "34", "CDH26,SNPH,CDHR3,SDCCAG8,SARM1,OBSCN,NPHP4,ABCB4,ARHGAP22,RASIP1,PTPRN2,SYNE2,LPXN,NGFR,NLGN2,FGFR3,BSN,FHL3,CDC42BPA,PLXDC1,STXBP5,FBF1,LCK,CDH19,CLDN1,PRIMA1,SHISA9,LMO7,CTNNA3,UNC13C,C8orf37,CTNND1,EPHA4,GABRA4"], ["GO:0000981", "MF", "DNA-binding transcription factor activity, RNA polymerase II-specific", "9.75E-04", "3.67E-01", "1.00E+00", "7.35E-01", "43", "ZNF717,ZXDC,HIVEP1,ERG,ZNF154,ESR1,ZSCAN25,ARNTL2,ZNF836,ZNF469,ZNF547,GLI2,GLI3,ZNF347,ZNF778,BATF3,TET3,ZNF687,ZNF114,MACC1,ZNF555,ZNF493,FOXP2,NRL,ZNF596,ZNF689,ZNF300,ZKSCAN2,RFX3,ZNF496,IKZF4,RLF,KAT7,DMRT2,ZNF334,MTF1,ZKSCAN3,ZNF559-ZNF177,ZNF69,ZNF528,ZNF543,GLIS1,ZNF124"], ["GO:0005524", "MF", "ATP binding", "2.83E-02", "4.14E-01", "1.00E+00", "1.00E+00", "34", "EPHB4,PRPS2,STK36,MAK,CNNM2,SPAST,TTLL3,MYO7A,MYO10,NEK10,OBSCN,PFAS,TOR4A,ABCB4,FGFR3,XYLB,DNAH5,DNHD1,ATP13A4,DNAH3,CDC42BPA,ATP13A1,GRK4,MAP 3K14,AAK1,ABCC5,LCK,NLRP2,NLRP6,TRIB3,CHEK2,ERCC6L2,MAST3,EPHA4"]], "row_count": 15, "column_count": 9, "numeric_cells": 84, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab3"}}, {"id": "asset:table:pmid:33622336:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:65ad56a7f037ac73d76d9b34b28d9e76c81c1995e593f54aba172a7af1f31749", "bytes": 3457, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#Tab4", "version": null, "note": "The enriched pathway terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC7901211", "section_index": 5, "section_title": "GO and pathway enrichment of DEGs in PCOS", "row_count": 15, "column_count": 8}, "table": {"label": "Table 4", "caption": "The enriched pathway terms of the up and down regulated differentially expressed genes", "rows": [["Pathway ID", "Pathway Name", "P-value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Geness"], ["Up regulated genes"], ["1268678", "Translation", "8.83E-20", "4.54E-17", "3.26E-16", "6.54E-17", "30", "RPL24,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,RPLP0,RPS5,RPS8,ETF1,RPS10,EIF3E,RPS15,RPS15A,SRP72,RPS20,RPS21,RPS23,RPS24,RPS29,EIF3L,TRMT112,RPL14,RPS27L,EIF1AX,SEC11A,EIF5,RPL35,RPL13A"], ["1270128", "Respiratory electron transport", "2.39E-16", "1.27E-14", "9.10E-14", "1.77E-13", "22", "ETFB,NDUFA2,ECSIT,NDUFB2,NDUFC2,NDUFS4,NDUFS5,UQCRC1,UQCRFS1,UQCRH,UQCR11,COX4I1,COX5B,COX6A1,NDUFAF3,COX6B1,COX6C,COX7C,COX8A,NDUFA13,COX7A2L,UQCRQ"], ["1268677", "Metabolism of proteins", "6.29E-10", "1.46E-08", "1.05E-07", "4.66E-07", "72", "B4GALT2,RPL24,RPL27,RPL30,RPL29,UAP1,RPL34,RPL35A,RPL36A,RPLP0,RPS5,PSMB1,RPS8,ETF1,RPS10,PSMB4,ETFB,EIF3E,PSMB7,RPS15,RPS15A,PSMC5,SRP72,PSMD3,RPS20,PFDN1,RPS21,RPS23,PFDN5,PSMD10,RPS24,COA4,RPS29,TOMM5,GFPT1,NEDD8,RAB10,SAA1,UBE2E1,UCHL1,EIF3L,TADA3,RAB4A,TBCA,PMM1,TOMM7,WIPI1,TRMT112,TNIP2,PIGS,AMDHD2,USP24,DERL2,CPE,RPL14,RPS27L,ARF5,EXOC5,TIMM8B,DPH5,ICMT,EIF1AX,ATP6AP2,SEC11A,DYNLL2,EIF5,CHCHD2,SUMO3,RPL35,SYVN1,RPL13A,PSMD14"], ["1269649", "Gene Expression", "1.72E-09", "3.85E-08", "2.77E-07", "1.27E-06", "77", "CDKN2B,RPL24,PRPF31,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,PRELID1,TMEM219,RPLP0,SAP18,RPS5,PSMB1,RPS8,ETF1,RPS10,PSMB4,EIF3E,PSMB7,RPS15,RPS15A,PSMC5,NBN,SRP72,PSMD3,RPS20,RPS21,RPS23,PSMD10,RPS24,RPS29,LSM3,RBMX,EIF3L,NABP2,LSM4,PRMT1,TAF7,SRSF6,POLR3GL,RBBP7,COX4I1,TRMT112,COX5B,COX6A1,COX6B1,POLR2J,POLR2K,NELFB,COX6C,COX7C,COX8A,RPL14,TEAD3,SKIL,YWHAH,RPS27L,CCNC,POLR1D,GTF2A2,MED4,GTF3A,LAMTOR4,EIF1AX,ZNF706,SEC11A,SF3B6,EIF5,COX7A2L,HSD17B10,RPL35,RPL13A,PSMD14,SNRPD2,SF3B5"], ["1269852", "Autodegradation of Cdh1 by Cdh1:APC/C", "1.22E-06", "2.58E-05", "1.86E-04", "9.04E-04", "10", "PSMB1,PSMB4,PSMB7,PSMC5,PSMD3,PSMD10,UBE2E1,ANAPC5,CDC27,PSMD14"], ["1268843", "Mitochondrial translation initiation", "2.55E-06", "4.96E-05", "3.57E-04", "1.89E-03", "11", "MRPL12,MRPS12,MRPS21,MRPL24,MRPL20,MRPL54,MRPS24,MRPS15,MRPS6,MRPS34,MRPL9"], ["Down regulated genes"], ["1269650", "Generic Transcription Pathway", "1.96E-04", "1.10E-01", "7.63E-01", "1.10E-01", "29", "ZNF717,ZNF486,ZNF154,ESR1,ZSCAN25,MEN1,ZNF547,BANP,ZNF347,ZNF778,TAF4B,ZNF114,ZNF573,ZNF555,ZNF493,NEDD4L,ZNF596,ZNF689,ZNF300,RFFL,FAS,ZNF496,ZNF334,ZKSCAN3,CHEK2,ZNF528,ZNF543,TOP3A,ZNF124"], ["1269903", "Transmembrane transport of small molecules", "2.80E-02", "7.66E-01", "1.00E+00", "1.00E+00", "18", "ATP6V1G2,SLC22A15,SLCO4A1,ASIC3,ABCB4,SLC24A4,SLC44A5,SCNN1D,SLC9A7,ATP13A4,NEDD4L,ATP13A1,ABCC5,SLC1A7,SLC5A4,SLC30A7,NDC1,GABRA4"], ["1268846", "Cilium Assembly", "3.71E-02", "7.66E-01", "1.00E+00", "1.00E+00", "7", "SDCCAG8,NPHP4,FBF1,ODF2,WDR19,CEP135,IFT122"], ["1269957", "Metabolism of carbohydrates", "1.11E-01", "7.66E-01", "1.00E+00", "1.00E+00", "8", "PRPS2,CHST14,XYLB,MGAM,ABCC5,SLC5A4,NDC1,SLC25A13"], ["1269443", "Signalling by NGF", "1.63E-01", "7.66E-01", "1.00E+00", "1.00E+00", "11", "EREG,SPTB,OBSCN,KBTBD7,GFRA3,TIAM2,NGFR,FGFR3,BCL2L11,LCK,TRIB3"], ["1269171", "Adaptive Immune System", "1.86E-01", "7.66E-01", "1.00E+00", "1.00E+00", "17", "EREG,LRSAM1,HLA-H,RAP1GAP2,KBTBD7,SLAMF6,HECW2,FGFR3,KIR2DL4,TREML1,LILRA3,NEDD4L,MAP 3K14,KLC2,LCK,TRIB3,LMO7"]], "row_count": 15, "column_count": 8, "numeric_cells": 84, "header_rows": 1, "locator": "section[14]/table-wrap[2]#Tab4"}}, {"id": "asset:table:pmid:33622336:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:10f685f5bd14f7490fec09b2b684c305c016ce2bad1d0417b8474343a9cea523", "bytes": 827, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#Tab1", "version": null, "note": "Primers used for quantitative PCR", "structure": {"pmcid": "PMC7901211", "section_index": 10, "section_title": "Validation of the expression levels of candidate genes by RT-PCR", "row_count": 12, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers used for quantitative PCR", "rows": [["Primer sequence (5'→3')"], ["Gene", "Forward", "Reverse"], ["SAA1", "TCGTTCCTTGGCGAGGCTTTTG", "AGGTCCCCTTTTGGCAGCATCA"], ["ADCY6", "CTCCTGGTCCCTAAAGTGGAT", "GGAGGCAGCTCATATAGCGG"], ["POLR2K", "GGAGAGTGTCACACAGAAAATGA", "TCGAGCATCAAAAACGACCAAT"], ["RPS15", "CCCGAGATGATCGGCCACTA", "CCATGCTTTACGGGCTTGTAG"], ["RPS15A", "CTCCAAAGTCATCGTCCGGTT", "TGAGTTGCACGTCAAATCTGG"], ["CTNND1", "GTGACAACACGGACAGTACAG", "TTCTTGCGGAAATCACGACCC"], ["ESR1", "CCCACTCAACAGCGTGTCTC", "CGTCGATTATCTGAATTTGGCCT"], ["NEDD4L", "GACATGGAGCATGGATGGGAA", "GTTCGGCCTAAATTGTCCACT"], ["KNTC1", "ACCTGAGTGTCGGTTCAAGAA", "CACTGATTGGTCGGCTACAATAA"], ["NGFR", "CCTACGGCTACTACCAGGATG", "CACACGGTGTTCTGCTTGT"]], "row_count": 12, "column_count": 3, "numeric_cells": 3, "header_rows": 2, "locator": "section[10]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:33622336:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d8ef0fef2eda67da12aecce8eae9f69ea6ea6e6c9c6a06e311298cb5d1db1126", "bytes": 2258, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#Tab6", "version": null, "note": "miRNA - target gene and TF - target gene interaction", "structure": {"pmcid": "PMC7901211", "section_index": 11, "section_title": "Molecular docking studies", "row_count": 33, "column_count": 8}, "table": {"label": "Table 6", "caption": "miRNA - target gene and TF - target gene interaction", "rows": [["Regulation", "Target Genes", "Degree", "MicroRNA", "Regulation", "Target Genes", "Degree", "TF"], ["Up", "RPL13A", "97", "hsa-mir-8067", "Up", "RBX1", "15", "PER3"], ["Up", "RPS15A", "95", "hsa-mir-4518", "Up", "RPS15", "13", "CTCF"], ["Up", "RPLP0", "71", "hsa-mir-3685", "Up", "RPS20", "12", "E2F7"], ["Up", "ADCY6", "65", "hsa-mir-1202", "Up", "ADCY6", "11", "LMO2"], ["Up", "RPS29", "48", "hsa-mir-4461", "Up", "POLR2K", "9", "POLR2H"], ["Up", "RPL30", "47", "hsa-mir-6811-5p", "Up", "RPS15A", "8", "FOXF2"], ["Up", "RPL35", "44", "hsa-mir-2278", "Up", "RPL35", "8", "MYB"], ["Up", "RPS23", "40", "hsa-mir-4282", "Up", "RPS23", "5", "USF1"], ["Up", "SAA1", "33", "hsa-mir-4701-3p", "Up", "RPL13A", "5", "NFYA"], ["Up", "RPS5", "29", "hsa-mir-1301-3p", "Up", "RPS29", "5", "JUN"], ["Up", "RBX1", "29", "hsa-mir-5187-3p", "Up", "POLR2J", "5", "POLR2C"], ["Up", "RPS20", "26", "hsa-mir-708-5p", "Up", "RPL30", "4", "IRF7"], ["Up", "RPS15", "23", "hsa-mir-1260b", "Up", "RPLP0", "3", "SMAD3"], ["Up", "POLR2K", "13", "hsa-mir-5680", "Up", "RPS5", "3", "GABPA"], ["Up", "POLR2J", "9", "hsa-mir-129-2-3p", "Up", "SAA1", "2", "CEBPB"], ["Down", "CTNND1", "129", "hsa-mir-8082", "Up", "PHB2", "1", "PHB2"], ["Down", "ESR1", "98", "hsa-mir-4422", "Down", "ESR1", "122", "NCOA2"], ["Down", "NEDD4L", "76", "hsa-mir-548am-5p", "Down", "LCK", "21", "EBF1"], ["Down", "KNTC1", "62", "hsa-mir-6886-3p", "Down", "GLI3", "18", "SMAD2"], ["Down", "NGFR", "56", "hsa-mir-9500", "Down", "NEDD4L", "17", "JUND"], ["Down", "TIAM2", "49", "hsa-mir-3679-5p", "Down", "CALCR", "15", "FOXO3"], ["Down", "GLI3", "33", "hsa-mir-1913", "Down", "NGFR", "10", "POU2F1"], ["Down", "FASLG", "25", "hsa-mir-7849-3p", "Down", "FASLG", "8", "DAXX"], ["Down", "PLD1", "22", "hsa-mir-3200-3p", "Down", "CTNND1", "7", "GATA1"], ["Down", "OBSCN", "19", "hsa-mir-3657", "Down", "KNTC1", "5", "SP1"], ["Down", "CALCR", "12", "hsa-mir-4735-5p", "Down", "PLD1", "4", "E2F1"], ["Down", "PTGDR", "11", "hsa-mir-4477b", "Down", "TIAM2", "4", "FOXD1"], ["Down", "CCL28", "8", "hsa-mir-770-5p", "Down", "GLI2", "1", "GLI3"], ["Down", "LCK", "6", "hsa-mir-520c-3p", "Down", "ERG", "1", "ESR1"], ["Down", "S1PR5", "4", "hsa-mir-31-5p", "Down", "PTGDR", "1", "RORA"], ["", "", "", "", "Down", "CCL28", "1", "FOS"], ["", "", "", "", "Down", "OBSCN", "1", "CUX1"]], "row_count": 33, "column_count": 8, "numeric_cells": 110, "header_rows": 1, "locator": "section[20]/table-wrap[1]#Tab6"}}, {"id": "asset:table:pmid:33622336:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a781c090ad2161c4ec6bdf85b64aa485426af6284443a587ab55175b290cddae", "bytes": 865, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[2]#Tab7", "version": null, "note": "Docking results of standard drugs on overexpressed proteins", "structure": {"pmcid": "PMC7901211", "section_index": 11, "section_title": "Molecular docking studies", "row_count": 6, "column_count": 13}, "table": {"label": "Table 7", "caption": "Docking results of standard drugs on overexpressed proteins", "rows": [["Sl. No/ Code", "Over expressed gene: POLR2K", "Over expressed gene: RPS15", "Over expressed gene: RPS15 alpha", "Over expressed gene: SAA1"], ["PDB: 1LE9", "PDB: 3OW2", "PDB: 1G1X", "PDB: 4IP8"], ["Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar"], ["ETE", "8.019", "-0.755", "1.219", "8.223", "-1.768", "2.517", "8.260", "-0.857", "3.135", "9.943", "-1.689", "0.891"], ["LNG", "7.973", "-0.945", "1.295", "8.351", "-2.752", "3.465", "7.854", "-0.599", "2.373", "8.535", "-1.948", "0.057"], ["DSG", "8.273", "-1.124", "1.116", "5.674", "-1.611", "2.212", "7.745", "-1.046", "2.306", "8.158", "-1.997", "0.000"]], "row_count": 6, "column_count": 13, "numeric_cells": 42, "header_rows": 3, "locator": "section[20]/table-wrap[2]#Tab7"}}, {"id": "asset:table:pmid:33622336:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:44d0cf3e60aece51e25b4742155ec584b2693f0aeda578626302871d955b2349", "bytes": 70045, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#Tab2", "version": null, "note": "The statistical metrics for key differentially expressed genes (DEGs)", "structure": {"pmcid": "PMC7901211", "section_index": 13, "section_title": "Identification of DEGs", "row_count": 740, "column_count": 7}, "table": {"label": "Table 2", "caption": "The statistical metrics for key differentially expressed genes (DEGs)", "rows": [["Gene Symbol", "logFC", "p Value", "adj. P.Val", "t value", "Regulation", "Gene Name"], ["SAA2", "4.381364", "3.5E-07", "0.00095", "5.718643", "Up", "serum amyloid A2"], ["PLOD2", "4.201209", "5.64E-07", "0.001025", "5.593469", "Up", "procollagen-lysine,2-oxoglutarate 5-dioxygenase 2"], ["ABI3BP", "4.13442", "2.07E-07", "0.000779", "5.856015", "Up", "ABI family member 3 binding protein"], ["RPPH1", "4.09338", "7.43E-06", "0.002243", "4.901502", "Up", "ribonuclease P RNA component H1"], ["C7orf50", "4.074966", "4.01E-07", "0.00095", "5.683289", "Up", "chromosome 7 open reading frame 50"], ["RMRP", "3.989952", "7.74E-06", "0.002243", "4.890252", "Up", "RNA component of mitochondrial RNA processing endoribonuclease"], ["BNIP3", "3.899781", "2.99E-07", "0.00095", "5.760151", "Up", "BCL2 interacting protein 3"], ["POLE4", "3.874065", "6.35E-07", "0.001025", "5.562056", "Up", "DNA polymerase epsilon 4, accessory subunit"], ["RHBDD2", "3.854997", "4.02E-06", "0.001884", "5.068914", "Up", "rhomboid domain containing 2"], ["F13A1", "3.806046", "1.82E-06", "0.001545", "5.283097", "Up", "coagulation factor XIII A chain"], ["SIVA1", "3.784719", "7.02E-07", "0.001025", "5.535746", "Up", "SIVA1 apoptosis inducing factor"], ["TMEM54", "3.721", "1.5E-09", "1.98E-05", "7.116347", "Up", "transmembrane protein 54"], ["SBDS", "3.630263", "1.28E-05", "0.002885", "4.75139", "Up", "SBDS ribosome maturation factor"], ["CERS2", "3.600241", "1.32E-06", "0.001336", "5.368773", "Up", "ceramide synthase 2"], ["PLA2G2A", "3.575964", "6.92E-07", "0.001025", "5.539611", "Up", "phospholipase A2 group IIA"], ["SAA1", "3.551756", "0.000565", "0.017754", "3.640098", "Up", "serum amyloid A1"], ["PHB2", "3.526406", "1.39E-05", "0.003049", "4.728928", "Up", "prohibitin 2"], ["LSM14A", "3.514098", "2.94E-06", "0.001776", "5.153832", "Up", "LSM14A mRNA processing body assembly factor"], ["MRPL20", "3.513535", "4.93E-05", "0.005042", "4.370518", "Up", "mitochondrial ribosomal protein L20"], ["NEDD8", "3.493441", "7.9E-06", "0.002265", "4.884608", "Up", "NEDD8 ubiquitin like modifier"], ["LRRC59", "3.487927", "5.07E-08", "0.000334", "6.219575", "Up", "leucine rich repeat containing 59"], ["NAA38", "3.483141", "0.000119", "0.008042", "4.113375", "Up", "N (alpha)-acetyltransferase 38, NatC auxiliary subunit"], ["R3HDM4", "3.472879", "0.000181", "0.009987", "3.989599", "Up", "R3H domain containing 4"], ["PI4KB", "3.463829", "2.36E-05", "0.003497", "4.579687", "Up", "phosphatidylinositol 4-kinase beta"], ["RPS27L", "3.462436", "6.2E-05", "0.005556", "4.304481", "Up", "ribosomal protein S27 like"], ["UBL5", "3.458582", "4.83E-05", "0.005015", "4.376605", "Up", "ubiquitin like 5"], ["S100A1", "3.431536", "0.000323", "0.013388", "3.813673", "Up", "S100 calcium binding protein A1"], ["TEAD3", "3.414631", "1.1E-08", "9.64E-05", "6.611182", "Up", "TEA domain transcription factor 3"], ["PRELID1", "3.395554", "1.51E-05", "0.003137", "4.706077", "Up", "PRELI domain containing 1"], ["SNCG", "3.381526", "0.001426", "0.0285", "3.342577", "Up", "synuclein gamma"], ["NDUFAF3", "3.380114", "3.84E-05", "0.00453", "4.442043", "Up", "NADH:ubiquinoneoxidoreductase complex assembly factor 3"], ["LOC101926960", "3.379084", "8.99E-05", "0.006783", "4.196554", "Up", "uncharacterized LOC101926960"], ["MRAP", "3.376232", "0.000186", "0.010117", "3.981504", "Up", "melanocortin 2 receptor accessory protein"], ["EIF1AX", "3.363678", "3.15E-05", "0.004025", "4.498903", "Up", "eukaryotic translation initiation factor 1A X-linked"], ["FIS1", "3.36153", "0.000316", "0.01319", "3.819875", "Up", "fission, mitochondrial 1"], ["LSM4", "3.342924", "2.22E-06", "0.001669", "5.229869", "Up", "LSM4 homolog, U6 small nuclear RNA and mRNA degradation associated"], ["MRPL24", "3.341155", "8.03E-05", "0.006322", "4.229412", "Up", "mitochondrial ribosomal protein L24"], ["ZNF32", "3.328313", "2.03E-06", "0.001623", "5.253128", "Up", "zinc finger protein 32"], ["SAP18", "3.320223", "3.41E-05", "0.004196", "4.47629", "Up", "Sin3A associated protein 18"], ["ZFAND6", "3.310728", "6.93E-05", "0.005946", "4.272145", "Up", "zinc finger AN1-type containing 6"], ["PLCG2", "3.309309", "2.45E-05", "0.003542", "4.570246", "Up", "phospholipase C gamma 2"], ["COA4", "3.297112", "1.12E-06", "0.001179", "5.412446", "Up", "cytochrome c oxidase assembly factor 4 homolog"], ["GTF3A", "3.27873", "0.000407", "0.015016", "3.742231", "Up", "general transcription factor IIIA"], ["SMIM19", "3.278578", "1.23E-05", "0.002829", "4.763305", "Up", "small integral membrane protein 19"], ["DYNLL2", "3.274028", "1.21E-05", "0.002818", "4.76751", "Up", "dynein light chain LC8-type 2"], ["WSB2", "3.272902", "0.000138", "0.008726", "4.070129", "Up", "WD repeat and SOCS box containing 2"], ["MMAB", "3.272634", "2.33E-05", "0.003497", "4.583501", "Up", "metabolism of cobalamin associated B"], ["COX5B", "3.250497", "8.68E-05", "0.006676", "4.206576", "Up", "cytochrome c oxidase subunit 5B"], ["ZNF706", "3.247455", "1.57E-05", "0.003137", "4.695098", "Up", "zinc finger protein 706"], ["SUMO3", "3.244703", "1.07E-05", "0.002689", "4.799887", "Up", "small ubiquitin like modifier 3"], ["ZHX1", "3.244233", "2.98E-05", "0.003952", "4.514129", "Up", "zinc fingers and homeoboxes 1"], ["DCAF6", "3.218358", "7.16E-05", "0.005962", "4.263031", "Up", "DDB1 and CUL4 associated factor 6"], ["NDUFA2", "3.202606", "0.00011", "0.007611", "4.136503", "Up", "NADH:ubiquinoneoxidoreductase subunit A2"], ["COMT", "3.194553", "7.49E-06", "0.002243", "4.899155", "Up", "catechol-O-methyltransferase"], ["USP24", "3.193685", "7.7E-06", "0.002243", "4.891689", "Up", "ubiquitin specific peptidase 24"], ["CLEC3B", "3.192924", "0.000932", "0.023147", "3.480824", "Up", "C-type lectin domain family 3 member B"], ["S100A16", "3.181908", "2.08E-05", "0.00341", "4.615343", "Up", "S100 calcium binding protein A16"], ["PIH1D1", "3.168542", "3.25E-06", "0.001776", "5.126645", "Up", "PIH1 domain containing 1"], ["PEX2", "3.15767", "6.91E-05", "0.005946", "4.273176", "Up", "peroxisomal biogenesis factor 2"], ["BCCIP", "3.156384", "5.08E-06", "0.002061", "5.005401", "Up", "BRCA2 and CDKN1A interacting protein"], ["UCHL1", "3.144433", "0.000603", "0.018411", "3.61943", "Up", "ubiquitin C-terminal hydrolase L1"], ["CCND2", "3.137527", "0.000795", "0.021152", "3.531905", "Up", "cyclin D2"], ["MTDH", "3.134009", "8.58E-05", "0.006622", "4.210031", "Up", "metadherin"], ["ATP6V1D", "3.1239", "0.0001", "0.007145", "4.164159", "Up", "ATPase H+ transporting V1 subunit D"], ["BOD1", "3.11664", "6.28E-06", "0.002168", "4.947675", "Up", "biorientation of chromosomes in cell division 1"], ["MRPL12", "3.114756", "7.59E-05", "0.006143", "4.245866", "Up", "mitochondrial ribosomal protein L12"], ["FOXN3", "3.113552", "0.000114", "0.007817", "4.126313", "Up", "forkhead box N3"], ["POLR3GL", "3.098647", "0.000131", "0.008485", "4.084894", "Up", "RNA polymerase III subunit G like"], ["ALKBH7", "3.098442", "0.000306", "0.012934", "3.830063", "Up", "alkB homolog 7"], ["CDV3", "3.096327", "0.000108", "0.007553", "4.141317", "Up", "CDV3 homolog"], ["ZSCAN16-AS1", "3.095847", "7.34E-07", "0.001025", "5.523754", "Up", "ZSCAN16 antisense RNA 1"], ["S100A13", "3.091633", "5.32E-05", "0.005263", "4.348914", "Up", "S100 calcium binding protein A13"], ["GFPT1", "3.085405", "5.33E-05", "0.005263", "4.348282", "Up", "glutamine--fructose-6-phosphate transaminase 1"], ["CCSER2", "3.079066", "3.98E-05", "0.004552", "4.431771", "Up", "coiled-coil serine rich protein 2"], ["PET100", "3.05957", "0.000152", "0.009259", "4.041067", "Up", "PET100 cytochrome c oxidase chaperone"], ["POLR2J", "3.05183", "0.000358", "0.014077", "3.781554", "Up", "RNA polymerase II subunit J"], ["SF3B6", "3.047526", "0.000179", "0.009929", "3.992753", "Up", "splicing factor 3b subunit 6"], ["TSPAN17", "3.044512", "7.59E-06", "0.002243", "4.895829", "Up", "tetraspanin 17"], ["ECSIT", "3.043372", "1.61E-05", "0.003137", "4.688241", "Up", "ECSIT signaling integrator"], ["TMED4", "3.041199", "2.05E-05", "0.00341", "4.620554", "Up", "transmembrane p24 trafficking protein 4"], ["ROMO1", "3.039801", "0.000339", "0.013645", "3.798806", "Up", "reactive oxygen species modulator 1"], ["SCARNA2", "3.037947", "0.000602", "0.018408", "3.619837", "Up", "small Cajal body-specific RNA 2"], ["RDX", "3.036218", "1.11E-05", "0.002709", "4.790401", "Up", "radixin"], ["ATP6AP2", "3.032219", "0.000537", "0.01724", "3.656205", "Up", "ATPase H+ transporting accessory protein 2"], ["MRPS6", "3.031793", "0.001246", "0.026775", "3.386766", "Up", "mitochondrial ribosomal protein S6"], ["MAD2L1BP", "3.030044", "1.83E-05", "0.003308", "4.651088", "Up", "MAD2L1 binding protein"], ["NNAT", "3.01612", "0.001284", "0.027046", "3.376953", "Up", "neuronatin"], ["SNX8", "3.011952", "2.11E-05", "0.00341", "4.611584", "Up", "sorting nexin 8"], ["ITGAV", "3.006812", "0.000168", "0.009643", "4.011701", "Up", "integrin subunit alpha V"], ["TBCA", "3.005083", "8.86E-05", "0.006772", "4.200708", "Up", "tubulin folding cofactor A"], ["SNAPIN", "3.00314", "6.24E-05", "0.005556", "4.30272", "Up", "SNAP associated protein"], ["TIMM8B", "2.999367", "0.000105", "0.007409", "4.149862", "Up", "translocase of inner mitochondrial membrane 8 homolog B"], ["TADA3", "2.994876", "4.72E-05", "0.005", "4.38301", "Up", "transcriptional adaptor 3"], ["HLA-DPB1", "2.992346", "0.000391", "0.014705", "3.754948", "Up", "major histocompatibility complex, class II, DP beta 1"], ["MGP", "2.989607", "0.000677", "0.019612", "3.583067", "Up", "matrix Gla protein"], ["LAMTOR4", "2.985466", "0.000916", "0.022949", "3.486633", "Up", "late endosomal/lysosomal adaptor, MAPK and MTOR activator 4"], ["BTF3L4", "2.981702", "8.91E-05", "0.006776", "4.199218", "Up", "basic transcription factor 3 like 4"], ["TMX2", "2.979038", "0.000153", "0.009259", "4.040171", "Up", "thioredoxin related transmembrane protein 2"], ["CFL2", "2.977258", "3.16E-05", "0.004025", "4.497382", "Up", "cofilin 2"], ["FAM149A", "2.975549", "6.83E-05", "0.005946", "4.276377", "Up", "family with sequence similarity 149 member A"], ["DTYMK", "2.966972", "0.000289", "0.012546", "3.847791", "Up", "deoxythymidylate kinase"], ["MT1X", "2.96256", "0.000442", "0.015758", "3.716594", "Up", "metallothionein 1X"], ["TSG101", "2.95913", "0.00027", "0.012156", "3.868591", "Up", "tumor susceptibility 101"], ["CPED1", "2.957683", "0.000497", "0.016679", "3.680123", "Up", "cadherin like and PC-esterase domain containing 1"], ["EXOC5", "2.949442", "0.000271", "0.012156", "3.867668", "Up", "exocyst complex component 5"], ["BCYRN1", "2.947993", "1.57E-05", "0.003137", "4.695075", "Up", "brain cytoplasmic RNA 1"], ["ANXA4", "2.947244", "2.18E-05", "0.00341", "4.602361", "Up", "annexin A4"], ["DPP7", "2.946214", "8.92E-05", "0.006776", "4.198665", "Up", "dipeptidyl peptidase 7"], ["SYVN1", "2.942727", "6.24E-05", "0.005556", "4.302587", "Up", "synoviolin 1"], ["NDUFA13", "2.941729", "0.000735", "0.020483", "3.556961", "Up", "NADH:ubiquinoneoxidoreductase subunit A13"], ["C9orf16", "2.940481", "0.000406", "0.014994", "3.743119", "Up", "chromosome 9 open reading frame 16"], ["AMDHD2", "2.940188", "2.53E-05", "0.00358", "4.5612", "Up", "amidohydrolase domain containing 2"], ["KLHL12", "2.939522", "2.85E-05", "0.003867", "4.527463", "Up", "kelch like family member 12"], ["EIF2D", "2.938722", "0.000261", "0.011982", "3.878331", "Up", "eukaryotic translation initiation factor 2D"], ["NDUFB2", "2.935453", "7.75E-05", "0.006191", "4.239855", "Up", "NADH:ubiquinoneoxidoreductase subunit B2"], ["GLRX3", "2.93158", "0.001019", "0.024195", "3.452028", "Up", "glutaredoxin 3"], ["THRSP", "2.927803", "0.00402", "0.04933", "2.990471", "Up", "thyroid hormone responsive"], ["SLC25A11", "2.925157", "0.000548", "0.017445", "3.649379", "Up", "solute carrier family 25 member 11"], ["NDFIP1", "2.924945", "8E-05", "0.006317", "4.230473", "Up", "Nedd4 family interacting protein 1"], ["UBAC1", "2.919604", "0.000143", "0.008978", "4.058832", "Up", "UBA domain containing 1"], ["SETD3", "2.915915", "0.000233", "0.011326", "3.913355", "Up", "SET domain containing 3, actin histidinemethyltransferase"], ["UQCRH", "2.914264", "0.000206", "0.010586", "3.950821", "Up", "ubiquinol-cytochrome c reductase hinge protein"], ["LMBRD1", "2.91352", "0.000153", "0.009259", "4.039227", "Up", "LMBR1 domain containing 1"], ["C1S", "2.913138", "9.66E-05", "0.007077", "4.175345", "Up", "complement C1s"], ["YIPF6", "2.909794", "0.000398", "0.014783", "3.74923", "Up", "Yip1 domain family member 6"], ["COX4I1", "2.908785", "0.000397", "0.014772", "3.749898", "Up", "cytochrome c oxidase subunit 4I1"], ["NBN", "2.90833", "3.91E-06", "0.001884", "5.076794", "Up", "nibrin"], ["TAF7", "2.908109", "0.000345", "0.013777", "3.793503", "Up", "TATA-box binding protein associated factor 7"], ["ANAPC13", "2.904023", "0.002551", "0.038877", "3.147704", "Up", "anaphase promoting complex subunit 13"], ["LYVE1", "2.902347", "0.001203", "0.026382", "3.398322", "Up", "lymphatic vessel endothelial hyaluronan receptor 1"], ["PSMD14", "2.901936", "0.000247", "0.011699", "3.89503", "Up", "proteasome 26S subunit, non-ATPase 14"], ["FAM32A", "2.900891", "0.000535", "0.01724", "3.657406", "Up", "family with sequence similarity 32 member A"], ["UROS", "2.900315", "0.00024", "0.011528", "3.904656", "Up", "uroporphyrinogen III synthase"], ["OST4", "2.898201", "0.002022", "0.034115", "3.226353", "Up", "oligosaccharyltransferase complex subunit 4, non-catalytic"], ["RBBP7", "2.897646", "0.000946", "0.023286", "3.476066", "Up", "RB binding protein 7, chromatin remodeling factor"], ["PRG4", "2.897614", "4.83E-05", "0.005015", "4.376505", "Up", "proteoglycan 4"], ["COX7A2", "2.896609", "0.000818", "0.021597", "3.522952", "Up", "cytochrome c oxidase subunit 7A2"], ["HMGCL", "2.895335", "0.000179", "0.009929", "3.993321", "Up", "3-hydroxy-3-methylglutaryl-CoA lyase"], ["FAM3A", "2.894614", "8.47E-05", "0.006573", "4.213715", "Up", "family with sequence similarity 3 member A"], ["BAK1", "2.892595", "2.69E-05", "0.00371", "4.543614", "Up", "BCL2 antagonist/killer 1"], ["ELOVL6", "2.8913", "7.93E-05", "0.006283", "4.232941", "Up", "ELOVL fatty acid elongase 6"], ["CHCHD2", "2.888344", "0.000193", "0.010317", "3.970255", "Up", "coiled-coil-helix-coiled-coil-helix domain containing 2"], ["PRMT1", "2.886326", "0.000236", "0.01142", "3.909722", "Up", "protein arginine methyltransferase 1"], ["HCFC1R1", "2.88509", "0.000187", "0.010126", "3.979988", "Up", "host cell factor C1 regulator 1"], ["RPS8", "2.88263", "0.000763", "0.02086", "3.545152", "Up", "ribosomal protein S8"], ["JMJD8", "2.880095", "0.000466", "0.016117", "3.700249", "Up", "jumonji domain containing 8"], ["VPS28", "2.868412", "0.00038", "0.014539", "3.763185", "Up", "VPS28 subunit of ESCRT-I"], ["EIF5", "2.867934", "0.00037", "0.014306", "3.772157", "Up", "eukaryotic translation initiation factor 5"], ["ADCY6", "2.866913", "0.000145", "0.009003", "4.055897", "Up", "adenylatecyclase 6"], ["NDUFC2", "2.865496", "0.001531", "0.029477", "3.319099", "Up", "NADH:ubiquinoneoxidoreductase subunit C2"], ["PIGS", "2.862467", "0.002273", "0.036573", "3.186856", "Up", "phosphatidylinositol glycan anchor biosynthesis class S"], ["C1QA", "2.861687", "0.000816", "0.021594", "3.523683", "Up", "complement C1q A chain"], ["FDX1", "2.861442", "0.000394", "0.014749", "3.752127", "Up", "ferredoxin 1"], ["RBX1", "2.85968", "0.000974", "0.023505", "3.466607", "Up", "ring-box 1"], ["TRIB1", "2.8594", "3.17E-05", "0.004025", "4.496868", "Up", "tribblespseudokinase 1"], ["COX6B1", "2.858458", "0.000469", "0.01616", "3.698433", "Up", "cytochrome c oxidase subunit 6B1"], ["MDFI", "2.857869", "0.000277", "0.012363", "3.860877", "Up", "MyoD family inhibitor"], ["RASD1", "2.855883", "0.00079", "0.021079", "3.533796", "Up", "ras related dexamethasone induced 1"], ["SLC40A1", "2.854864", "0.003422", "0.045502", "3.046747", "Up", "solute carrier family 40 member 1"], ["POLR2K", "2.854222", "0.001838", "0.032468", "3.258347", "Up", "RNA polymerase II subunit K"], ["CYB5B", "2.852742", "9.79E-05", "0.00709", "4.171566", "Up", "cytochrome b5 type B"], ["C1orf115", "2.850887", "0.001855", "0.03266", "3.255182", "Up", "chromosome 1 open reading frame 115"], ["EIF3L", "2.846772", "0.000651", "0.019135", "3.595545", "Up", "eukaryotic translation initiation factor 3 subunit L"], ["TMEM219", "2.834679", "0.001098", "0.025262", "3.427919", "Up", "transmembrane protein 219"], ["UQCR11", "2.833847", "0.000542", "0.017312", "3.652923", "Up", "ubiquinol-cytochrome c reductase, complex III subunit XI"], ["AGFG1", "2.83177", "8.83E-05", "0.006771", "4.201612", "Up", "ArfGAP with FG repeats 1"], ["MRPS15", "2.831483", "0.000629", "0.018848", "3.606346", "Up", "mitochondrial ribosomal protein S15"], ["UBE2E1", "2.82743", "0.00062", "0.018805", "3.610605", "Up", "ubiquitin conjugating enzyme E2 E1"], ["NQO1", "2.827398", "3.12E-05", "0.004025", "4.50132", "Up", "NAD(P) H quinone dehydrogenase 1"], ["MORF4L1", "2.825223", "0.000145", "0.009003", "4.055546", "Up", "mortality factor 4 like 1"], ["TM7SF3", "2.823384", "0.0001", "0.007145", "4.165181", "Up", "transmembrane 7 superfamily member 3"], ["RPL35A", "2.822157", "0.000266", "0.012089", "3.87247", "Up", "ribosomal protein L35a"], ["TMEM160", "2.812975", "0.000317", "0.01319", "3.819678", "Up", "transmembrane protein 160"], ["LSM3", "2.809963", "0.000282", "0.012404", "3.854606", "Up", "LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated"], ["PHB", "2.808084", "0.000258", "0.011974", "3.881731", "Up", "prohibitin"], ["MRPS21", "2.805911", "0.000295", "0.012696", "3.841189", "Up", "mitochondrial ribosomal protein S21"], ["TMEM256", "2.804853", "0.003453", "0.045785", "3.04363", "Up", "transmembrane protein 256"], ["MRPS12", "2.804789", "0.000223", "0.011092", "3.925752", "Up", "mitochondrial ribosomal protein S12"], ["PLTP", "2.803513", "0.000258", "0.011965", "3.882486", "Up", "phospholipid transfer protein"], ["TNPO2", "2.794461", "0.000852", "0.022167", "3.509567", "Up", "transportin 2"], ["SKIL", "2.793991", "1.01E-05", "0.002625", "4.815964", "Up", "SKI like proto-oncogene"], ["SEC11A", "2.784473", "0.001174", "0.026198", "3.406284", "Up", "SEC11 homolog A, signal peptidase complex subunit"], ["RPS10", "2.783754", "0.000749", "0.020638", "3.550811", "Up", "ribosomal protein S10"], ["APOD", "2.777795", "0.00264", "0.039615", "3.136112", "Up", "apolipoprotein D"], ["RAB4A", "2.777311", "0.000182", "0.01001", "3.987809", "Up", "RAB4A, member RAS oncogene family"], ["RBMX", "2.774453", "6.17E-05", "0.005556", "4.306198", "Up", "RNA binding motif protein X-linked"], ["ARFIP2", "2.772975", "0.000459", "0.016062", "3.705244", "Up", "ADP ribosylation factor interacting protein 2"], ["CPE", "2.770836", "0.001392", "0.028193", "3.350337", "Up", "carboxypeptidase E"], ["TCTN3", "2.770597", "8.94E-05", "0.006776", "4.198026", "Up", "tectonic family member 3"], ["YWHAH", "2.77017", "0.000866", "0.02234", "3.504563", "Up", "tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta"], ["PLXNA1", "2.769986", "1.66E-05", "0.003137", "4.67951", "Up", "plexin A1"], ["AK1", "2.767903", "0.000273", "0.012251", "3.864784", "Up", "adenylate kinase 1"], ["ORMDL1", "2.767548", "7.27E-05", "0.005968", "4.258602", "Up", "ORMDL sphingolipid biosynthesis regulator 1"], ["SLTM", "2.767084", "0.000706", "0.020072", "3.569499", "Up", "SAFB like transcription modulator"], ["PSMC5", "2.760402", "0.00097", "0.023505", "3.468114", "Up", "proteasome 26S subunit, ATPase 5"], ["UHMK1", "2.759638", "0.000128", "0.008394", "4.09178", "Up", "U2AF homology motif kinase 1"], ["AIFM1", "2.757223", "7.05E-05", "0.005956", "4.267206", "Up", "apoptosis inducing factor mitochondria associated 1"], ["TATDN1", "2.756526", "0.000672", "0.019534", "3.585379", "Up", "TatDDNase domain containing 1"], ["COX6C", "2.753983", "0.000372", "0.014337", "3.769771", "Up", "cytochrome c oxidase subunit 6C"], ["GIPC1", "2.753721", "0.000335", "0.013596", "3.802772", "Up", "GIPC PDZ domain containing family member 1"], ["RPS21", "2.753031", "0.000158", "0.009439", "4.030076", "Up", "ribosomal protein S21"], ["CCDC85B", "2.752819", "0.001517", "0.029361", "3.322182", "Up", "coiled-coil domain containing 85B"], ["UAP1", "2.74977", "0.001158", "0.026017", "3.410666", "Up", "UDP-N-acetylglucosaminepyrophosphorylase 1"], ["POFUT1", "2.742386", "0.000309", "0.012965", "3.827384", "Up", "protein O-fucosyltransferase 1"], ["C3AR1", "2.736533", "2.1E-05", "0.00341", "4.613724", "Up", "complement C3a receptor 1"], ["SRP72", "2.734833", "5.43E-05", "0.005283", "4.342922", "Up", "signal recognition particle 72"], ["ABHD17A", "2.734708", "0.001052", "0.024558", "3.441677", "Up", "abhydrolase domain containing 17A"], ["TOMM7", "2.730177", "0.001231", "0.026634", "3.390625", "Up", "translocase of outer mitochondrial membrane 7"], ["ANP32B", "2.728749", "0.00161", "0.030287", "3.302334", "Up", "acidic nuclear phosphoprotein 32 family member B"], ["TMEM230", "2.728085", "0.001136", "0.025784", "3.416807", "Up", "transmembrane protein 230"], ["NABP2", "2.7271", "0.000369", "0.014306", "3.772639", "Up", "nucleic acid binding protein 2"], ["CDC27", "2.726993", "0.001334", "0.027538", "3.364495", "Up", "cell division cycle 27"], ["FAM20B", "2.723814", "0.000841", "0.021962", "3.513811", "Up", "FAM20B glycosaminoglycan xylosylkinase"], ["ETF1", "2.7213", "0.000538", "0.01724", "3.655315", "Up", "eukaryotic translation termination factor 1"], ["GRHPR", "2.720938", "0.000857", "0.022226", "3.507777", "Up", "glyoxylate and hydroxypyruvatereductase"], ["DERL2", "2.720492", "0.000154", "0.009266", "4.038321", "Up", "derlin 2"], ["RPL36A", "2.720487", "0.000898", "0.02272", "3.492922", "Up", "ribosomal protein L36a"], ["C19orf53", "2.718168", "0.000499", "0.016701", "3.678807", "Up", "chromosome 19 open reading frame 53"], ["GTF2A2", "2.716967", "0.000389", "0.014658", "3.756692", "Up", "general transcription factor IIA subunit 2"], ["GADD45B", "2.716143", "0.000261", "0.011982", "3.878655", "Up", "growth arrest and DNA damage inducible beta"], ["CDIPT", "2.714923", "0.00013", "0.00844", "4.088275", "Up", "CDP-diacylglycerol--inositol 3-phosphatidyltransferase"], ["COX6A1", "2.712855", "0.000535", "0.01724", "3.657442", "Up", "cytochrome c oxidase subunit 6A1"], ["SRSF6", "2.711655", "0.000694", "0.019868", "3.575141", "Up", "serine and arginine rich splicing factor 6"], ["SCARB1", "2.709938", "0.00054", "0.017244", "3.654526", "Up", "scavenger receptor class B member 1"], ["ASAP3", "2.709641", "3.15E-05", "0.004025", "4.498522", "Up", "ArfGAP with SH3 domain, ankyrin repeat and PH domain 3"], ["RNASE1", "2.702048", "0.00234", "0.037096", "3.177048", "Up", "ribonuclease A family member 1, pancreatic"], ["NAPRT", "2.701", "0.000937", "0.023198", "3.479213", "Up", "nicotinatephosphoribosyltransferase"], ["UQCRQ", "2.698312", "0.000786", "0.021056", "3.535632", "Up", "ubiquinol-cytochrome c reductase complex III subunit VII"], ["COX7C", "2.697196", "0.000888", "0.022598", "3.496307", "Up", "cytochrome c oxidase subunit 7C"], ["PSMB1", "2.694976", "0.000391", "0.014705", "3.754384", "Up", "proteasome 20S subunit beta 1"], ["ECH1", "2.694774", "0.002021", "0.034115", "3.226513", "Up", "enoyl-CoA hydratase 1"], ["RPS15A", "2.694313", "0.000873", "0.022405", "3.502067", "Up", "ribosomal protein S15a"], ["ERH", "2.693982", "9.3E-05", "0.006902", "4.186545", "Up", "ERH mRNA splicing and mitosis factor"], ["PSMD3", "2.69342", "0.000362", "0.014114", "3.77823", "Up", "proteasome 26S subunit, non-ATPase 3"], ["MRPS24", "2.689672", "2.97E-06", "0.001776", "5.150884", "Up", "mitochondrial ribosomal protein S24"], ["HSD17B10", "2.689486", "0.000184", "0.010093", "3.984586", "Up", "hydroxysteroid 17-beta dehydrogenase 10"], ["ICMT", "2.68742", "0.001623", "0.030348", "3.299776", "Up", "isoprenylcysteine carboxyl methyltransferase"], ["COX8A", "2.68611", "0.00082", "0.021597", "3.521817", "Up", "cytochrome c oxidase subunit 8A"], ["RPS23", "2.683611", "0.001311", "0.027304", "3.370125", "Up", "ribosomal protein S23"], ["TMEM165", "2.683585", "0.000309", "0.012965", "3.827632", "Up", "transmembrane protein 165"], ["TMEM97", "2.683426", "1.54E-06", "0.001401", "5.327084", "Up", "transmembrane protein 97"], ["COX7A2L", "2.680847", "0.0015", "0.029177", "3.325736", "Up", "cytochrome c oxidase subunit 7A2 like"], ["FAM89B", "2.67751", "0.003528", "0.046326", "3.036153", "Up", "family with sequence similarity 89 member B"], ["SMAD5", "2.676775", "0.0005", "0.016701", "3.678519", "Up", "SMAD family member 5"], ["CCNC", "2.675154", "0.002737", "0.040448", "3.123787", "Up", "cyclin C"], ["CDC42EP2", "2.672348", "0.000165", "0.009593", "4.016925", "Up", "CDC42 effector protein 2"], ["UQCRC1", "2.67139", "3.96E-05", "0.004552", "4.433447", "Up", "ubiquinol-cytochrome c reductase core protein 1"], ["COPS7A", "2.671383", "0.001825", "0.032315", "3.260743", "Up", "COP9 signalosome subunit 7A"], ["CCDC80", "2.670347", "0.003064", "0.042867", "3.085018", "Up", "coiled-coil domain containing 80"], ["PSMB4", "2.669349", "0.000572", "0.017831", "3.636053", "Up", "proteasome 20S subunit beta 4"], ["EIF6", "2.664726", "0.000227", "0.011159", "3.920651", "Up", "eukaryotic translation initiation factor 6"], ["PFDN5", "2.657659", "0.001117", "0.025474", "3.422216", "Up", "prefoldin subunit 5"], ["AFF1", "2.657404", "0.00036", "0.014077", "3.78051", "Up", "AF4/FMR2 family member 1"], ["UQCRFS1", "2.656808", "0.000434", "0.01563", "3.722419", "Up", "ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1"], ["TYROBP", "2.652926", "0.0038", "0.047966", "3.010176", "Up", "TYRO protein tyrosine kinase binding protein"], ["ANAPC5", "2.650988", "0.000463", "0.016091", "3.702541", "Up", "anaphase promoting complex subunit 5"], ["TRMT112", "2.643049", "0.001145", "0.025902", "3.414206", "Up", "tRNAmethyltransferase subunit 11-2"], ["ARF5", "2.641389", "0.002168", "0.035481", "3.202951", "Up", "ADP ribosylation factor 5"], ["POLR1D", "2.64106", "0.000197", "0.010419", "3.963486", "Up", "RNA polymerase I and III subunit D"], ["SNX9", "2.639558", "0.000559", "0.017629", "3.643451", "Up", "sorting nexin 9"], ["NDUFS5", "2.634939", "0.000625", "0.018808", "3.608112", "Up", "NADH:ubiquinoneoxidoreductase subunit S5"], ["KDSR", "2.634609", "0.00089", "0.022598", "3.495893", "Up", "3-ketodihydrosphingosine reductase"], ["KRTCAP2", "2.634197", "0.001854", "0.032651", "3.255495", "Up", "keratinocyte associated protein 2"], ["RPAIN", "2.632929", "0.00075", "0.020638", "3.55055", "Up", "RPA interacting protein"], ["OXCT1", "2.63204", "0.003122", "0.043255", "3.078538", "Up", "3-oxoacid CoA-transferase 1"], ["CAPNS1", "2.631695", "0.000733", "0.020454", "3.557742", "Up", "calpain small subunit 1"], ["SERPINH1", "2.631035", "0.000261", "0.011982", "3.878996", "Up", "serpin family H member 1"], ["TNIP2", "2.630856", "0.000242", "0.011614", "3.901038", "Up", "TNFAIP3 interacting protein 2"], ["RASSF3", "2.62826", "0.004015", "0.049293", "2.990897", "Up", "Ras association domain family member 3"], ["RPL27", "2.626854", "0.001008", "0.024036", "3.455675", "Up", "ribosomal protein L27"], ["ARHGAP12", "2.624075", "0.0007", "0.019959", "3.572316", "Up", "Rho GTPase activating protein 12"], ["PRPF31", "2.623671", "0.000129", "0.008399", "4.090841", "Up", "pre-mRNA processing factor 31"], ["KLB", "2.623223", "0.001365", "0.027884", "3.356946", "Up", "klotho beta"], ["TMX4", "2.618625", "0.00108", "0.024945", "3.433183", "Up", "thioredoxin related transmembrane protein 4"], ["NQO2", "2.617727", "0.002855", "0.041527", "3.109292", "Up", "N-ribosyldihydronicotinamide:quinonereductase 2"], ["NME2", "2.617495", "0.002462", "0.038092", "3.159908", "Up", "NME/NM23 nucleoside diphosphate kinase 2"], ["SLC25A26", "2.616798", "1.27E-05", "0.002881", "4.754142", "Up", "solute carrier family 25 member 26"], ["TOMM5", "2.615408", "0.003222", "0.043977", "3.067588", "Up", "translocase of outer mitochondrial membrane 5"], ["ETFB", "2.614762", "0.001976", "0.033674", "3.234172", "Up", "electron transfer flavoprotein subunit beta"], ["MOAP1", "2.614239", "0.000133", "0.008495", "4.081606", "Up", "modulator of apoptosis 1"], ["NACC1", "2.613132", "1.23E-05", "0.002829", "4.761618", "Up", "nucleus accumbens associated 1"], ["NAGLU", "2.612492", "0.000258", "0.011965", "3.882494", "Up", "N-acetyl-alpha-glucosaminidase"], ["XRCC5", "2.611431", "0.000462", "0.016091", "3.703217", "Up", "X-ray repair cross complementing 5"], ["RPL35", "2.610712", "0.000229", "0.011194", "3.918588", "Up", "ribosomal protein L35"], ["KRCC1", "2.608947", "9.22E-05", "0.006864", "4.189205", "Up", "lysine rich coiled-coil 1"], ["PSMB7", "2.608925", "0.001141", "0.025828", "3.415417", "Up", "proteasome 20S subunit beta 7"], ["RPS29", "2.608914", "0.001176", "0.026198", "3.405623", "Up", "ribosomal protein S29"], ["SNRPD2", "2.604428", "0.000499", "0.016701", "3.679267", "Up", "small nuclear ribonucleoprotein D2 polypeptide"], ["RSL24D1", "2.604123", "0.001206", "0.026399", "3.397372", "Up", "ribosomal L24 domain containing 1"], ["RBM3", "2.602465", "0.000751", "0.020661", "3.549857", "Up", "RNA binding motif protein 3"], ["RPL14", "2.598328", "0.002801", "0.041085", "3.115761", "Up", "ribosomal protein L14"], ["DBI", "2.593769", "0.001225", "0.026608", "3.392185", "Up", "diazepam binding inhibitor, acyl-CoA binding protein"], ["RPL13A", "2.592976", "0.000949", "0.023287", "3.474966", "Up", "ribosomal protein L13a"], ["NAB1", "2.591638", "0.000791", "0.021082", "3.533288", "Up", "NGFI-A binding protein 1"], ["STX10", "2.590276", "0.003718", "0.047358", "3.01781", "Up", "syntaxin 10"], ["SLC35E1", "2.589777", "0.000244", "0.011642", "3.898916", "Up", "solute carrier family 35 member E1"], ["GCHFR", "2.586356", "0.00154", "0.029477", "3.317136", "Up", "GTP cyclohydrolase I feedback regulator"], ["WIPI1", "2.586044", "0.001049", "0.024512", "3.442577", "Up", "WD repeat domain, phosphoinositide interacting 1"], ["TMEM50A", "2.586036", "0.001551", "0.029566", "3.314827", "Up", "transmembrane protein 50A"], ["NELFB", "2.585911", "0.000623", "0.018805", "3.609156", "Up", "negative elongation factor complex member B"], ["MRPL9", "2.582693", "0.000637", "0.019003", "3.60222", "Up", "mitochondrial ribosomal protein L9"], ["DIP2C", "2.577846", "1.51E-06", "0.001401", "5.333124", "Up", "disco interacting protein 2 homolog C"], ["PFDN1", "2.577843", "0.001923", "0.033201", "3.243123", "Up", "prefoldin subunit 1"], ["PCYT2", "2.574996", "0.000343", "0.013741", "3.795229", "Up", "phosphate cytidylyltransferase 2, ethanolamine"], ["RPL29", "2.574629", "0.000911", "0.022881", "3.488378", "Up", "ribosomal protein L29"], ["RPL30", "2.574242", "0.000917", "0.022969", "3.486043", "Up", "ribosomal protein L30"], ["EMC4", "2.572361", "0.00205", "0.034257", "3.221746", "Up", "ER membrane protein complex subunit 4"], ["RPL24", "2.571676", "0.002479", "0.038185", "3.157525", "Up", "ribosomal protein L24"], ["RPS15", "2.570516", "0.001711", "0.031119", "3.282153", "Up", "ribosomal protein S15"], ["SMARCD2", "2.569052", "0.000525", "0.017152", "3.66321", "Up", "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2"], ["C9orf78", "2.568679", "9.48E-05", "0.007003", "4.180864", "Up", "chromosome 9 open reading frame 78"], ["BLOC1S1", "2.568295", "0.001664", "0.03072", "3.291398", "Up", "biogenesis of lysosomal organelles complex 1 subunit 1"], ["ATP9A", "2.567757", "0.000243", "0.011614", "3.900357", "Up", "ATPase phospholipid transporting 9A (putative)"], ["MS4A4A", "2.566919", "5.96E-05", "0.005493", "4.316129", "Up", "membrane spanning 4-domains A4A"], ["AFAP1L1", "2.565706", "0.002187", "0.035677", "3.199902", "Up", "actin filament associated protein 1 like 1"], ["CDKN2B", "2.565157", "0.000599", "0.018321", "3.621709", "Up", "cyclin dependent kinase inhibitor 2B"], ["IFI27", "2.563118", "0.00371", "0.047358", "3.01863", "Up", "interferon alpha inducible protein 27"], ["MED4", "2.555663", "0.001188", "0.026311", "3.402174", "Up", "mediator complex subunit 4"], ["DPH5", "2.553328", "3.71E-05", "0.004462", "4.452413", "Up", "diphthamide biosynthesis 5"], ["WIZ", "2.550083", "0.000617", "0.018752", "3.612543", "Up", "WIZ zinc finger"], ["PEX19", "2.549485", "0.003066", "0.042867", "3.084727", "Up", "peroxisomal biogenesis factor 19"], ["RABGEF1", "2.547097", "0.001793", "0.032062", "3.266518", "Up", "RAB guanine nucleotide exchange factor 1"], ["SLC9A3R1", "2.544376", "0.000906", "0.022852", "3.490141", "Up", "SLC9A3 regulator 1"], ["ANO6", "2.541247", "0.00097", "0.023505", "3.468073", "Up", "anoctamin 6"], ["RPLP0", "2.539879", "0.000147", "0.009101", "4.051259", "Up", "ribosomal protein lateral stalk subunit P0"], ["EZH1", "2.538446", "0.000787", "0.021056", "3.535293", "Up", "enhancer of zeste 1 polycomb repressive complex 2 subunit"], ["PSKH1", "2.53776", "0.001027", "0.024288", "3.449585", "Up", "protein serine kinase H1"], ["RPL34", "2.53733", "0.000646", "0.0191", "3.597964", "Up", "ribosomal protein L34"], ["NDUFS4", "2.53691", "0.000267", "0.012096", "3.871781", "Up", "NADH:ubiquinoneoxidoreductase subunit S4"], ["BANF1", "2.535865", "0.000572", "0.017831", "3.636063", "Up", "barrier to autointegration factor 1"], ["MRPL54", "2.533785", "0.000952", "0.023287", "3.473973", "Up", "mitochondrial ribosomal protein L54"], ["CKS1B", "2.533771", "0.000911", "0.022881", "3.488195", "Up", "CDC28 protein kinase regulatory subunit 1B"], ["TMEM184B", "2.532583", "1.67E-05", "0.003137", "4.676649", "Up", "transmembrane protein 184B"], ["PSMD10", "2.530765", "0.00053", "0.01724", "3.660242", "Up", "proteasome 26S subunit, non-ATPase 10"], ["RPS5", "2.529965", "0.000597", "0.018297", "3.622831", "Up", "ribosomal protein S5"], ["CUL4A", "2.529656", "0.001663", "0.03072", "3.291653", "Up", "cullin 4A"], ["MFAP5", "2.527961", "0.000821", "0.021597", "3.521542", "Up", "microfibril associated protein 5"], ["SNTA1", "2.526907", "0.000372", "0.014337", "3.770146", "Up", "syntrophin alpha 1"], ["RPS20", "2.52651", "0.002839", "0.041407", "3.111181", "Up", "ribosomal protein S20"], ["RSL1D1", "2.524784", "0.000405", "0.014978", "3.743879", "Up", "ribosomal L1 domain containing 1"], ["RPS24", "2.523665", "0.002187", "0.035677", "3.200019", "Up", "ribosomal protein S24"], ["ICAM2", "2.52328", "0.00175", "0.031637", "3.274701", "Up", "intercellular adhesion molecule 2"], ["B4GALT2", "2.522208", "0.001703", "0.031013", "3.283844", "Up", "beta-1,4-galactosyltransferase 2"], ["NUDT16", "2.521704", "0.001545", "0.029527", "3.315981", "Up", "nudix hydrolase 16"], ["PFN2", "2.519815", "0.001062", "0.024764", "3.438594", "Up", "profilin 2"], ["RAB10", "2.519714", "0.003057", "0.04281", "3.085745", "Up", "RAB10, member RAS oncogene family"], ["SF3B5", "2.519177", "0.003604", "0.046771", "3.028686", "Up", "splicing factor 3b subunit 5"], ["TCEAL8", "2.516685", "0.003486", "0.04603", "3.040293", "Up", "transcription elongation factor A like 8"], ["CD99L2", "2.51621", "0.001957", "0.03358", "3.23728", "Up", "CD99 molecule like 2"], ["SUCLG1", "2.514671", "0.001177", "0.026198", "3.405243", "Up", "succinate-CoA ligase alpha subunit"], ["LAMA2", "2.514019", "0.000535", "0.01724", "3.657403", "Up", "laminin subunit alpha 2"], ["EIF3E", "2.511931", "0.000766", "0.020887", "3.543592", "Up", "eukaryotic translation initiation factor 3 subunit E"], ["BCL7B", "2.511858", "0.000361", "0.014084", "3.779795", "Up", "BAF chromatin remodeling complex subunit BCL7B"], ["SEPHS2", "2.511732", "0.000202", "0.010561", "3.955986", "Up", "selenophosphatesynthetase 2"], ["LOXL2", "2.511606", "0.000883", "0.022598", "3.498175", "Up", "lysyl oxidase like 2"], ["PMM1", "2.511461", "0.00143", "0.02855", "3.341501", "Up", "phosphomannomutase 1"], ["DNPH1", "2.50873", "0.002905", "0.041811", "3.103319", "Up", "2'-deoxynucleoside 5'-phosphate N-hydrolase 1"], ["RARRES2", "2.504265", "0.003791", "0.047902", "3.011021", "Up", "retinoic acid receptor responder 2"], ["COA3", "2.50271", "0.001102", "0.025262", "3.426827", "Up", "cytochrome c oxidase assembly factor 3"], ["MRPS34", "2.502001", "0.000919", "0.022981", "3.485574", "Up", "mitochondrial ribosomal protein S34"], ["SLC30A7", "-3.56691", "4.14E-07", "0.00095", "-5.67461", "Down", "solute carrier family 30 member 7"], ["VTI1A", "-3.31043", "1.05E-07", "0.000478", "-6.03155", "Down", "vesicle transport through interaction with t-SNAREs 1A"], ["ERG", "-3.30133", "2.32E-05", "0.003497", "-4.58491", "Down", "ETS transcription factor ERG"], ["ZFYVE1", "-3.18784", "1.03E-06", "0.001179", "-5.43378", "Down", "zinc finger FYVE-type containing 1"], ["AAK1", "-3.1737", "2.73E-06", "0.001776", "-5.17359", "Down", "AP2 associated kinase 1"], ["URB2", "-3.16731", "8.19E-07", "0.00108", "-5.49481", "Down", "URB2 ribosome biogenesis homolog"], ["IGIP", "-3.12032", "5.55E-05", "0.005363", "-4.33643", "Down", "IgA inducing protein"], ["ITIH4", "-2.9168", "3.51E-06", "0.001852", "-5.10571", "Down", "inter-alpha-trypsin inhibitor heavy chain 4"], ["LOC646214", "-2.85088", "0.000346", "0.013805", "-3.79234", "Down", "p21 protein (Cdc42/Rac)-activated kinase 2 pseudogene"], ["ZNF486", "-2.84793", "1.14E-05", "0.002738", "-4.78297", "Down", "zinc finger protein 486"], ["TET3", "-2.81596", "1.11E-06", "0.001179", "-5.41343", "Down", "tetmethylcytosinedioxygenase 3"], ["HECW2", "-2.8127", "3.17E-05", "0.004025", "-4.49639", "Down", "HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2"], ["LPXN", "-2.80145", "3.07E-06", "0.001776", "-5.14246", "Down", "leupaxin"], ["GOSR1", "-2.79883", "1.73E-05", "0.003174", "-4.66687", "Down", "golgi SNAP receptor complex member 1"], ["PDPR", "-2.78381", "4.99E-05", "0.005058", "-4.36736", "Down", "pyruvate dehydrogenase phosphatase regulatory subunit"], ["TNKS", "-2.74917", "9.17E-05", "0.006848", "-4.19071", "Down", "tankyrase"], ["ECD", "-2.73445", "0.000348", "0.013823", "-3.79107", "Down", "ecdysoneless cell cycle regulator"], ["ABCC5", "-2.72387", "1.16E-05", "0.002752", "-4.77862", "Down", "ATP binding cassette subfamily C member 5"], ["STXBP5", "-2.71632", "0.000176", "0.009858", "-3.99744", "Down", "syntaxin binding protein 5"], ["WDR19", "-2.69898", "0.000615", "0.018721", "-3.61344", "Down", "WD repeat domain 19"], ["SARM1", "-2.69717", "1.19E-09", "1.98E-05", "-7.17529", "Down", "sterile alpha and TIR motif containing 1"], ["TRAF5", "-2.66677", "0.000107", "0.007492", "-4.14579", "Down", "TNF receptor associated factor 5"], ["SYNE2", "-2.663", "5.87E-05", "0.005493", "-4.32047", "Down", "spectrin repeat containing nuclear envelope protein 2"], ["CFP", "-2.6567", "0.000675", "0.019585", "-3.58386", "Down", "complement factor properdin"], ["ANKRD20A9P", "-2.64322", "0.001714", "0.031148", "-3.28161", "Down", "ankyrin repeat domain 20 family member A9, pseudogene"], ["FAT4", "-2.63099", "0.000494", "0.016631", "-3.68187", "Down", "FAT atypical cadherin 4"], ["HIVEP1", "-2.62581", "8.18E-05", "0.006387", "-4.22422", "Down", "HIVEP zinc finger 1"], ["SNAP47", "-2.61436", "0.000216", "0.010911", "-3.93599", "Down", "synaptosome associated protein 47"], ["DMRT2", "-2.61357", "0.000161", "0.009544", "-4.02349", "Down", "doublesex and mab-3 related transcription factor 2"], ["GEMIN5", "-2.60553", "3.51E-05", "0.004269", "-4.46757", "Down", "gem nuclear organelle associated protein 5"], ["LOC643406", "-2.59315", "0.000435", "0.015643", "-3.72139", "Down", "uncharacterized LOC643406"], ["OBSCN", "-2.58615", "0.000237", "0.011453", "-3.90744", "Down", "obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF"], ["ATP13A1", "-2.57902", "6.26E-05", "0.005556", "-4.3019", "Down", "ATPase 13A1"], ["LOC105372795", "-2.56184", "2.46E-06", "0.001776", "-5.2015", "Down", "uncharacterized LOC105372795"], ["PXMP4", "-2.55289", "0.000508", "0.016883", "-3.67316", "Down", "peroxisomal membrane protein 4"], ["FAS", "-2.51889", "0.000221", "0.011049", "-3.92874", "Down", "Fas cell surface death receptor"], ["MGAM", "-2.5179", "0.001226", "0.026608", "-3.39213", "Down", "maltase-glucoamylase"], ["ERCC6L2", "-2.49433", "0.000462", "0.016091", "-3.70269", "Down", "ERCC excision repair 6 like 2"], ["MFAP3", "-2.48427", "9.78E-05", "0.00709", "-4.17183", "Down", "microfibril associated protein 3"], ["TPD52", "-2.48206", "0.001319", "0.027418", "-3.36809", "Down", "tumor protein D52"], ["PPP1R3B", "-2.47428", "0.001536", "0.029477", "-3.31797", "Down", "protein phosphatase 1 regulatory subunit 3B"], ["PTGDR", "-2.46695", "4.33E-07", "0.00095", "-5.66312", "Down", "prostaglandin D2 receptor"], ["AHSP", "-2.45099", "4.99E-06", "0.002061", "-5.01026", "Down", "alpha hemoglobin stabilizing protein"], ["ODF2", "-2.44884", "0.000531", "0.01724", "-3.65942", "Down", "outer dense fiber of sperm tails 2"], ["MAU2", "-2.44852", "0.002675", "0.039958", "-3.1315", "Down", "MAU2 sister chromatid cohesion factor"], ["PTOV1-AS2", "-2.44504", "8.73E-06", "0.002428", "-4.85721", "Down", "PTOV1 antisense RNA 2"], ["SLCO4A1", "-2.42489", "9.04E-05", "0.006791", "-4.19486", "Down", "solute carrier organic anion transporter family member 4A1"], ["RAP1GAP2", "-2.41727", "0.000428", "0.015491", "-3.72656", "Down", "RAP1 GTPase activating protein 2"], ["GUSBP11", "-2.41706", "1.72E-05", "0.003165", "-4.66966", "Down", "GUSB pseudogene 11"], ["CHST14", "-2.40289", "6.43E-06", "0.002175", "-4.94093", "Down", "carbohydrate sulfotransferase 14"], ["SMYD4", "-2.3923", "0.000889", "0.022598", "-3.49612", "Down", "SET and MYND domain containing 4"], ["CACNA2D4", "-2.38689", "1.62E-05", "0.003137", "-4.6856", "Down", "calcium voltage-gated channel auxiliary subunit alpha2delta 4"], ["ERO1A", "-2.3862", "0.001273", "0.026966", "-3.37975", "Down", "endoplasmic reticulum oxidoreductase 1 alpha"], ["ATRNL1", "-2.37103", "1.84E-05", "0.003308", "-4.64955", "Down", "attractin like 1"], ["ATL1", "-2.37076", "0.000548", "0.017445", "-3.64947", "Down", "atlastinGTPase 1"], ["EPHB4", "-2.36058", "0.000451", "0.015882", "-3.71047", "Down", "EPH receptor B4"], ["AOC4P", "-2.35367", "3.9E-06", "0.001884", "-5.07705", "Down", "amine oxidase copper containing 4, pseudogene"], ["SLC25A13", "-2.34818", "0.000134", "0.008515", "-4.07881", "Down", "solute carrier family 25 member 13"], ["FAM13B", "-2.34187", "0.003334", "0.044854", "-3.05577", "Down", "family with sequence similarity 13 member B"], ["TRAK1", "-2.33457", "0.000883", "0.022598", "-3.49834", "Down", "trafficking kinesin protein 1"], ["ABI3", "-2.3343", "0.000274", "0.012278", "-3.8636", "Down", "ABI family member 3"], ["SEMA6B", "-2.33392", "4.57E-05", "0.004952", "-4.39248", "Down", "semaphorin 6B"], ["METTL21A", "-2.33362", "0.002789", "0.040954", "-3.11724", "Down", "methyltransferase like 21A"], ["ZNF778", "-2.33087", "3.93E-06", "0.001884", "-5.07521", "Down", "zinc finger protein 778"], ["PDE4B", "-2.32078", "0.000786", "0.021056", "-3.5357", "Down", "phosphodiesterase 4B"], ["NDC1", "-2.31958", "0.000208", "0.010631", "-3.94732", "Down", "NDC1 transmembranenucleoporin"], ["SLC9A7", "-2.31311", "0.001151", "0.025956", "-3.41266", "Down", "solute carrier family 9 member A7"], ["NLGN2", "-2.31264", "7.89E-05", "0.006274", "-4.23441", "Down", "neuroligin 2"], ["IKZF4", "-2.30922", "0.000113", "0.007788", "-4.12818", "Down", "IKAROS family zinc finger 4"], ["MAST3", "-2.3067", "0.001042", "0.024428", "-3.44474", "Down", "microtubule associated serine/threonine kinase 3"], ["SAP25", "-2.30632", "0.000324", "0.013394", "-3.81298", "Down", "Sin3A associated protein 25"], ["ZNF213-AS1", "-2.30592", "3.03E-06", "0.001776", "-5.14592", "Down", "ZNF213 antisense RNA 1 (head to head)"], ["ADAMTS13", "-2.30408", "2.03E-06", "0.001623", "-5.25359", "Down", "ADAM metallopeptidase with thrombospondin type 1 motif 13"], ["CDH19", "-2.30007", "9.85E-06", "0.002623", "-4.82394", "Down", "cadherin 19"], ["DOCK9", "-2.28015", "0.002517", "0.038469", "-3.15239", "Down", "dedicator of cytokinesis 9"], ["PARP10", "-2.27632", "0.003654", "0.047012", "-3.0239", "Down", "poly (ADP-ribose) polymerase family member 10"], ["LOC648987", "-2.27592", "2.87E-06", "0.001776", "-5.16", "Down", "uncharacterized LOC648987"], ["GIMAP8", "-2.27461", "0.001512", "0.029333", "-3.32309", "Down", "GTPase, IMAP family member 8"], ["COL8A1", "-2.27216", "0.00307", "0.042867", "-3.08427", "Down", "collagen type VIII alpha 1 chain"], ["MYO7A", "-2.26997", "5.89E-06", "0.002131", "-4.96524", "Down", "myosin VIIA"], ["SLC25A35", "-2.26394", "4.18E-05", "0.004645", "-4.41821", "Down", "solute carrier family 25 member 35"], ["ESR1", "-2.25478", "0.000772", "0.020954", "-3.54124", "Down", "estrogen receptor 1"], ["FAM71F2", "-2.25074", "5.55E-06", "0.002118", "-4.98153", "Down", "family with sequence similarity 71 member F2"], ["ZNF493", "-2.24829", "0.000671", "0.019525", "-3.58587", "Down", "zinc finger protein 493"], ["CEP135", "-2.24319", "1.89E-05", "0.003342", "-4.64292", "Down", "centrosomal protein 135"], ["CEP126", "-2.24051", "0.001032", "0.024341", "-3.44789", "Down", "centrosomal protein 126"], ["ASTN2", "-2.23592", "0.001156", "0.026012", "-3.41115", "Down", "astrotactin 2"], ["IPP", "-2.22612", "0.000101", "0.007163", "-4.16214", "Down", "intracisternal A particle-promoted polypeptide"], ["TANGO6", "-2.2248", "0.000418", "0.015262", "-3.73417", "Down", "transport and golgi organization 6 homolog"], ["ZXDC", "-2.22107", "0.001926", "0.033211", "-3.24265", "Down", "ZXD family zinc finger C"], ["TMCO4", "-2.21386", "0.000912", "0.022891", "-3.48775", "Down", "transmembrane and coiled-coil domains 4"], ["WSCD1", "-2.20938", "1.36E-05", "0.003004", "-4.73545", "Down", "WSC domain containing 1"], ["PLXNB3", "-2.20331", "0.000194", "0.010359", "-3.96765", "Down", "plexin B3"], ["SPAST", "-2.19723", "0.003713", "0.047358", "-3.01835", "Down", "spastin"], ["LRSAM1", "-2.19647", "0.00028", "0.012403", "-3.85725", "Down", "leucine rich repeat and sterile alpha motif containing 1"], ["BANP", "-2.19578", "0.002678", "0.039958", "-3.13116", "Down", "BTG3 associated nuclear protein"], ["SCAF4", "-2.1951", "0.001471", "0.028954", "-3.33217", "Down", "SR-related CTD associated factor 4"], ["SDCCAG8", "-2.19392", "0.001272", "0.026966", "-3.38007", "Down", "serologically defined colon cancer antigen 8"], ["KCNQ1OT1", "-2.19178", "0.002417", "0.037819", "-3.16609", "Down", "KCNQ1 opposite strand/antisense transcript 1"], ["CD82", "-2.18167", "0.001254", "0.026814", "-3.38461", "Down", "CD82 molecule"], ["KIAA0754", "-2.17697", "0.000994", "0.023761", "-3.46018", "Down", "KIAA0754"], ["PTPRN2", "-2.17646", "0.00099", "0.023704", "-3.46132", "Down", "protein tyrosine phosphatase receptor type N2"], ["MYLK-AS1", "-2.16901", "0.000153", "0.009259", "-4.03959", "Down", "MYLK antisense RNA 1"], ["PLXDC1", "-2.16377", "0.001307", "0.027262", "-3.37099", "Down", "plexin domain containing 1"], ["TDRD5", "-2.15738", "4.87E-05", "0.005015", "-4.37413", "Down", "tudor domain containing 5"], ["LCAT", "-2.15173", "0.000278", "0.012383", "-3.85932", "Down", "lecithin-cholesterol acyltransferase"], ["PRDM11", "-2.15109", "6.78E-07", "0.001025", "-5.54474", "Down", "PR/SET domain 11"], ["RASIP1", "-2.14799", "0.000745", "0.02059", "-3.55262", "Down", "Ras interacting protein 1"], ["SPN", "-2.14456", "0.002682", "0.039958", "-3.13065", "Down", "sialophorin"], ["SHISA9", "-2.14372", "0.00386", "0.048313", "-3.0047", "Down", "shisa family member 9"], ["ANKRD6", "-2.14267", "0.003628", "0.046875", "-3.0264", "Down", "ankyrin repeat domain 6"], ["MAK", "-2.13779", "2.41E-05", "0.003515", "-4.57405", "Down", "male germ cell associated kinase"], ["EPHA4", "-2.13565", "0.000848", "0.022087", "-3.51135", "Down", "EPH receptor A4"], ["UBR5-AS1", "-2.12673", "2.81E-05", "0.003842", "-4.53078", "Down", "UBR5 antisense RNA 1"], ["CTC1", "-2.12661", "0.003144", "0.043426", "-3.07609", "Down", "CST telomere replication complex component 1"], ["NPHP4", "-2.12045", "7.65E-05", "0.006152", "-4.24347", "Down", "nephrocystin 4"], ["RFX3", "-2.11961", "0.000286", "0.012464", "-3.85121", "Down", "regulatory factor X3"], ["PLD1", "-2.10857", "0.000478", "0.016343", "-3.69227", "Down", "phospholipase D1"], ["ZNF474", "-2.10767", "3.19E-06", "0.001776", "-5.13193", "Down", "zinc finger protein 474"], ["LCK", "-2.10338", "0.000224", "0.011092", "-3.92537", "Down", "LCK proto-oncogene, Src family tyrosine kinase"], ["ZCCHC4", "-2.10229", "0.002042", "0.034193", "-3.22302", "Down", "zinc finger CCHC-type containing 4"], ["PRPS2", "-2.09872", "0.001319", "0.027418", "-3.3681", "Down", "phosphoribosyl pyrophosphate synthetase 2"], ["TAF4B", "-2.09126", "0.000171", "0.009664", "-4.00627", "Down", "TATA-box binding protein associated factor 4b"], ["CDC42BPA", "-2.08947", "0.001389", "0.028155", "-3.3511", "Down", "CDC42 binding protein kinase alpha"], ["LINC01230", "-2.0891", "0.00033", "0.013567", "-3.80731", "Down", "long intergenic non-protein coding RNA 1230"], ["CPAMD8", "-2.08813", "0.000302", "0.012829", "-3.83385", "Down", "C3 and PZP like alpha-2-macroglobulin domain containing 8"], ["PARP9", "-2.08698", "0.001921", "0.033188", "-3.24363", "Down", "poly (ADP-ribose) polymerase family member 9"], ["ZFYVE27", "-2.08654", "0.000479", "0.016343", "-3.69181", "Down", "zinc finger FYVE-type containing 27"], ["IWS1", "-2.08516", "0.002881", "0.041667", "-3.10619", "Down", "interacts with SUPT6H, CTD assembly factor 1"], ["MMRN1", "-2.08143", "0.000451", "0.015882", "-3.7104", "Down", "multimerin 1"], ["ST20-AS1", "-2.07521", "6.76E-06", "0.00223", "-4.92723", "Down", "ST20 antisense RNA 1"], ["CALCR", "-2.07464", "5.03E-05", "0.005083", "-4.36486", "Down", "calcitonin receptor"], ["KAT7", "-2.06821", "0.003226", "0.043983", "-3.06718", "Down", "lysine acetyltransferase 7"], ["ARHGAP22", "-2.05873", "4.78E-06", "0.002061", "-5.02181", "Down", "Rho GTPase activating protein 22"], ["TMEM199", "-2.05777", "0.002257", "0.036467", "-3.18933", "Down", "transmembrane protein 199"], ["NTN1", "-2.05766", "0.000168", "0.009643", "-4.01109", "Down", "netrin 1"], ["LAMA5", "-2.05607", "0.002141", "0.035221", "-3.20706", "Down", "laminin subunit alpha 5"], ["SPNS3", "-2.05195", "2.18E-05", "0.00341", "-4.60239", "Down", "sphingolipid transporter 3 (putative)"], ["NEDD4L", "-2.04969", "0.001542", "0.029477", "-3.31678", "Down", "NEDD4 like E3 ubiquitin protein ligase"], ["BSN", "-2.04855", "2.9E-05", "0.003871", "-4.52186", "Down", "bassoon presynaptic cytomatrix protein"], ["TMED8", "-2.04722", "7.63E-06", "0.002243", "-4.89431", "Down", "transmembrane p24 trafficking protein family member 8"], ["STRBP", "-2.04479", "0.003521", "0.046281", "-3.03684", "Down", "spermatid perinuclear RNA binding protein"], ["ATP13A4", "-2.04282", "5.91E-05", "0.005493", "-4.3185", "Down", "ATPase 13A4"], ["KLC2", "-2.03984", "0.001017", "0.024181", "-3.45276", "Down", "kinesin light chain 2"], ["RLF", "-2.03665", "0.001889", "0.032833", "-3.2492", "Down", "rearranged L-myc fusion"], ["TTF1", "-2.03264", "0.002608", "0.03937", "-3.14019", "Down", "transcription termination factor 1"], ["TMEM79", "-2.0311", "5.41E-05", "0.005279", "-4.34419", "Down", "transmembrane protein 79"], ["ZCCHC2", "-2.02905", "0.002297", "0.036735", "-3.18334", "Down", "zinc finger CCHC-type containing 2"], ["ANKRD13B", "-2.02722", "0.001008", "0.024036", "-3.45558", "Down", "ankyrin repeat domain 13B"], ["IFT122", "-2.02015", "0.002868", "0.041571", "-3.10772", "Down", "intraflagellar transport 122"], ["MAP 3K14", "-2.01534", "0.003484", "0.046026", "-3.0405", "Down", "mitogen-activated protein kinase kinasekinase 14"], ["SPATA6L", "-2.01191", "3.29E-05", "0.004116", "-4.48594", "Down", "spermatogenesis associated 6 like"], ["SCOC-AS1", "-2.01128", "0.00093", "0.023147", "-3.48171", "Down", "SCOC antisense RNA 1"], ["LMO7", "-2.00579", "0.000573", "0.017831", "-3.63573", "Down", "LIM domain 7"], ["MEX3B", "-1.99674", "2.01E-05", "0.00341", "-4.6259", "Down", "mex-3 RNA binding family member B"], ["IQCK", "-1.99382", "0.00025", "0.011782", "-3.89149", "Down", "IQ motif containing K"], ["GPATCH1", "-1.9934", "0.000126", "0.008296", "-4.09746", "Down", "G-patch domain containing 1"], ["HPS4", "-1.98942", "0.002434", "0.037832", "-3.16378", "Down", "HPS4 biogenesis of lysosomal organelles complex 3 subunit 2"], ["FGFR3", "-1.98496", "1.56E-05", "0.003137", "-4.6955", "Down", "fibroblast growth factor receptor 3"], ["GABRA4", "-1.98306", "0.000116", "0.007921", "-4.1216", "Down", "gamma-aminobutyric acid type A receptor alpha4 subunit"], ["TMEM116", "-1.97917", "0.000648", "0.0191", "-3.5967", "Down", "transmembrane protein 116"], ["CTU1", "-1.97326", "4.92E-06", "0.002061", "-5.01408", "Down", "cytosolic thiouridylase subunit 1"], ["PPIEL", "-1.9687", "0.002144", "0.035221", "-3.20669", "Down", "peptidylprolylisomerase E like pseudogene"], ["FUT11", "-1.965", "0.000688", "0.019806", "-3.57787", "Down", "fucosyltransferase 11"], ["TOP3A", "-1.96066", "0.00295", "0.04205", "-3.098", "Down", "DNA topoisomerase III alpha"], ["C22orf34", "-1.95954", "0.000251", "0.011782", "-3.89083", "Down", "chromosome 22 open reading frame 34"], ["ASIC3", "-1.95737", "4.65E-05", "0.005", "-4.38764", "Down", "acid sensing ion channel subunit 3"], ["SNPH", "-1.95235", "0.002152", "0.035284", "-3.20546", "Down", "syntaphilin"], ["ZNF547", "-1.95217", "0.000487", "0.016474", "-3.68677", "Down", "zinc finger protein 547"], ["FEZ1", "-1.94468", "0.000873", "0.022405", "-3.50206", "Down", "fasciculation and elongation protein zeta 1"], ["ENTPD5", "-1.94339", "0.000264", "0.012058", "-3.87463", "Down", "ectonucleoside triphosphate diphosphohydrolase 5 (inactive)"], ["LOC729683", "-1.94235", "2.6E-05", "0.00365", "-4.55269", "Down", "uncharacterized LOC729683"], ["S1PR5", "-1.94099", "8.19E-05", "0.006387", "-4.22381", "Down", "sphingosine-1-phosphate receptor 5"], ["ZNF300P1", "-1.93492", "0.000171", "0.009664", "-4.00596", "Down", "zinc finger protein 300 pseudogene 1"], ["UNC13C", "-1.93485", "0.000438", "0.015649", "-3.7196", "Down", "unc-13 homolog C"], ["LOC101928370", "-1.93447", "2.11E-06", "0.001634", "-5.24334", "Down", "uncharacterized LOC101928370"], ["ZNF555", "-1.92846", "0.000376", "0.014411", "-3.76684", "Down", "zinc finger protein 555"], ["GADD45G", "-1.92497", "0.001994", "0.03385", "-3.23101", "Down", "growth arrest and DNA damage inducible gamma"], ["KCNC1", "-1.92247", "2.19E-05", "0.00341", "-4.60096", "Down", "potassium voltage-gated channel subfamily C member 1"], ["CARD14", "-1.91822", "6.28E-06", "0.002168", "-4.9474", "Down", "caspase recruitment domain family member 14"], ["STK36", "-1.91359", "0.003625", "0.046875", "-3.0267", "Down", "serine/threonine kinase 36"], ["TRIB3", "-1.91164", "0.00031", "0.012992", "-3.82577", "Down", "tribblespseudokinase 3"], ["ZNF124", "-1.9092", "0.000271", "0.012156", "-3.86767", "Down", "zinc finger protein 124"], ["MPZL3", "-1.90884", "0.000298", "0.012703", "-3.83854", "Down", "myelin protein zero like 3"], ["TOR4A", "-1.90324", "0.00029", "0.012546", "-3.84663", "Down", "torsin family 4 member A"], ["MIR3916", "-1.90072", "4.48E-06", "0.002039", "-5.03938", "Down", "microRNA 3916"], ["ZNF334", "-1.89919", "6.18E-06", "0.002168", "-4.9521", "Down", "zinc finger protein 334"], ["TTLL3", "-1.89535", "0.000105", "0.007409", "-4.1499", "Down", "tubulin tyrosine ligase like 3"], ["ZKSCAN3", "-1.89411", "0.001595", "0.030071", "-3.30542", "Down", "zinc finger with KRAB and SCAN domains 3"], ["PAPLN", "-1.88842", "0.001527", "0.029477", "-3.31986", "Down", "papilin, proteoglycan like sulfated glycoprotein"], ["KNTC1", "-1.88703", "0.000207", "0.01061", "-3.94852", "Down", "kinetochore associated 1"], ["SLC1A7", "-1.88316", "0.000163", "0.009559", "-4.01961", "Down", "solute carrier family 1 member 7"], ["BCL9", "-1.87682", "0.00158", "0.029935", "-3.30857", "Down", "BCL9 transcription coactivator"], ["ZNF496", "-1.87502", "0.00041", "0.015068", "-3.74029", "Down", "zinc finger protein 496"], ["LNX2", "-1.87272", "0.003479", "0.045998", "-3.04098", "Down", "ligand of numb-protein X 2"], ["DNAJC18", "-1.8714", "0.000203", "0.010561", "-3.95515", "Down", "DnaJ heat shock protein family (Hsp40) member C18"], ["ZNF114", "-1.86888", "6.34E-05", "0.0056", "-4.29807", "Down", "zinc finger protein 114"], ["VWA3B", "-1.86543", "3.01E-05", "0.003964", "-4.51187", "Down", "von Willebrand factor A domain containing 3B"], ["ARNTL2", "-1.86522", "0.002029", "0.034127", "-3.22522", "Down", "aryl hydrocarbon receptor nuclear translocator like 2"], ["NGFR", "-1.85434", "0.000295", "0.012696", "-3.84106", "Down", "nerve growth factor receptor"], ["CLEC1A", "-1.85306", "0.001166", "0.026095", "-3.40829", "Down", "C-type lectin domain family 1 member A"], ["ZNF687", "-1.85305", "0.003658", "0.047012", "-3.02347", "Down", "zinc finger protein 687"], ["ZNF69", "-1.85271", "2.47E-05", "0.003545", "-4.56704", "Down", "zinc finger protein 69"], ["MTF1", "-1.85038", "0.000974", "0.023505", "-3.46684", "Down", "metal regulatory transcription factor 1"], ["ZNF154", "-1.84509", "0.00012", "0.008053", "-4.11197", "Down", "zinc finger protein 154"], ["SLAMF6", "-1.84139", "0.00019", "0.010241", "-3.9745", "Down", "SLAM family member 6"], ["TMEM255B", "-1.8379", "5.28E-05", "0.005263", "-4.35097", "Down", "transmembrane protein 255B"], ["HLA-H", "-1.83482", "0.002773", "0.040755", "-3.11929", "Down", "major histocompatibility complex, class I, H (pseudogene)"], ["KBTBD7", "-1.82918", "0.000254", "0.011836", "-3.88686", "Down", "kelch repeat and BTB domain containing 7"], ["CDC20B", "-1.82896", "6.91E-05", "0.005946", "-4.2731", "Down", "cell division cycle 20B"], ["SLC44A5", "-1.82893", "1.48E-05", "0.003137", "-4.71193", "Down", "solute carrier family 44 member 5"], ["MEN1", "-1.8227", "0.001593", "0.030071", "-3.30582", "Down", "menin 1"], ["SCNN1D", "-1.82156", "0.003912", "0.048656", "-3.00003", "Down", "sodium channel epithelial 1 delta subunit"], ["PFAS", "-1.81549", "0.002896", "0.041776", "-3.10436", "Down", "phosphoribosylformylglycinamidine synthase"], ["EVA1C", "-1.81455", "0.001419", "0.028438", "-3.34407", "Down", "eva-1 homolog C"], ["TIAM2", "-1.80764", "6.94E-05", "0.005946", "-4.27171", "Down", "TIAM Rac1 associated GEF 2"], ["HLA-F-AS1", "-1.80482", "0.002916", "0.041853", "-3.10204", "Down", "HLA-F antisense RNA 1"], ["TRAPPC9", "-1.80093", "0.00091", "0.022881", "-3.48851", "Down", "trafficking protein particle complex 9"], ["APCDD1L", "-1.80071", "1.64E-05", "0.003137", "-4.68254", "Down", "APC down-regulated 1 like"], ["CYTIP", "-1.79864", "0.001215", "0.026482", "-3.39492", "Down", "cytohesin 1 interacting protein"], ["NUTM1", "-1.79716", "2.14E-05", "0.00341", "-4.60821", "Down", "NUT midline carcinoma family member 1"], ["ARHGAP39", "-1.79263", "0.000319", "0.013245", "-3.81744", "Down", "Rho GTPase activating protein 39"], ["SPTB", "-1.79073", "0.001482", "0.028982", "-3.32988", "Down", "spectrin beta, erythrocytic"], ["ZNF469", "-1.78919", "7.59E-05", "0.006143", "-4.24571", "Down", "zinc finger protein 469"], ["AZIN1-AS1", "-1.78541", "1.92E-05", "0.003347", "-4.63776", "Down", "AZIN1 antisense RNA 1"], ["BCL2L11", "-1.78395", "0.001862", "0.032689", "-3.25392", "Down", "BCL2 like 11"], ["CLDN1", "-1.78076", "0.000331", "0.013573", "-3.80619", "Down", "claudin 1"], ["ZNF836", "-1.77956", "6.7E-06", "0.00223", "-4.92984", "Down", "zinc finger protein 836"], ["APBA1", "-1.77749", "0.002859", "0.041537", "-3.10878", "Down", "amyloid beta precursor protein binding family A member 1"], ["C8orf37", "-1.77616", "0.000155", "0.009321", "-4.03521", "Down", "chromosome 8 open reading frame 37"], ["LOC391322", "-1.77531", "9.16E-06", "0.00249", "-4.84394", "Down", "D-dopachrometautomerase-like"], ["SPATA2L", "-1.77449", "0.002137", "0.035219", "-3.2077", "Down", "spermatogenesis associated 2 like"], ["GLIS1", "-1.7719", "2.07E-05", "0.00341", "-4.61666", "Down", "GLIS family zinc finger 1"], ["LOC389765", "-1.76734", "7.38E-07", "0.001025", "-5.5224", "Down", "kinesin family member 27 pseudogene"], ["DENND2C", "-1.76558", "1.69E-05", "0.003137", "-4.67437", "Down", "DENN domain containing 2C"], ["MFAP3L", "-1.76481", "0.003083", "0.042962", "-3.08279", "Down", "microfibril associated protein 3 like"], ["TREML1", "-1.76402", "5.96E-05", "0.005493", "-4.31615", "Down", "triggering receptor expressed on myeloid cells like 1"], ["DNHD1", "-1.76398", "0.001285", "0.027046", "-3.37662", "Down", "dynein heavy chain domain 1"], ["SETD6", "-1.75933", "5.78E-05", "0.005462", "-4.32489", "Down", "SET domain containing 6, protein lysine methyltransferase"], ["TTC34", "-1.75712", "4.74E-05", "0.005", "-4.38193", "Down", "tetratricopeptide repeat domain 34"], ["SARDH", "-1.74727", "0.000444", "0.015767", "-3.71564", "Down", "sarcosine dehydrogenase"], ["ZNF385C", "-1.74659", "5.06E-06", "0.002061", "-5.00645", "Down", "zinc finger protein 385C"], ["NEXN-AS1", "-1.74174", "0.001791", "0.03205", "-3.26688", "Down", "NEXN antisense RNA 1"], ["CDHR3", "-1.741", "5.08E-05", "0.00511", "-4.36224", "Down", "cadherin related family member 3"], ["SPRYD4", "-1.7362", "0.00381", "0.048018", "-3.00934", "Down", "SPRY domain containing 4"], ["ZSCAN25", "-1.73514", "0.000224", "0.011092", "-3.92529", "Down", "zinc finger and SCAN domain containing 25"], ["FAM157C", "-1.73405", "3.95E-05", "0.004552", "-4.43393", "Down", "family with sequence similarity 157 member C"], ["ARSG", "-1.73192", "0.000264", "0.012045", "-3.8757", "Down", "arylsulfatase G"], ["GLI2", "-1.72398", "8.75E-06", "0.002428", "-4.85662", "Down", "GLI family zinc finger 2"], ["NSUN7", "-1.72112", "0.000383", "0.014539", "-3.76087", "Down", "NOP2/Sun RNA methyltransferase family member 7"], ["BMP3", "-1.71974", "0.00051", "0.016932", "-3.67185", "Down", "bone morphogenetic protein 3"], ["PPT2", "-1.71813", "1.01E-05", "0.002625", "-4.81647", "Down", "palmitoyl-protein thioesterase 2"], ["CCNJL", "-1.7168", "0.00297", "0.042241", "-3.0957", "Down", "cyclin J like"], ["C3orf70", "-1.71506", "1.17E-05", "0.002752", "-4.77652", "Down", "chromosome 3 open reading frame 70"], ["FBF1", "-1.71426", "0.002996", "0.042479", "-3.09265", "Down", "Fas binding factor 1"], ["SEC14L2", "-1.70866", "7.5E-05", "0.006105", "-4.24929", "Down", "SEC14 like lipid binding 2"], ["YPEL4", "-1.70708", "0.000495", "0.016631", "-3.68141", "Down", "yippee like 4"], ["PCDH11Y", "-1.70054", "0.00111", "0.025344", "-3.42438", "Down", "protocadherin 11 Y-linked"], ["AFAP1L2", "-1.68648", "4.19E-05", "0.004645", "-4.41718", "Down", "actin filament associated protein 1 like 2"], ["ZNF674-AS1", "-1.6796", "0.001198", "0.026347", "-3.39966", "Down", "ZNF674 antisense RNA 1 (head to head)"], ["KCNQ4", "-1.67351", "1.12E-05", "0.002709", "-4.78912", "Down", "potassium voltage-gated channel subfamily Q member 4"], ["SULT1B1", "-1.67126", "9.73E-05", "0.00709", "-4.17312", "Down", "sulfotransferase family 1B member 1"], ["MORN1", "-1.66843", "0.000538", "0.01724", "-3.6552", "Down", "MORN repeat containing 1"], ["PCDH17", "-1.66757", "7.41E-05", "0.006068", "-4.25287", "Down", "protocadherin 17"], ["FOXP2", "-1.66727", "0.000941", "0.023272", "-3.47788", "Down", "forkhead box P2"], ["XYLB", "-1.66722", "0.001703", "0.031013", "-3.28371", "Down", "xylulokinase"], ["CTNNA3", "-1.66694", "0.000163", "0.009544", "-4.02144", "Down", "catenin alpha 3"], ["NLRP6", "-1.66633", "0.000524", "0.017152", "-3.66377", "Down", "NLR family pyrin domain containing 6"], ["SLC16A13", "-1.66401", "0.000624", "0.018805", "-3.60875", "Down", "solute carrier family 16 member 13"], ["GLI3", "-1.6638", "0.003245", "0.044179", "-3.06511", "Down", "GLI family zinc finger 3"], ["SYNJ2", "-1.66358", "0.000209", "0.010651", "-3.94618", "Down", "synaptojanin 2"], ["C2orf15", "-1.6617", "0.000283", "0.012404", "-3.85419", "Down", "chromosome 2 open reading frame 15"], ["SCIMP", "-1.65716", "0.002226", "0.036099", "-3.19403", "Down", "SLP adaptor and CSK interacting membrane protein"], ["KIR2DL4", "-1.6566", "0.000227", "0.01115", "-3.92146", "Down", "killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 4"], ["FHL3", "-1.65441", "0.00305", "0.042759", "-3.08659", "Down", "four and a half LIM domains 3"], ["OVGP1", "-1.65215", "1.12E-06", "0.001179", "-5.41243", "Down", "oviductal glycoprotein 1"], ["N4BP3", "-1.65201", "0.000581", "0.017987", "-3.63113", "Down", "NEDD4 binding protein 3"], ["ELOVL7", "-1.64755", "3.88E-05", "0.00453", "-4.43907", "Down", "ELOVL fatty acid elongase 7"], ["ESRG", "-1.64744", "0.001428", "0.028535", "-3.34192", "Down", "embryonic stem cell related"], ["ACTA2-AS1", "-1.64552", "0.000128", "0.008394", "-4.09176", "Down", "ACTA2 antisense RNA 1"], ["CNKSR3", "-1.64218", "7.19E-05", "0.005962", "-4.26146", "Down", "CNKSR family member 3"], ["ZNF347", "-1.63729", "0.002754", "0.040644", "-3.12164", "Down", "zinc finger protein 347"], ["SGMS1-AS1", "-1.6362", "3.3E-06", "0.001776", "-5.12249", "Down", "SGMS1 antisense RNA 1"], ["ZKSCAN2", "-1.63535", "4.67E-05", "0.005", "-4.38616", "Down", "zinc finger with KRAB and SCAN domains 2"], ["AMIGO1", "-1.63486", "0.000936", "0.023198", "-3.47947", "Down", "adhesion molecule with Ig like domain 1"], ["ZC3H10", "-1.63262", "0.001463", "0.028876", "-3.33409", "Down", "zinc finger CCCH-type containing 10"], ["MUC17", "-1.62593", "0.000109", "0.007553", "-4.14108", "Down", "mucin 17, cell surface associated"], ["ZNF559-ZNF177", "-1.62399", "6.21E-05", "0.005556", "-4.30427", "Down", "ZNF559-ZNF177 readthrough"], ["NUTM2D", "-1.62355", "0.000228", "0.011159", "-3.92008", "Down", "NUT family member 2D"], ["ABCB4", "-1.62247", "3.99E-06", "0.001884", "-5.07099", "Down", "ATP binding cassette subfamily B member 4"], ["LOC100652768", "-1.61749", "0.000307", "0.012935", "-3.82956", "Down", "uncharacterized LOC100652768"], ["C8orf58", "-1.61509", "5.62E-06", "0.002118", "-4.97786", "Down", "chromosome 8 open reading frame 58"], ["WRAP73", "-1.61325", "4.07E-06", "0.001884", "-5.06554", "Down", "WD repeat containing, antisense to TP73"], ["SLC24A4", "-1.61174", "2.06E-05", "0.00341", "-4.61911", "Down", "solute carrier family 24 member 4"], ["LENG8-AS1", "-1.61071", "2.39E-05", "0.003497", "-4.57709", "Down", "LENG8 antisense RNA 1"], ["C2orf66", "-1.60563", "1.03E-05", "0.002643", "-4.81096", "Down", "chromosome 2 open reading frame 66"], ["SMIM10L2A", "-1.60523", "9.09E-05", "0.006806", "-4.19335", "Down", "small integral membrane protein 10 like 2A"], ["CYP1B1-AS1", "-1.60433", "0.000107", "0.007513", "-4.14419", "Down", "CYP1B1 antisense RNA 1"], ["CTNND1", "-1.60088", "0.000109", "0.007568", "-4.13895", "Down", "catenin delta 1"], ["ADCY10P1", "-1.60028", "4.19E-05", "0.004645", "-4.4176", "Down", "ADCY10 pseudogene 1"], ["LOC100130298", "-1.59936", "3.39E-05", "0.004196", "-4.47779", "Down", "hCG1816373-like"], ["FLJ42627", "-1.59816", "0.001285", "0.027046", "-3.37677", "Down", "uncharacterized LOC645644"], ["CRISPLD1", "-1.59815", "0.000698", "0.019931", "-3.57312", "Down", "cysteine rich secretory protein LCCL domain containing 1"], ["MESTIT1", "-1.59755", "1.51E-06", "0.001401", "-5.33225", "Down", "MEST intronic transcript 1, antisense RNA"], ["ASPG", "-1.59743", "0.001369", "0.027894", "-3.35594", "Down", "asparaginase"], ["PRICKLE2-AS1", "-1.59631", "0.000336", "0.013596", "-3.80182", "Down", "PRICKLE2 antisense RNA 1"], ["LINC00865", "-1.59557", "2.66E-05", "0.00371", "-4.54615", "Down", "long intergenic non-protein coding RNA 865"], ["LINC01001", "-1.59556", "1.77E-06", "0.001545", "-5.29009", "Down", "long intergenic non-protein coding RNA 1001"], ["GRK4", "-1.59417", "1.69E-05", "0.003137", "-4.67411", "Down", "G protein-coupled receptor kinase 4"], ["ZNF300", "-1.59305", "5.6E-05", "0.005391", "-4.33388", "Down", "zinc finger protein 300"], ["CADM3-AS1", "-1.59265", "7.19E-05", "0.005962", "-4.26163", "Down", "CADM3 antisense RNA 1"], ["SIT1", "-1.59069", "0.000397", "0.014772", "-3.75003", "Down", "signaling threshold regulating transmembrane adaptor 1"], ["LINC01138", "-1.59045", "0.001479", "0.028971", "-3.33042", "Down", "long intergenic non-protein coding RNA 1138"], ["DNAH5", "-1.5878", "0.000268", "0.012109", "-3.87093", "Down", "dynein axonemal heavy chain 5"], ["FAM155B", "-1.58584", "2.87E-05", "0.003871", "-4.52525", "Down", "family with sequence similarity 155 member B"], ["SLC5A4", "-1.58234", "3.27E-06", "0.001776", "-5.12479", "Down", "solute carrier family 5 member 4"], ["ZNF573", "-1.58059", "6.33E-06", "0.002168", "-4.94541", "Down", "zinc finger protein 573"], ["RCAN3", "-1.5793", "2.89E-05", "0.003871", "-4.52291", "Down", "RCAN family member 3"], ["DNAH3", "-1.57822", "0.000296", "0.012696", "-3.83989", "Down", "dynein axonemal heavy chain 3"], ["UBXN10", "-1.57771", "1.9E-05", "0.003343", "-4.64092", "Down", "UBX domain protein 10"], ["CLEC4A", "-1.57555", "0.003924", "0.048741", "-2.99895", "Down", "C-type lectin domain family 4 member A"], ["RFFL", "-1.57423", "0.000171", "0.009664", "-4.00626", "Down", "ring finger and FYVE like domain containing E3 ubiquitin protein ligase"], ["TMEM130", "-1.57294", "0.000437", "0.015643", "-3.72015", "Down", "transmembrane protein 130"], ["KCNMB4", "-1.57256", "0.003907", "0.048656", "-3.0005", "Down", "potassium calcium-activated channel subfamily M regulatory beta subunit 4"], ["LINC00924", "-1.57057", "0.000165", "0.009593", "-4.01761", "Down", "long intergenic non-protein coding RNA 924"], ["EREG", "-1.57034", "0.000125", "0.008283", "-4.09939", "Down", "epiregulin"], ["URAD", "-1.56639", "0.000704", "0.020012", "-3.5708", "Down", "ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5-) decarboxylase"], ["SLC22A15", "-1.56367", "0.000564", "0.017736", "-3.64079", "Down", "solute carrier family 22 member 15"], ["ADRA2B", "-1.56339", "0.000592", "0.018192", "-3.62512", "Down", "adrenoceptor alpha 2B"], ["CDH26", "-1.56317", "0.00033", "0.013567", "-3.80719", "Down", "cadherin 26"], ["ZNF596", "-1.5628", "0.000227", "0.01115", "-3.92153", "Down", "zinc finger protein 596"], ["NYAP1", "-1.55572", "3.9E-05", "0.004533", "-4.43763", "Down", "neuronal tyrosine phosphorylated phosphoinositide-3-kinase adaptor 1"], ["SFRP5", "-1.55537", "0.000468", "0.016151", "-3.699", "Down", "secreted frizzled related protein 5"], ["LOC101929574", "-1.55461", "0.001368", "0.027894", "-3.35602", "Down", "uncharacterized LOC101929574"], ["RNF207", "-1.54999", "7.31E-06", "0.002243", "-4.90599", "Down", "ring finger protein 207"], ["NRL", "-1.54936", "2.58E-05", "0.003634", "-4.55549", "Down", "neural retina leucine zipper"], ["ANGPTL6", "-1.54763", "0.00025", "0.011782", "-3.89133", "Down", "angiopoietin like 6"], ["ALOX15", "-1.54749", "0.000145", "0.009003", "-4.0563", "Down", "arachidonate 15-lipoxygenase"], ["CHEK2", "-1.54682", "0.001992", "0.03385", "-3.23132", "Down", "checkpoint kinase 2"], ["ZNF543", "-1.54508", "0.00303", "0.042657", "-3.08876", "Down", "zinc finger protein 543"], ["ZNF717", "-1.54439", "0.000156", "0.009363", "-4.03319", "Down", "zinc finger protein 717"], ["FASLG", "-1.54428", "0.001265", "0.026877", "-3.38181", "Down", "Fas ligand"], ["LILRA3", "-1.5435", "1.84E-05", "0.003308", "-4.65038", "Down", "leukocyte immunoglobulin like receptor A3"], ["NEK10", "-1.54346", "0.00012", "0.008053", "-4.11146", "Down", "NIMA related kinase 10"], ["MIR1914", "-1.543", "0.000489", "0.016519", "-3.68532", "Down", "microRNA 1914"], ["BATF3", "-1.54097", "0.000518", "0.017057", "-3.667", "Down", "basic leucine zipper ATF-like transcription factor 3"], ["AVIL", "-1.54065", "0.000332", "0.013573", "-3.80487", "Down", "advillin"], ["KLK10", "-1.54034", "7.07E-05", "0.005956", "-4.26664", "Down", "kallikrein related peptidase 10"], ["ZNF689", "-1.53954", "0.003253", "0.04422", "-3.06429", "Down", "zinc finger protein 689"], ["MKLN1-AS", "-1.53911", "0.00209", "0.0347", "-3.2153", "Down", "MKLN1 antisense RNA"], ["LOC100128398", "-1.53652", "0.002092", "0.034722", "-3.21487", "Down", "uncharacterized LOC100128398"], ["LRP1-AS", "-1.53646", "4.89E-05", "0.005015", "-4.37323", "Down", "LRP1 antisense RNA"], ["NPIPA1", "-1.5363", "0.003113", "0.043191", "-3.07949", "Down", "nuclear pore complex interacting protein family member A1"], ["NLRP2", "-1.53625", "0.00031", "0.012977", "-3.82661", "Down", "NLR family pyrin domain containing 2"], ["MMEL1", "-1.5346", "0.000336", "0.013596", "-3.80163", "Down", "membrane metalloendopeptidase like 1"], ["SPDYE5", "-1.53457", "0.000116", "0.007921", "-4.12051", "Down", "speedy/RINGO cell cycle regulator family member E5"], ["CCL28", "-1.5342", "5.69E-05", "0.005435", "-4.32942", "Down", "C-C motif chemokine ligand 28"], ["KLHDC1", "-1.53297", "0.000501", "0.016732", "-3.67754", "Down", "kelch domain containing 1"], ["FRMPD1", "-1.53279", "4.28E-05", "0.004701", "-4.41134", "Down", "FERM and PDZ domain containing 1"], ["LINC00211", "-1.53271", "0.00019", "0.010241", "-3.97414", "Down", "long intergenic non-protein coding RNA 211"], ["ATP6V1G2", "-1.53264", "0.000799", "0.021227", "-3.53045", "Down", "ATPase H+ transporting V1 subunit G2"], ["PRIMA1", "-1.53113", "0.000786", "0.021056", "-3.53546", "Down", "proline rich membrane anchor 1"], ["NPTX1", "-1.52859", "0.000253", "0.011808", "-3.88811", "Down", "neuronal pentraxin 1"], ["LOC101928107", "-1.5272", "0.0003", "0.012783", "-3.83612", "Down", "uncharacterized LOC101928107"], ["GFRA3", "-1.5245", "8.59E-06", "0.002428", "-4.86161", "Down", "GDNF family receptor alpha 3"], ["LOC101929595", "-1.51972", "1.12E-05", "0.002709", "-4.78841", "Down", "uncharacterized LOC101929595"], ["FLJ37453", "-1.51859", "7.55E-06", "0.002243", "-4.8971", "Down", "uncharacterized LOC729614"], ["MACC1", "-1.51799", "0.000573", "0.017831", "-3.6354", "Down", "MET transcriptional regulator MACC1"], ["LINC00607", "-1.51637", "2.68E-05", "0.00371", "-4.5447", "Down", "long intergenic non-protein coding RNA 607"], ["FAM86B1", "-1.5153", "0.000332", "0.013573", "-3.80528", "Down", "family with sequence similarity 86 member B1"], ["MIR4477B", "-1.51191", "2.05E-05", "0.00341", "-4.62019", "Down", "microRNA 4477b"], ["CNNM2", "-1.50798", "0.001668", "0.03072", "-3.29062", "Down", "cyclin and CBS domain divalent metal cation transport mediator 2"], ["SKA1", "-1.50659", "0.00086", "0.02226", "-3.50665", "Down", "spindle and kinetochore associated complex subunit 1"], ["ABRACL", "-1.50603", "0.001136", "0.025784", "-3.41701", "Down", "ABRA C-terminal like"], ["LINC00954", "-1.50484", "0.000652", "0.019135", "-3.59472", "Down", "long intergenic non-protein coding RNA 954"], ["ZBP1", "-1.50412", "0.002141", "0.035221", "-3.20719", "Down", "Z-DNA binding protein 1"], ["ZNF528", "-1.50042", "0.000464", "0.016097", "-3.70168", "Down", "zinc finger protein 528"], ["ACTG1P4", "-1.50023", "0.000252", "0.011803", "-3.88932", "Down", "actin gamma 1 pseudogene 4"], ["MYO10", "-1.50014", "0.003103", "0.043113", "-3.08058", "Down", "myosin X"]], "row_count": 740, "column_count": 7, "numeric_cells": 3763, "header_rows": 1, "locator": "section[13]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:33622336:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b05de603893be1d8efd12e537f53ea5636f28381cb8e98bca17139dbaf06e918", "bytes": 5269, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab3", "version": null, "note": "The enriched GO terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC7901211", "section_index": 14, "section_title": "GO and pathway enrichment of DEGs in PCOS", "row_count": 15, "column_count": 9}, "table": {"label": "Table 3", "caption": "The enriched GO terms of the up and down regulated differentially expressed genes", "rows": [["GO ID", "CATEGORY", "GO Name", "P Value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["GO:0006518", "BP", "peptide metabolic process", "1.51E-13", "2.66E-11", "2.37E-10", "6.37E-10", "52", "RPL24,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,RPLP0,MRPL12,MRPS12,RPS5,RPS8,ETF1,RPS10,EIF3E,RPS15,RPS15A,SRP72,RPS20,RPS21,RPS23,RPS24,RPS29,EIF6,EIF3L,MRPS21,MRPL24,MRPL20,COA3,RBM3,TRMT112,MRPL54,CPE,RPL14,RPS27L,EIF2D,DPH5,EIF1AX,ATP6AP2,ZNF706,SEC11A,MRPS24,UHMK1,EIF5,MRPS15,MRPS6,MRPS34,LSM14A,RPL35,RPL13A,MRPL9,RSL24D1"], ["GO:0006886", "BP", "intracellular protein transport", "6.75E-12", "8.16E-10", "7.28E-09", "2.86E-08", "66", "GIPC1,SNAPIN,RPL24,TCTN3,RPL27,RPL30,RPL29,RPL34,ROMO1,RPL35A,RPL36A,RPLP0,RPS5,RPS8,RPS10,RPS15,RPS15A,PHB2,SRP72,RPS20,HMGCL,RPS21,RPS23,RPS24,RPS29,ARFIP2,TOMM5,EIF6,RAB10,ATP6V1D,SNX8,PEX19,AGFG1,PEX2,ZFAND6,RABGEF1,SNX9,RAB4A,PMM1,TOMM7,SRSF6,ANP32B,RPAIN,TNPO2,DERL2,FIS1,RPL14,APOD,ECH1,IFI27,YWHAH,TMED4,ARF5,NDUFA13,EXOC5,EIF2D,UBL5,TIMM8B,ICMT,UHMK1,DYNLL2,VPS28,RPL35,SYVN1,RPL13A,STX10"], ["GO:0031967", "CC", "organelle envelope", "2.36E-19", "1.71E-17", "1.20E-16", "1.47E-16", "72", "ROMO1,PRELID1,MRPL12,MRPS12,PET100,BAK1,PHB2,LRRC59,HMGCL,GCHFR,COA4,NDUFA2,SLC25A26,BLOC1S1,ECSIT,SUCLG1,NDUFB2,TOMM5,NDUFC2,BANF1,MOAP1,NDUFS4,NDUFS5,PHB,BNIP3,PI4KB,FDX1,MRPS21,AGFG1,SLC25A11,TMEM97,UQCRC1,UQCRFS1,UQCRH,UQCR11,NME2,MRPL24,CERS2,MRPL20,TOMM7,COA3,COX4I1,COX5B,DTYMK,ANXA4,COX6A1,NDUFAF3,COX6B1,MRPL54,COX6C,COX7A2,COX7C,COX8A,FIS1,IFI27,MAD2L1BP,CCND2,NDUFA13,CYB5B,TMEM256,TIMM8B,AIFM1,MRPS24,MRPS15,CHCHD2,MRPS6,MRPS34,COX7A2L,UQCRQ,HSD17B10,MTDH,MRPL9"], ["GO:1902494", "CC", "catalytic complex", "1.31E-12", "5.84E-11", "4.09E-10", "8.17E-10", "67", "PRPF31,DCAF6,ERH,SAP18,OST4,PSMB1,PSMB4,ETFB,PSMB7,PSMC5,PSMD3,PSMD10,NDUFA2,EZH1,SUCLG1,NDUFB2,NDUFC2,NDUFS4,NDUFS5,LSM3,CKS1B,TSPAN17,SLC9A3R1,UBE2E1,RBMX,MORF4L1,PEX2,AK1,PRMT1,UQCRC1,UQCRFS1,UQCRH,TAF7,ANAPC5,TADA3,ANAPC13,RBX1,CUL4A,POLR3GL,RBBP7,PIGS,POLR2J,POLR2K,DERL2,BCCIP,POLE4,NAA38,CCNC,CCND2,RMRP,NDUFA13,POLR1D,GTF2A2,ORMDL1,SEC11A,SF3B6,DYNLL2,SMARCD2,UQCRQ,HSD17B10,KLHL12,SYVN1,CDC27,PSMD14,SNRPD2,RPPH1,KRTCAP2"], ["GO:0003723", "MF", "RNA binding", "1.66E-10", "4.49E-08", "3.30E-07", "1.45E-07", "76", "RPL24,PRPF31,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,ERH,RPLP0,MRPL12,MRPS12,SAP18,RSL1D1,RPS5,RPS8,ETF1,RPS10,EIF3E,RPS15,RPS15A,SRP72,RPS20,LRRC59,RPS21,RPS23,RPS24,SUCLG1,EIF6,LSM3,RBMX,EIF3L,MRPS21,NQO1,AGFG1,LSM4,PRMT1,SLC25A11,TBCA,MRPL20,NUDT16,SRSF6,S100A16,GLRX3,RBBP7,RBM3,MRPL54,NELFB,BCCIP,RDX,RPL14,C7orf50,XRCC5,SERPINH1,RPS27L,EIF2D,GTF3A,FAM32A,EIF1AX,SBDS,SF3B6,MRPS24,UHMK1,EIF5,MRPS15,SLTM,MRPS6,LSM14A,HSD17B10,RPL35,RPL13A,SNRPD2,MTDH,MRPL9,SF3B5,RSL24D1"], ["GO:0008134", "MF", "transcription factor binding", "1.05E-02", "1.83E-01", "1.00E+00", "1.00E+00", "23", "NAB1,PHB2,PSMC5,FAM89B,NBN,PSMD10,MDFI,TAF7,SETD3,TADA3,RBX1,WIPI1,ANXA4,TEAD3,IFI27,YWHAH,GTF2A2,MED4,ICMT,CHCHD2,HSD17B10,MTDH,TRIB1"], ["Down regulated genes"], ["GO:0120036", "BP", "plasma membrane bounded cell projection organization", "7.28E-05", "2.19E-02", "1.94E-01", "2.91E-01", "49", "EPHB4,STK36,MAK,SPAST,ZFYVE27,TTLL3,MYO7A,MYO10,SDCCAG8,SPTB,SARM1,RAP1GAP2,NPHP4,GFRA3,AMIGO1,HECW2,GLI2,GLI3,SYNE2,WRAP73,NGFR,NTN1,NLGN2,FGFR3,PLD1,CEP126,NYAP1,DNAH5,UBXN10,PLXNB3,SEMA6B,FAT4,NPTX1,NEDD4L,STXBP5,FBF1,LAMA5,RFFL,ODF2,FAS,RFX3,ATL1,TRAK1,WDR19,FEZ1,AVIL,CEP135,IFT122,EPHA4"], ["GO:0000902", "BP", "cell morphogenesis", "3.10E-03", "1.93E-01", "1.00E+00", "1.00E+00", "31", "EPHB4,CDH26,SPAST,ZFYVE27,MYO7A,MYO10,CDHR3,SPTB,SARM1,GFRA3,AMIGO1,HECW2,GLI2,GLI3,NGFR,NTN1,FGFR3,NYAP1,PLXNB3,SEMA6B,NPTX1,NEDD4L,STXBP5,LAMA5,CDH19,ATL1,TRAK1,WDR19,FEZ1,C8orf37,EPHA4"], ["GO:0043005", "CC", "neuron projection", "3.65E-05", "7.26E-03", "5.00E-02", "2.00E-02", "46", "EPHB4,MAK,PDE4B,SNPH,SPAST,ZFYVE27,MYO7A,MYO10,ESR1,SDCCAG8,SARM1,RAP1GAP2,N4BP3,NPHP4,SNAP47,TIAM2,AMIGO1,KCNC1,PTPRN2,SYNJ2,NGFR,NLGN2,BSN,NPTX1,CALCR,PLXDC1,STXBP5,ERO1A,GRK4,AAK1,APBA1,KLC2,VTI1A,FAS,ATL1,TRAK1,WDR19,SHISA9,FEZ1,KCNQ4,AVIL,UNC13C,IFT122,CTNND1,EPHA4,GABRA4"], ["GO:0030054", "CC", "cell junction", "3.04E-03", "8.34E-02", "5.74E-01", "1.00E+00", "34", "CDH26,SNPH,CDHR3,SDCCAG8,SARM1,OBSCN,NPHP4,ABCB4,ARHGAP22,RASIP1,PTPRN2,SYNE2,LPXN,NGFR,NLGN2,FGFR3,BSN,FHL3,CDC42BPA,PLXDC1,STXBP5,FBF1,LCK,CDH19,CLDN1,PRIMA1,SHISA9,LMO7,CTNNA3,UNC13C,C8orf37,CTNND1,EPHA4,GABRA4"], ["GO:0000981", "MF", "DNA-binding transcription factor activity, RNA polymerase II-specific", "9.75E-04", "3.67E-01", "1.00E+00", "7.35E-01", "43", "ZNF717,ZXDC,HIVEP1,ERG,ZNF154,ESR1,ZSCAN25,ARNTL2,ZNF836,ZNF469,ZNF547,GLI2,GLI3,ZNF347,ZNF778,BATF3,TET3,ZNF687,ZNF114,MACC1,ZNF555,ZNF493,FOXP2,NRL,ZNF596,ZNF689,ZNF300,ZKSCAN2,RFX3,ZNF496,IKZF4,RLF,KAT7,DMRT2,ZNF334,MTF1,ZKSCAN3,ZNF559-ZNF177,ZNF69,ZNF528,ZNF543,GLIS1,ZNF124"], ["GO:0005524", "MF", "ATP binding", "2.83E-02", "4.14E-01", "1.00E+00", "1.00E+00", "34", "EPHB4,PRPS2,STK36,MAK,CNNM2,SPAST,TTLL3,MYO7A,MYO10,NEK10,OBSCN,PFAS,TOR4A,ABCB4,FGFR3,XYLB,DNAH5,DNHD1,ATP13A4,DNAH3,CDC42BPA,ATP13A1,GRK4,MAP 3K14,AAK1,ABCC5,LCK,NLRP2,NLRP6,TRIB3,CHEK2,ERCC6L2,MAST3,EPHA4"]], "row_count": 15, "column_count": 9, "numeric_cells": 84, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab3"}}, {"id": "asset:table:pmid:33622336:9", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:65ad56a7f037ac73d76d9b34b28d9e76c81c1995e593f54aba172a7af1f31749", "bytes": 3457, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#Tab4", "version": null, "note": "The enriched pathway terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC7901211", "section_index": 14, "section_title": "GO and pathway enrichment of DEGs in PCOS", "row_count": 15, "column_count": 8}, "table": {"label": "Table 4", "caption": "The enriched pathway terms of the up and down regulated differentially expressed genes", "rows": [["Pathway ID", "Pathway Name", "P-value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Geness"], ["Up regulated genes"], ["1268678", "Translation", "8.83E-20", "4.54E-17", "3.26E-16", "6.54E-17", "30", "RPL24,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,RPLP0,RPS5,RPS8,ETF1,RPS10,EIF3E,RPS15,RPS15A,SRP72,RPS20,RPS21,RPS23,RPS24,RPS29,EIF3L,TRMT112,RPL14,RPS27L,EIF1AX,SEC11A,EIF5,RPL35,RPL13A"], ["1270128", "Respiratory electron transport", "2.39E-16", "1.27E-14", "9.10E-14", "1.77E-13", "22", "ETFB,NDUFA2,ECSIT,NDUFB2,NDUFC2,NDUFS4,NDUFS5,UQCRC1,UQCRFS1,UQCRH,UQCR11,COX4I1,COX5B,COX6A1,NDUFAF3,COX6B1,COX6C,COX7C,COX8A,NDUFA13,COX7A2L,UQCRQ"], ["1268677", "Metabolism of proteins", "6.29E-10", "1.46E-08", "1.05E-07", "4.66E-07", "72", "B4GALT2,RPL24,RPL27,RPL30,RPL29,UAP1,RPL34,RPL35A,RPL36A,RPLP0,RPS5,PSMB1,RPS8,ETF1,RPS10,PSMB4,ETFB,EIF3E,PSMB7,RPS15,RPS15A,PSMC5,SRP72,PSMD3,RPS20,PFDN1,RPS21,RPS23,PFDN5,PSMD10,RPS24,COA4,RPS29,TOMM5,GFPT1,NEDD8,RAB10,SAA1,UBE2E1,UCHL1,EIF3L,TADA3,RAB4A,TBCA,PMM1,TOMM7,WIPI1,TRMT112,TNIP2,PIGS,AMDHD2,USP24,DERL2,CPE,RPL14,RPS27L,ARF5,EXOC5,TIMM8B,DPH5,ICMT,EIF1AX,ATP6AP2,SEC11A,DYNLL2,EIF5,CHCHD2,SUMO3,RPL35,SYVN1,RPL13A,PSMD14"], ["1269649", "Gene Expression", "1.72E-09", "3.85E-08", "2.77E-07", "1.27E-06", "77", "CDKN2B,RPL24,PRPF31,RPL27,RPL30,RPL29,RPL34,RPL35A,RPL36A,PRELID1,TMEM219,RPLP0,SAP18,RPS5,PSMB1,RPS8,ETF1,RPS10,PSMB4,EIF3E,PSMB7,RPS15,RPS15A,PSMC5,NBN,SRP72,PSMD3,RPS20,RPS21,RPS23,PSMD10,RPS24,RPS29,LSM3,RBMX,EIF3L,NABP2,LSM4,PRMT1,TAF7,SRSF6,POLR3GL,RBBP7,COX4I1,TRMT112,COX5B,COX6A1,COX6B1,POLR2J,POLR2K,NELFB,COX6C,COX7C,COX8A,RPL14,TEAD3,SKIL,YWHAH,RPS27L,CCNC,POLR1D,GTF2A2,MED4,GTF3A,LAMTOR4,EIF1AX,ZNF706,SEC11A,SF3B6,EIF5,COX7A2L,HSD17B10,RPL35,RPL13A,PSMD14,SNRPD2,SF3B5"], ["1269852", "Autodegradation of Cdh1 by Cdh1:APC/C", "1.22E-06", "2.58E-05", "1.86E-04", "9.04E-04", "10", "PSMB1,PSMB4,PSMB7,PSMC5,PSMD3,PSMD10,UBE2E1,ANAPC5,CDC27,PSMD14"], ["1268843", "Mitochondrial translation initiation", "2.55E-06", "4.96E-05", "3.57E-04", "1.89E-03", "11", "MRPL12,MRPS12,MRPS21,MRPL24,MRPL20,MRPL54,MRPS24,MRPS15,MRPS6,MRPS34,MRPL9"], ["Down regulated genes"], ["1269650", "Generic Transcription Pathway", "1.96E-04", "1.10E-01", "7.63E-01", "1.10E-01", "29", "ZNF717,ZNF486,ZNF154,ESR1,ZSCAN25,MEN1,ZNF547,BANP,ZNF347,ZNF778,TAF4B,ZNF114,ZNF573,ZNF555,ZNF493,NEDD4L,ZNF596,ZNF689,ZNF300,RFFL,FAS,ZNF496,ZNF334,ZKSCAN3,CHEK2,ZNF528,ZNF543,TOP3A,ZNF124"], ["1269903", "Transmembrane transport of small molecules", "2.80E-02", "7.66E-01", "1.00E+00", "1.00E+00", "18", "ATP6V1G2,SLC22A15,SLCO4A1,ASIC3,ABCB4,SLC24A4,SLC44A5,SCNN1D,SLC9A7,ATP13A4,NEDD4L,ATP13A1,ABCC5,SLC1A7,SLC5A4,SLC30A7,NDC1,GABRA4"], ["1268846", "Cilium Assembly", "3.71E-02", "7.66E-01", "1.00E+00", "1.00E+00", "7", "SDCCAG8,NPHP4,FBF1,ODF2,WDR19,CEP135,IFT122"], ["1269957", "Metabolism of carbohydrates", "1.11E-01", "7.66E-01", "1.00E+00", "1.00E+00", "8", "PRPS2,CHST14,XYLB,MGAM,ABCC5,SLC5A4,NDC1,SLC25A13"], ["1269443", "Signalling by NGF", "1.63E-01", "7.66E-01", "1.00E+00", "1.00E+00", "11", "EREG,SPTB,OBSCN,KBTBD7,GFRA3,TIAM2,NGFR,FGFR3,BCL2L11,LCK,TRIB3"], ["1269171", "Adaptive Immune System", "1.86E-01", "7.66E-01", "1.00E+00", "1.00E+00", "17", "EREG,LRSAM1,HLA-H,RAP1GAP2,KBTBD7,SLAMF6,HECW2,FGFR3,KIR2DL4,TREML1,LILRA3,NEDD4L,MAP 3K14,KLC2,LCK,TRIB3,LMO7"]], "row_count": 15, "column_count": 8, "numeric_cells": 84, "header_rows": 1, "locator": "section[14]/table-wrap[2]#Tab4"}}, {"id": "asset:table:pmid:33622336:10", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0c1b7ecc656a88cbb39fca04c8ec31266bf5a9caeb74f6a0eb6534c5640f1397", "bytes": 14627, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#Tab5", "version": null, "note": "Topology table for up and down regulated genes", "structure": {"pmcid": "PMC7901211", "section_index": 15, "section_title": "PPI networks construction and module Analysis", "row_count": 285, "column_count": 6}, "table": {"label": "Table 5", "caption": "Topology table for up and down regulated genes", "rows": [["Regulation", "Node", "Degree", "Betweenness", "Stress", "Closeness"], ["Up", "SAA1", "315", "0.10107", "69407430", "0.321603"], ["Up", "ADCY6", "312", "0.072777", "44726506", "0.302897"], ["Up", "POLR2K", "236", "0.037471", "28379862", "0.302013"], ["Up", "RPS15", "212", "0.008152", "26431684", "0.308863"], ["Up", "RPS15A", "211", "0.007809", "26602340", "0.309741"], ["Up", "RPS5", "209", "0.007859", "26492428", "0.309463"], ["Up", "RPL13A", "207", "0.007846", "22124842", "0.309533"], ["Up", "RPS23", "205", "0.005989", "23951504", "0.308794"], ["Up", "RPLP0", "205", "0.00818", "22450450", "0.310438"], ["Up", "RPL35", "203", "0.006165", "21837168", "0.309417"], ["Up", "RPS20", "202", "0.005559", "24073032", "0.308564"], ["Up", "RPS29", "198", "0.004498", "20672292", "0.308426"], ["Up", "RBX1", "197", "0.044386", "26711280", "0.318217"], ["Up", "POLR2J", "192", "0.020679", "20252592", "0.293659"], ["Up", "RPL30", "187", "0.006891", "19563996", "0.308265"], ["Up", "RPS8", "177", "0.004042", "18164736", "0.30678"], ["Up", "RPL35A", "174", "0.003759", "16445648", "0.30783"], ["Up", "RPS24", "174", "0.003192", "15939464", "0.304838"], ["Up", "RPL24", "173", "0.003533", "16772430", "0.306803"], ["Up", "C3AR1", "172", "0.003177", "5121210", "0.274955"], ["Up", "RPL34", "172", "0.004039", "16061864", "0.30719"], ["Up", "RPL29", "171", "0.00494", "18453558", "0.307647"], ["Up", "RPS21", "170", "0.002685", "15196960", "0.304636"], ["Up", "SNRPD2", "168", "0.03814", "33998368", "0.309486"], ["Up", "RPS10", "164", "0.002949", "14807414", "0.306055"], ["Up", "RPL14", "163", "0.00328", "15070824", "0.306826"], ["Up", "RPL27", "160", "0.002277", "14404254", "0.305716"], ["Up", "PSMC5", "145", "0.016771", "20051716", "0.327066"], ["Up", "PSMD14", "138", "0.008797", "20693344", "0.312311"], ["Up", "RBBP7", "136", "0.039699", "19307334", "0.314733"], ["Up", "PSMD3", "132", "0.006138", "19507196", "0.312264"], ["Up", "SRSF6", "130", "0.01551", "18603044", "0.305242"], ["Up", "PSMB4", "128", "0.006024", "19460760", "0.31217"], ["Up", "PSMB1", "126", "0.005935", "19159108", "0.312736"], ["Up", "PSMD10", "125", "0.006564", "19293068", "0.313162"], ["Up", "PSMB7", "121", "0.004879", "18406276", "0.311911"], ["Up", "CDC27", "121", "0.014082", "17205180", "0.314709"], ["Up", "PLCG2", "119", "0.031441", "10514426", "0.284595"], ["Up", "UBE2E1", "111", "0.01698", "18575766", "0.315597"], ["Up", "MRPL24", "111", "0.004006", "3985902", "0.27419"], ["Up", "SEC11A", "107", "0.005316", "8457436", "0.302168"], ["Up", "EIF3E", "105", "0.00271", "6755804", "0.298099"], ["Up", "EIF1AX", "105", "0.00175", "6248608", "0.298099"], ["Up", "ETF1", "104", "0.003209", "7817310", "0.300348"], ["Up", "SF3B5", "104", "0.003133", "6307886", "0.271298"], ["Up", "EIF5", "103", "0.002157", "5951468", "0.298056"], ["Up", "MRPS12", "103", "0.001566", "3803642", "0.27381"], ["Up", "RPS27L", "103", "0.003987", "8037762", "0.3043"], ["Up", "RBMX", "102", "0.006533", "8629778", "0.302543"], ["Up", "SF3B6", "101", "0.007747", "10034416", "0.30272"], ["Up", "RPL36A", "101", "0.001189", "3109720", "0.271102"], ["Up", "RSL24D1", "100", "0.010421", "6175826", "0.267684"], ["Up", "ANAPC5", "100", "0.005802", "14180882", "0.312854"], ["Up", "ITGAV", "98", "0.047765", "36204220", "0.313518"], ["Up", "SRP72", "98", "0.001539", "6042806", "0.299696"], ["Up", "NME2", "94", "0.034644", "15645818", "0.312029"], ["Up", "YWHAH", "93", "0.030402", "22230232", "0.316369"], ["Up", "MRPS15", "86", "0.001926", "2385992", "0.260394"], ["Up", "UQCRQ", "83", "0.003421", "1615130", "0.240866"], ["Up", "CCNC", "83", "0.010303", "8511008", "0.281231"], ["Up", "UQCRC1", "82", "0.02328", "14231790", "0.289875"], ["Up", "MED4", "80", "0.018252", "17775072", "0.301683"], ["Up", "UQCRFS1", "78", "0.001699", "1157234", "0.244233"], ["Up", "CCND2", "77", "0.023553", "14830028", "0.314399"], ["Up", "MRPL12", "77", "0.002782", "2194820", "0.259789"], ["Up", "POLR1D", "75", "0.0061", "4678140", "0.274081"], ["Up", "UQCRH", "72", "0.001221", "959168", "0.244147"], ["Up", "KLHL12", "68", "0.003828", "3608276", "0.303719"], ["Up", "SLC9A3R1", "63", "0.021981", "10906810", "0.303987"], ["Up", "XRCC5", "63", "0.016826", "12450448", "0.298895"], ["Up", "EIF6", "62", "0.005109", "3166876", "0.251672"], ["Up", "GTF3A", "61", "0.016181", "6249890", "0.308426"], ["Up", "MRPS6", "60", "6.26E-04", "932952", "0.249563"], ["Up", "PLA2G2A", "59", "0.016536", "3353206", "0.267442"], ["Up", "NDUFC2", "58", "0.009137", "6243750", "0.288562"], ["Up", "TAF7", "58", "0.008456", "6200048", "0.248053"], ["Up", "NDUFA13", "58", "0.010438", "6851160", "0.289086"], ["Up", "TSG101", "57", "0.016521", "11031600", "0.306145"], ["Up", "SAP18", "57", "0.012307", "5315482", "0.302256"], ["Up", "NDUFS4", "56", "0.001242", "656204", "0.239889"], ["Up", "SMAD5", "56", "0.020424", "14462992", "0.296201"], ["Up", "RSL1D1", "56", "0.011475", "16770568", "0.229134"], ["Up", "NDUFA2", "54", "7.42E-04", "556554", "0.239861"], ["Up", "NBN", "54", "0.015436", "11207188", "0.30323"], ["Up", "NEDD8", "53", "0.011483", "3600034", "0.320831"], ["Up", "PRMT1", "52", "0.012592", "15575898", "0.301332"], ["Up", "MORF4L1", "51", "0.010667", "4279006", "0.296795"], ["Up", "CUL4A", "50", "0.007675", "2678820", "0.299544"], ["Up", "LAMA2", "49", "0.007709", "8570206", "0.278844"], ["Up", "COX6A1", "48", "0.001525", "801088", "0.240334"], ["Up", "AK1", "46", "0.003174", "1615960", "0.250894"], ["Up", "COX5B", "42", "0.001215", "595708", "0.239861"], ["Up", "TADA3", "40", "0.010349", "2368830", "0.281307"], ["Up", "SUMO3", "40", "0.011044", "5466788", "0.300348"], ["Up", "CDKN2B", "36", "0.006521", "2033654", "0.280983"], ["Up", "SERPINH1", "36", "0.01212", "7196482", "0.29909"], ["Up", "MRPL20", "34", "0.002069", "1471944", "0.293201"], ["Up", "COMT", "34", "0.015004", "4152910", "0.286109"], ["Up", "LSM4", "34", "0.007332", "2056240", "0.254456"], ["Up", "EXOC5", "33", "0.00443", "1785404", "0.263041"], ["Up", "SYVN1", "32", "0.012143", "5434366", "0.291078"], ["Up", "BAK1", "31", "0.006508", "1183542", "0.267425"], ["Up", "RAB10", "30", "0.008921", "6109230", "0.296328"], ["Up", "PFDN5", "29", "0.010966", "3969486", "0.290567"], ["Up", "SCARB1", "28", "0.010079", "5204710", "0.299544"], ["Up", "COX6C", "27", "4.36E-04", "219006", "0.232011"], ["Up", "COX4I1", "26", "6.32E-04", "186792", "0.232493"], ["Up", "EZH1", "26", "0.001591", "543666", "0.245377"], ["Up", "SUCLG1", "26", "0.008369", "8540110", "0.200727"], ["Up", "OXCT1", "25", "0.007475", "2818178", "0.199778"], ["Up", "PHB", "24", "0.005122", "2747910", "0.293388"], ["Up", "BANF1", "20", "0.005143", "1975740", "0.295651"], ["Up", "BCCIP", "20", "0.003654", "1838164", "0.269444"], ["Up", "RDX", "18", "0.004798", "4656272", "0.29563"], ["Up", "CFL2", "15", "0.005519", "1602836", "0.286624"], ["Up", "ARF5", "12", "0.004972", "1234824", "0.284419"], ["Up", "UCHL1", "12", "0.001629", "954606", "0.29618"], ["Up", "PFN2", "11", "0.003745", "1598036", "0.28734"], ["Up", "NDUFB2", "8", "0", "0", "0.225404"], ["Up", "COX6B1", "8", "0", "0", "0.225073"], ["Up", "COX7A2L", "8", "0", "0", "0.225073"], ["Up", "COX7C", "8", "0", "0", "0.225073"], ["Up", "PRPF31", "8", "1.73E-04", "119394", "0.213127"], ["Up", "COX8A", "8", "0", "0", "0.225073"], ["Up", "NDUFS5", "8", "0", "0", "0.225404"], ["Up", "PHB2", "8", "0.001363", "712242", "0.308449"], ["Up", "ETFB", "4", "0", "0", "0.224963"], ["Up", "NELFB", "3", "2.95E-04", "570978", "0.27419"], ["Up", "CKS1B", "3", "6.28E-06", "1544", "0.254284"], ["Up", "ANAPC13", "3", "0", "0", "0.245741"], ["Up", "GTF2A2", "3", "0", "0", "0.236342"], ["Up", "POLE4", "3", "2.39E-04", "114402", "0.254863"], ["Up", "TYROBP", "2", "0", "0", "0.248948"], ["Up", "DCAF6", "2", "0", "0", "0.241724"], ["Up", "SKIL", "2", "0", "0", "0.239764"], ["Up", "S100A16", "2", "0", "0", "0.172622"], ["Up", "HMGCL", "2", "0", "0", "0.172622"], ["Up", "ARHGAP12", "2", "7.30E-07", "10130", "0.210056"], ["Up", "STX10", "2", "0", "0", "0.222748"], ["Up", "UQCR11", "2", "0", "0", "0.194129"], ["Up", "GADD45B", "1", "0", "0", "0.188748"], ["Up", "PFDN1", "1", "0", "0", "0.225159"], ["Up", "CDIPT", "1", "0", "0", "0.221556"], ["Up", "TOMM7", "1", "0", "0", "0.211009"], ["Up", "MRPS24", "1", "0", "0", "0.206607"], ["Up", "SBDS", "1", "0", "0", "0.201078"], ["Up", "COPS7A", "1", "0", "0", "0.230512"], ["Up", "DERL2", "1", "0", "0", "0.225466"], ["Up", "DTYMK", "1", "0", "0", "0.237835"], ["Up", "NDFIP1", "1", "0", "0", "0.237726"], ["Up", "BTF3L4", "1", "0", "0", "0.213292"], ["Up", "AFAP1L1", "1", "0", "0", "0.195053"], ["Up", "ATP6V1D", "1", "0", "0", "0.235992"], ["Up", "LSM3", "1", "0", "0", "0.202852"], ["Up", "ARFIP2", "1", "0", "0", "0.22145"], ["Up", "F13A1", "1", "0", "0", "0.201558"], ["Up", "ABI3BP", "1", "0", "0", "0.18668"], ["Up", "NDUFAF3", "1", "0", "0", "0.193485"], ["Up", "APOD", "1", "0", "0", "0.201401"], ["Up", "UBL5", "1", "0", "0", "0.242915"], ["Up", "MFAP5", "1", "0", "0", "0.160727"], ["Up", "RAB4A", "1", "0", "0", "0.234402"], ["Up", "SNAPIN", "1", "0", "0", "0.232493"], ["Up", "UROS", "1", "0", "0", "0.212264"], ["Up", "PLTP", "1", "0", "0", "0.201401"], ["Up", "VPS28", "1", "0", "0", "0.234402"], ["Up", "EIF3L", "1", "0", "0", "0.229656"], ["Up", "NUDT16", "1", "0", "0", "0.237835"], ["Up", "BLOC1S1", "1", "0", "0", "0.256919"], ["Down", "ESR1", "250", "0.13227", "1.07E+08", "0.34572"], ["Down", "LCK", "209", "0.099202", "95979964", "0.328259"], ["Down", "S1PR5", "174", "0.006652", "8092966", "0.28169"], ["Down", "CCL28", "174", "0.003314", "5208440", "0.274992"], ["Down", "CTNND1", "106", "0.042469", "42968374", "0.310275"], ["Down", "KNTC1", "101", "0.02909", "80024314", "0.25565"], ["Down", "NGFR", "100", "0.036602", "63182380", "0.318388"], ["Down", "TIAM2", "95", "0.021154", "62011932", "0.265317"], ["Down", "OBSCN", "86", "0.010365", "36096562", "0.247534"], ["Down", "PLD1", "73", "0.033394", "17246708", "0.30421"], ["Down", "CALCR", "71", "0.002592", "2172836", "0.25466"], ["Down", "PTGDR", "70", "0.002067", "1966748", "0.255524"], ["Down", "FASLG", "69", "0.019813", "7248566", "0.301244"], ["Down", "NEDD4L", "68", "0.023391", "18526624", "0.311841"], ["Down", "GLI3", "68", "0.017183", "7308126", "0.2879"], ["Down", "CEP135", "65", "0.013666", "21907982", "0.267857"], ["Down", "SDCCAG8", "65", "0.013666", "21907982", "0.267857"], ["Down", "ARHGAP39", "61", "0.006186", "28702190", "0.252655"], ["Down", "TNKS", "60", "0.004206", "3754360", "0.297842"], ["Down", "CHEK2", "60", "0.016237", "7288936", "0.307601"], ["Down", "GLI2", "58", "0.012509", "5073890", "0.282922"], ["Down", "ENTPD5", "57", "0.005964", "2743528", "0.250015"], ["Down", "FAM13B", "56", "0.004818", "23506158", "0.251122"], ["Down", "ARHGAP22", "56", "0.004818", "23506158", "0.251122"], ["Down", "LAMA5", "52", "0.00723", "12112106", "0.258896"], ["Down", "SYNJ2", "52", "0.010084", "13175450", "0.253879"], ["Down", "BCL2L11", "52", "0.016836", "10636772", "0.313969"], ["Down", "ALOX15", "49", "0.008753", "5227944", "0.244161"], ["Down", "FGFR3", "49", "0.011331", "25238840", "0.255587"], ["Down", "GEMIN5", "47", "0.001525", "2623902", "0.254973"], ["Down", "FAS", "47", "0.009545", "4674560", "0.293347"], ["Down", "PDE4B", "46", "0.005717", "3857072", "0.252024"], ["Down", "KCNC1", "45", "0.011352", "17732982", "0.215233"], ["Down", "TAF4B", "45", "0.004747", "2685668", "0.266101"], ["Down", "TOP3A", "45", "0.011616", "46078906", "0.231272"], ["Down", "TTF1", "43", "0.001327", "799808", "0.270889"], ["Down", "KCNQ4", "42", "0.027528", "31515762", "0.226874"], ["Down", "MUC17", "42", "0.019711", "25257640", "0.157086"], ["Down", "NTN1", "40", "0.012007", "10110832", "0.266152"], ["Down", "COL8A1", "38", "0.013121", "17046748", "0.212558"], ["Down", "MMRN1", "38", "0.011827", "11815884", "0.252424"], ["Down", "EPHA4", "38", "0.003668", "1364992", "0.273358"], ["Down", "MEN1", "35", "0.006804", "6211974", "0.272297"], ["Down", "GOSR1", "34", "0.008526", "3939382", "0.285714"], ["Down", "SKA1", "32", "0.002897", "9913724", "0.243129"], ["Down", "VTI1A", "31", "0.007925", "4181998", "0.286386"], ["Down", "SYNE2", "30", "0.007519", "9249888", "0.228212"], ["Down", "ITIH4", "26", "0.007262", "1264158", "0.272297"], ["Down", "LCAT", "26", "0.005782", "971078", "0.252178"], ["Down", "TRIB3", "24", "0.002492", "6242350", "0.248261"], ["Down", "TRAF5", "24", "0.00684", "5476244", "0.212395"], ["Down", "DNAH3", "24", "0.007222", "8565654", "0.215524"], ["Down", "PFAS", "24", "0.014988", "8957870", "0.288321"], ["Down", "SNPH", "24", "0.00801", "15545944", "0.224536"], ["Down", "GADD45G", "20", "0.003326", "13947820", "0.23265"], ["Down", "SFRP5", "20", "0.006774", "5015824", "0.211927"], ["Down", "SPTB", "20", "0.0063", "11636704", "0.233978"], ["Down", "KAT7", "18", "0.003392", "3121342", "0.235683"], ["Down", "EPHB4", "18", "0.001434", "905566", "0.260034"], ["Down", "DNAH5", "17", "0.002849", "3119232", "0.205745"], ["Down", "HIVEP1", "17", "0.005211", "11367638", "0.232859"], ["Down", "DNAJC18", "16", "0.004758", "4513144", "0.228489"], ["Down", "SCNN1D", "16", "0.001683", "759732", "0.291057"], ["Down", "ZBP1", "16", "0.0032", "6672792", "0.233555"], ["Down", "RAP1GAP2", "15", "0.003133", "3581154", "0.225872"], ["Down", "SARDH", "15", "0.005309", "5233702", "0.183926"], ["Down", "PRPS2", "15", "0.006081", "1607396", "0.285281"], ["Down", "MYO10", "15", "0.004221", "1310316", "0.235723"], ["Down", "ABCB4", "14", "5.59E-04", "1308566", "0.227248"], ["Down", "SPN", "13", "0.003074", "2890384", "0.244522"], ["Down", "ERO1A", "13", "0.004612", "1425588", "0.287161"], ["Down", "LPXN", "13", "0.002728", "4156340", "0.242304"], ["Down", "CD82", "12", "0.001605", "269660", "0.279107"], ["Down", "CFP", "12", "0.004063", "2388686", "0.220588"], ["Down", "CDC20B", "12", "7.24E-04", "204270", "0.243429"], ["Down", "EREG", "11", "0.00292", "4060738", "0.221568"], ["Down", "GABRA4", "11", "0.004826", "844010", "0.188362"], ["Down", "STK36", "10", "5.16E-06", "1410", "0.231582"], ["Down", "CLDN1", "10", "0.002949", "1746194", "0.196311"], ["Down", "SCAF4", "10", "0.003013", "2202372", "0.198039"], ["Down", "MFAP3", "9", "0.003861", "3290616", "0.191498"], ["Down", "PPT2", "9", "0.003141", "1767236", "0.210548"], ["Down", "NPHP4", "9", "0.003191", "1398268", "0.215199"], ["Down", "ABI3", "8", "0.001847", "2267982", "0.229515"], ["Down", "BATF3", "8", "6.07E-04", "393104", "0.226291"], ["Down", "KLC2", "8", "0.00245", "1875364", "0.222485"], ["Down", "GRK4", "8", "5.59E-04", "417560", "0.222533"], ["Down", "ARNTL2", "7", "0.001968", "1639758", "0.209684"], ["Down", "PPP1R3B", "7", "0.002897", "1494078", "0.211732"], ["Down", "IFT122", "7", "0.001127", "614274", "0.187492"], ["Down", "AHSP", "7", "0.002414", "2877402", "0.186226"], ["Down", "ASIC3", "7", "0.001895", "501964", "0.235361"], ["Down", "WDR19", "7", "0.001287", "982818", "0.187492"], ["Down", "MGAM", "7", "0.002455", "406020", "0.181388"], ["Down", "STXBP5", "6", "0.00108", "832104", "0.196993"], ["Down", "SLC30A7", "6", "0.002041", "1162028", "0.211776"], ["Down", "NRL", "6", "0.001496", "1056416", "0.226267"], ["Down", "KCNMB4", "5", "0.001932", "644596", "0.189223"], ["Down", "SPAST", "5", "0.001932", "3015012", "0.17458"], ["Down", "MTF1", "5", "8.87E-04", "1194192", "0.226862"], ["Down", "FOXP2", "5", "0.001059", "361276", "0.219804"], ["Down", "IWS1", "4", "4.91E-04", "486888", "0.21999"], ["Down", "LRSAM1", "4", "4.66E-04", "327264", "0.292456"], ["Down", "ECD", "4", "3.00E-08", "6", "0.246517"], ["Down", "RFX3", "3", "9.66E-04", "260498", "0.235696"], ["Down", "IPP", "3", "4.83E-04", "255296", "0.199412"], ["Down", "ERG", "3", "0.001157", "1993680", "0.288401"], ["Down", "SLC9A7", "2", "4.83E-04", "102030", "0.189205"], ["Down", "KBTBD7", "2", "4.83E-04", "116108", "0.284029"], ["Down", "CARD14", "2", "2.67E-05", "3564", "0.219501"], ["Down", "ANKRD6", "2", "3.60E-07", "366", "0.212744"], ["Down", "ZFYVE1", "2", "4.83E-04", "123952", "0.234428"], ["Down", "LNX2", "1", "0", "0", "0.215132"], ["Down", "ATL1", "1", "0", "0", "0.148637"], ["Down", "LMO7", "1", "0", "0", "0.195467"]], "row_count": 285, "column_count": 6, "numeric_cells": 1200, "header_rows": 1, "locator": "section[15]/table-wrap[1]#Tab5"}}, {"id": "asset:table:pmid:33622336:11", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d8ef0fef2eda67da12aecce8eae9f69ea6ea6e6c9c6a06e311298cb5d1db1126", "bytes": 2258, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#Tab6", "version": null, "note": "miRNA - target gene and TF - target gene interaction", "structure": {"pmcid": "PMC7901211", "section_index": 20, "section_title": "Molecular docking studies", "row_count": 33, "column_count": 8}, "table": {"label": "Table 6", "caption": "miRNA - target gene and TF - target gene interaction", "rows": [["Regulation", "Target Genes", "Degree", "MicroRNA", "Regulation", "Target Genes", "Degree", "TF"], ["Up", "RPL13A", "97", "hsa-mir-8067", "Up", "RBX1", "15", "PER3"], ["Up", "RPS15A", "95", "hsa-mir-4518", "Up", "RPS15", "13", "CTCF"], ["Up", "RPLP0", "71", "hsa-mir-3685", "Up", "RPS20", "12", "E2F7"], ["Up", "ADCY6", "65", "hsa-mir-1202", "Up", "ADCY6", "11", "LMO2"], ["Up", "RPS29", "48", "hsa-mir-4461", "Up", "POLR2K", "9", "POLR2H"], ["Up", "RPL30", "47", "hsa-mir-6811-5p", "Up", "RPS15A", "8", "FOXF2"], ["Up", "RPL35", "44", "hsa-mir-2278", "Up", "RPL35", "8", "MYB"], ["Up", "RPS23", "40", "hsa-mir-4282", "Up", "RPS23", "5", "USF1"], ["Up", "SAA1", "33", "hsa-mir-4701-3p", "Up", "RPL13A", "5", "NFYA"], ["Up", "RPS5", "29", "hsa-mir-1301-3p", "Up", "RPS29", "5", "JUN"], ["Up", "RBX1", "29", "hsa-mir-5187-3p", "Up", "POLR2J", "5", "POLR2C"], ["Up", "RPS20", "26", "hsa-mir-708-5p", "Up", "RPL30", "4", "IRF7"], ["Up", "RPS15", "23", "hsa-mir-1260b", "Up", "RPLP0", "3", "SMAD3"], ["Up", "POLR2K", "13", "hsa-mir-5680", "Up", "RPS5", "3", "GABPA"], ["Up", "POLR2J", "9", "hsa-mir-129-2-3p", "Up", "SAA1", "2", "CEBPB"], ["Down", "CTNND1", "129", "hsa-mir-8082", "Up", "PHB2", "1", "PHB2"], ["Down", "ESR1", "98", "hsa-mir-4422", "Down", "ESR1", "122", "NCOA2"], ["Down", "NEDD4L", "76", "hsa-mir-548am-5p", "Down", "LCK", "21", "EBF1"], ["Down", "KNTC1", "62", "hsa-mir-6886-3p", "Down", "GLI3", "18", "SMAD2"], ["Down", "NGFR", "56", "hsa-mir-9500", "Down", "NEDD4L", "17", "JUND"], ["Down", "TIAM2", "49", "hsa-mir-3679-5p", "Down", "CALCR", "15", "FOXO3"], ["Down", "GLI3", "33", "hsa-mir-1913", "Down", "NGFR", "10", "POU2F1"], ["Down", "FASLG", "25", "hsa-mir-7849-3p", "Down", "FASLG", "8", "DAXX"], ["Down", "PLD1", "22", "hsa-mir-3200-3p", "Down", "CTNND1", "7", "GATA1"], ["Down", "OBSCN", "19", "hsa-mir-3657", "Down", "KNTC1", "5", "SP1"], ["Down", "CALCR", "12", "hsa-mir-4735-5p", "Down", "PLD1", "4", "E2F1"], ["Down", "PTGDR", "11", "hsa-mir-4477b", "Down", "TIAM2", "4", "FOXD1"], ["Down", "CCL28", "8", "hsa-mir-770-5p", "Down", "GLI2", "1", "GLI3"], ["Down", "LCK", "6", "hsa-mir-520c-3p", "Down", "ERG", "1", "ESR1"], ["Down", "S1PR5", "4", "hsa-mir-31-5p", "Down", "PTGDR", "1", "RORA"], ["", "", "", "", "Down", "CCL28", "1", "FOS"], ["", "", "", "", "Down", "OBSCN", "1", "CUX1"]], "row_count": 33, "column_count": 8, "numeric_cells": 110, "header_rows": 1, "locator": "section[20]/table-wrap[1]#Tab6"}}, {"id": "asset:table:pmid:33622336:12", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a781c090ad2161c4ec6bdf85b64aa485426af6284443a587ab55175b290cddae", "bytes": 865, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[2]#Tab7", "version": null, "note": "Docking results of standard drugs on overexpressed proteins", "structure": {"pmcid": "PMC7901211", "section_index": 20, "section_title": "Molecular docking studies", "row_count": 6, "column_count": 13}, "table": {"label": "Table 7", "caption": "Docking results of standard drugs on overexpressed proteins", "rows": [["Sl. No/ Code", "Over expressed gene: POLR2K", "Over expressed gene: RPS15", "Over expressed gene: RPS15 alpha", "Over expressed gene: SAA1"], ["PDB: 1LE9", "PDB: 3OW2", "PDB: 1G1X", "PDB: 4IP8"], ["Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar"], ["ETE", "8.019", "-0.755", "1.219", "8.223", "-1.768", "2.517", "8.260", "-0.857", "3.135", "9.943", "-1.689", "0.891"], ["LNG", "7.973", "-0.945", "1.295", "8.351", "-2.752", "3.465", "7.854", "-0.599", "2.373", "8.535", "-1.948", "0.057"], ["DSG", "8.273", "-1.124", "1.116", "5.674", "-1.611", "2.212", "7.745", "-1.046", "2.306", "8.158", "-1.997", "0.000"]], "row_count": 6, "column_count": 13, "numeric_cells": 42, "header_rows": 3, "locator": "section[20]/table-wrap[2]#Tab7"}}], "gaps": ["asset:data:geo:GSE84958 not downloaded", "asset:data:geo:GSE84958 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {"fdr_threshold": "with Benjamini–Hochberg false discovery rate correction"}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The limma [11] in R bioconductor package was used to analyze the DEGs between PCOS samples and normal control samples in the expression profiling by high throughput sequencing data of GSE84958. The adjusted P-value and [logFC] were calculated. The Benjamini & Hochberg false discovery rate method was used as a correction factor for the adjusted P-value in limma [12]."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "GO enrichment"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE84958"], "resolved_accessions": ["GSE84958"], "statements": ["The datasets supporting the conclusions of this article are available in the GEO (http://www.ncbi.nlm.nih.gov/geo) repository. [(GSE84958) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84958)]"], "basis": "The paper names GSE84958 in Gene Expression Omnibus (GEO) / NCBI-GEO and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33622336", "data:geo:GSE84958", "asset:table:pmid:33622336:1", "asset:table:pmid:33622336:2", "asset:table:pmid:33622336:3", "asset:table:pmid:33622336:4", "asset:table:pmid:33622336:5", "asset:table:pmid:33622336:6", "asset:table:pmid:33622336:7", "asset:table:pmid:33622336:8", "asset:table:pmid:33622336:9", "asset:table:pmid:33622336:10", "asset:table:pmid:33622336:11", "asset:table:pmid:33622336:12"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE84958"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:27:17Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 114629, "completion_tokens": 1360, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33622336", "type": "paper", "label": "pmid:33622336"}, {"id": "source:pmid:33622336", "type": "manuscript", "label": "PMID 33622336 full text"}, {"id": "data:geo:GSE84958", "type": "dataset", "label": "GEO GSE84958"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33622336", "type": "paper", "label": "pmid:33622336"}, {"id": "source:pmid:33622336", "type": "manuscript", "label": "PMID 33622336 full text"}, {"id": "data:geo:GSE84958", "type": "dataset", "label": "GEO GSE84958"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33622336", "type": "extraction", "used": ["source:pmid:33622336"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE84958", "type": "accession_resolution", "used": ["data:geo:GSE84958"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33622336", "parent_hash": "sha256:7257e1042b73f0eead91c201a87c80ec1abe714f6b0ebd5f3d47ae5b3bf0e8b1", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE84958 licence not read", "asset:data:geo:GSE84958 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The limma [11] in R bioconductor package was used to analyze the DEGs between PCOS samples and normal control samples in the expression profiling by high throughput sequencing data of GSE84958. The adjusted P-value and [logFC] were calculated. The Benjamini & Hochberg false discovery rate method was used as a correction factor for the adjusted P-value in limma [12]."], "order_basis": "analysis_only", "id": "assay:1"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-04T14:24:55+00:00","generated_at":"2026-11-05T02:18:40+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}