{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33827531", "kind": "science-record", "revision": 8, "content_hash": "sha256:fb9034e88552f15aab364d6c8e37cc0a2a93a1678cb9239407700573c4ee9698", "created_at": "2026-11-01T15:41:31Z", "updated_at": "2026-11-01T22:46:27Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of hub genes related to the progression of type 1 diabetes by computational analysis.", "doi": "10.1186/s12902-021-00709-6", "pmid": "33827531", "authors": ["G Prashanth", "Basavaraj Vastrad", "Anandkumar Tengli", "Chanabasayya Vastrad", "Iranna Kotturshetti"], "journal": "BMC endocrine disorders", "year": 2021, "abstract": "BACKGROUND: Type 1 diabetes (T1D) is a serious threat to childhood life and has fairly complicated pathogenesis. Profound attempts have been made to enlighten the pathogenesis, but the molecular mechanisms of T1D are still not well known.\nMETHODS: To identify the candidate genes in the progression of T1D, expression profiling by high throughput sequencing dataset GSE123658 was downloaded from Gene Expression Omnibus (GEO) database. The differentially expressed genes (DEGs) were identified, and gene ontology (GO) and pathway enrichment analyses were performed. The protein-protein interaction network (PPI), modules, target gene - miRNA regulatory network and target gene - TF regulatory network analysis were constructed and analyzed using HIPPIE, miRNet, NetworkAnalyst and Cytoscape. Finally, validation of hub genes was conducted by using ROC (Receiver operating characteristic) curve and RT-PCR analysis. A molecular docking study was performed.\nRESULTS: A total of 284 DEGs were identified, consisting of 142 up regulated genes and 142 down regulated genes. The gene ontology (GO) and pathways of the DEGs include cell-cell signaling, vesicle fusion, plasma membrane, signaling receptor activity, lipid binding, signaling by GPCR and innate immune system. Four hub genes were identified and biological process analysis revealed that these genes were mainly enriched in cell-cell signaling, cytokine signaling in immune system, signaling by GPCR and innate immune system. ROC curve and RT-PCR analysis showed that EGFR, GRIN2B, GJA1, CAP2, MIF, POLR2A, PRKACA, GABARAP, TLN1 and PXN might be involved in the advancement of T1D. Molecular docking studies showed high docking score.\nCONCLUSIONS: DEGs and hub genes identified in the present investigation help us understand the molecular mechanisms underlying the advancement of T1D, and provide candidate targets for diagnosis and treatment of T1D.", "claims": [{"id": "claim-method", "statement": "The identification of DEGs between 39 T1D patients’ samples and 43 healthy donors’ samples was performed using Limma package in R bioconductor.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33827531", "locator": "sections[4] \"Identification of DEGs\" paragraph 2", "quote": "The identification of DEGs between 39 T1D patients’ samples and 43 healthy donors’ samples was performed using Limma package in R bioconductor."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets supporting the conclusions of this article are available in the GEO (Gene Expression Omnibus) (https://www.ncbi.nlm.nih.gov/geo/) repository. [(GSE123658) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE123658)]", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33827531", "locator": "sections[23] \"Availability of data and materials\" paragraph 2", "quote": "The datasets supporting the conclusions of this article are available in the GEO (Gene Expression Omnibus) (https://www.ncbi.nlm.nih.gov/geo/) repository. [(GSE123658) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE123658)]"}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33827531"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE123658"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE123658"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33827531", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12902-021-00709-6", "sha256": "sha256:f5c5f50bd65aed4808a3bd8004605ef39aff5aa84f839dae9d945e8413eac27e", "bytes": 55148, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12902-021-00709-6", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8028841", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE123658", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE123658", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE123658", "version": null, "note": "The datasets supporting the conclusions of this article are available in the GEO (Gene Expression Omnibus) (https://www.ncbi.nlm.nih.gov/geo/) repository. [(GSE123658) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE123658)]", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets supporting the conclusions of this article are available in the GEO (Gene Expression Omnibus) (https://www.ncbi.nlm.nih.gov/geo/) repository. [(GSE123658) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE123658)]", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3509031", "GSM3509032", "GSM3509033", "GSM3509034", "GSM3509035", "GSM3509036", "GSM3509037", "GSM3509038", "GSM3509039", "GSM3509040", "GSM3509041", "GSM3509042", "GSM3509043", "GSM3509044", "GSM3509045", "GSM3509046", "GSM3509047", "GSM3509048", "GSM3509049", "GSM3509050", "GSM3509051", "GSM3509052", "GSM3509053", "GSM3509054", "GSM3509055", "GSM3509056", "GSM3509057", "GSM3509058", "GSM3509059", "GSM3509060", "GSM3509061", "GSM3509062", "GSM3509063", "GSM3509064", "GSM3509065", "GSM3509066", "GSM3509067", "GSM3509068", "GSM3509069", "GSM3509070", "GSM3509071", "GSM3509072", "GSM3509073", "GSM3509074", "GSM3509075", "GSM3509076", "GSM3509077", "GSM3509078", "GSM3509079", "GSM3509080", "GSM3509081", "GSM3509082", "GSM3509083", "GSM3509084", "GSM3509085", "GSM3509086", "GSM3509087", "GSM3509088", "GSM3509089", "GSM3509090", "GSM3509091", "GSM3509092", "GSM3509093", "GSM3509094", "GSM3509095", "GSM3509096", "GSM3509097", "GSM3509098", "GSM3509099", "GSM3509100", "GSM3509101", "GSM3509102", "GSM3509103", "GSM3509104", "GSM3509105", "GSM3509106", "GSM3509107", "GSM3509108", "GSM3509109", "GSM3509110", "GSM3509111", "GSM3509112"], "sample_count": 82, "group_sizes": null, "group_sizes_basis": null, "platform": "18573;20301", "taxon": "Homo sapiens", "title": "Transimmunom whole blood RNA-seq data  from type 1 diabetic patients and healthy volunteers", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33827531:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:01288106df1f7283fb78129885bf8b350967ffd439671430a6410e493adcddfa", "bytes": 96122, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#Tab2", "version": null, "note": "The statistical metrics for key differentially expressed genes (DEGs)", "structure": {"pmcid": "PMC8028841", "section_index": 4, "section_title": "Identification of DEGs", "row_count": 992, "column_count": 8}, "table": {"label": "Table 2", "caption": "The statistical metrics for key differentially expressed genes (DEGs)", "rows": [["GeneSymbol", "logFC", "p Value", "adj. P.Val", "t value", "Regulations", "GeneName"], ["ARMS2", "1.105122", "3.28E-07", "0.000198", "5.53328", "Up", "age-related maculopathy susceptibility 2"], ["PRSS46P", "1.005863", "1.59E-06", "0.000459", "5.153257", "Up", "serine protease 46, pseudogene"], ["MYH13", "1.03327", "1.64E-06", "0.00046", "5.144666", "Up", "myosin heavy chain 13"], ["RAD21L1", "1.367492", "2.87E-06", "0.000592", "5.007555", "Up", "RAD21 cohesin complex component like 1"], ["AS3MT", "1.172185", "2.97E-06", "0.000593", "4.998809", "Up", "arsenitemethyltransferase"], ["UPK1B", "1.142189", "4.25E-06", "0.000663", "4.909531", "Up", "uroplakin 1B"], ["CRHR2", "1.057435", "4.66E-06", "0.000686", "4.886267", "Up", "corticotropin releasing hormone receptor 2"], ["KRT20", "1.041956", "5.47E-06", "0.000738", "4.845569", "Up", "keratin 20"], ["CYP2F1", "0.996571", "5.49E-06", "0.000738", "4.844967", "Up", "cytochrome P450 family 2 subfamily F member 1"], ["TBX20", "0.915545", "6.65E-06", "0.000852", "4.796325", "Up", "T-box transcription factor 20"], ["TEX15", "1.040483", "6.7E-06", "0.000852", "4.794446", "Up", "testis expressed 15, meiosis and synapsis associated"], ["REN", "0.918655", "7.4E-06", "0.00091", "4.769059", "Up", "renin", ""], ["RDH8", "1.031642", "8.2E-06", "0.000925", "4.743027", "Up", "retinol dehydrogenase 8"], ["PADI3", "1.004196", "8.23E-06", "0.000925", "4.742198", "Up", "peptidyl arginine deiminase 3"], ["RIMS4", "1.005408", "8.44E-06", "0.000925", "4.735751", "Up", "regulating synaptic membrane exocytosis 4"], ["MS4A5", "0.988204", "8.45E-06", "0.000925", "4.735279", "Up", "membrane spanning 4-domains A5"], ["HFM1", "1.083591", "1.04E-05", "0.001038", "4.683383", "Up", "helicase for meiosis 1"], ["EGFR", "1.045618", "1.16E-05", "0.001078", "4.655195", "Up", "epidermal growth factor receptor"], ["C10orf113", "0.984302", "1.27E-05", "0.001122", "4.629975", "Up", "chromosome 10 open reading frame 113"], ["RGS4", "0.968679", "1.28E-05", "0.001122", "4.629106", "Up", "regulator of G protein signaling 4"], ["C2orf73", "0.965222", "1.29E-05", "0.001122", "4.626793", "Up", "chromosome 2 open reading frame 73"], ["ACSBG2", "1.181896", "1.27E-05", "0.001122", "4.631273", "Up", "acyl-CoA synthetasebubblegum family member 2"], ["BTBD18", "0.963267", "1.41E-05", "0.001181", "4.604073", "Up", "BTB domain containing 18"], ["DPPA5", "0.954617", "1.44E-05", "0.001195", "4.598614", "Up", "developmental pluripotency associated 5"], ["OR10J3", "0.985446", "1.56E-05", "0.001237", "4.578119", "Up", "olfactory receptor family 10 subfamily J member 3"], ["KCNK4", "1.033357", "1.57E-05", "0.001237", "4.575705", "Up", "potassium two pore domain channel subfamily K member 4"], ["LRAT", "0.925599", "1.61E-05", "0.001259", "4.568727", "Up", "lecithin retinol acyltransferase"], ["IL17B", "0.958598", "1.72E-05", "0.001302", "4.551641", "Up", "interleukin 17B"], ["FBXO10", "1.012141", "1.76E-05", "0.001319", "4.545579", "Up", "F-box protein 10"], ["LRRC74A", "0.894289", "1.78E-05", "0.001319", "4.54289", "Up", "leucine rich repeat containing 74A"], ["TM4SF5", "0.988935", "1.86E-05", "0.001335", "4.531217", "Up", "transmembrane 4 L six family member 5"], ["OR2T29", "0.956232", "1.89E-05", "0.001335", "4.527962", "Up", "olfactory receptor family 2 subfamily T member 29"], ["RNF180", "1.050934", "1.89E-05", "0.001335", "4.526775", "Up", "ring finger protein 180"], ["MYOT", "0.998153", "1.9E-05", "0.001335", "4.525922", "Up", "myotilin", ""], ["SLC22A25", "0.905085", "2.1E-05", "0.001407", "4.499193", "Up", "solute carrier family 22 member 25"], ["CMA1", "0.871927", "2.12E-05", "0.001407", "4.497403", "Up", "chymase 1"], ["PCDHB10", "1.017337", "2.14E-05", "0.001407", "4.494598", "Up", "protocadherin beta 10"], ["HRCT1", "0.931584", "2.16E-05", "0.001407", "4.492152", "Up", "histidine rich carboxyl terminus 1"], ["TRHR", "0.967196", "2.17E-05", "0.001407", "4.491435", "Up", "thyrotropin releasing hormone receptor"], ["NACA2", "1.235555", "2.15E-05", "0.001407", "4.494057", "Up", "nascent polypeptide associated complex subunit alpha 2"], ["CCL19", "1.05675", "2.17E-05", "0.001407", "4.490985", "Up", "C-C motif chemokine ligand 19"], ["DMRTA2", "0.919949", "2.31E-05", "0.001446", "4.474549", "Up", "DMRT like family A2"], ["NRAP", "0.970444", "2.42E-05", "0.001479", "4.46211", "Up", "nebulin related anchoring protein"], ["DNAH3", "0.948597", "2.46E-05", "0.001483", "4.458656", "Up", "dynein axonemal heavy chain 3"], ["CCL13", "1.008793", "2.46E-05", "0.001483", "4.458373", "Up", "C-C motif chemokine ligand 13"], ["OSR1", "0.99949", "2.47E-05", "0.001483", "4.456576", "Up", "odd-skipped related transcription factor 1"], ["TMEM145", "0.966024", "2.46E-05", "0.001483", "4.457613", "Up", "transmembrane protein 145"], ["AVP", "0.940076", "2.5E-05", "0.00149", "4.453465", "Up", "arginine vasopressin"], ["CSHL1", "0.84012", "2.55E-05", "0.001496", "4.44882", "Up", "chorionic somatomammotropin hormone like 1"], ["LHFPL3", "1.029874", "2.56E-05", "0.001497", "4.44723", "Up", "LHFPL tetraspan subfamily member 3"], ["SNAP91", "1.023292", "2.57E-05", "0.001497", "4.446795", "Up", "synaptosome associated protein 91"], ["SOX18", "1.029443", "2.6E-05", "0.001504", "4.44371", "Up", "SRY-box transcription factor 18"], ["CAP2", "1.0769", "2.63E-05", "0.001511", "4.440701", "Up", "cyclase associated actin cytoskeleton regulatory protein 2"], ["C1orf146", "0.912546", "2.69E-05", "0.001529", "4.434806", "Up", "chromosome 1 open reading frame 146"], ["PDE6C", "0.880944", "2.82E-05", "0.001574", "4.421773", "Up", "phosphodiesterase 6C"], ["CRYAA", "0.894932", "2.89E-05", "0.001596", "4.41523", "Up", "crystallin alpha A"], ["NR0B2", "0.903675", "2.9E-05", "0.001596", "4.414618", "Up", "nuclear receptor subfamily 0 group B member 2"], ["ANKRD30B", "0.953544", "2.93E-05", "0.001599", "4.411547", "Up", "ankyrin repeat domain 30B"], ["CST6", "0.946705", "3.04E-05", "0.001632", "4.401733", "Up", "cystatin E/M"], ["CAMK1G", "0.956887", "3.05E-05", "0.001632", "4.401395", "Up", "calcium/calmodulin dependent protein kinase IG"], ["CYP39A1", "0.879266", "3.08E-05", "0.001632", "4.399046", "Up", "cytochrome P450 family 39 subfamily A member 1"], ["ZNF214", "0.948008", "3.14E-05", "0.001653", "4.393435", "Up", "zinc finger protein 214"], ["MRGPRF", "0.936902", "3.18E-05", "0.001666", "4.390434", "Up", "MAS related GPR family member F"], ["PTPRT", "1.102577", "3.22E-05", "0.001674", "4.386782", "Up", "protein tyrosine phosphatase receptor type T"], ["KRT39", "1.081629", "3.21E-05", "0.001674", "4.387502", "Up", "keratin 39"], ["PHF21B", "0.897853", "3.26E-05", "0.001681", "4.383695", "Up", "PHD finger protein 21B"], ["ABRA", "0.967897", "3.26E-05", "0.001681", "4.383147", "Up", "actin binding Rho activating protein"], ["ADGRF4", "0.958187", "3.3E-05", "0.001693", "4.380467", "Up", "adhesion G protein-coupled receptor F4"], ["ABCC12", "0.932702", "3.35E-05", "0.001709", "4.376353", "Up", "ATP binding cassette subfamily C member 12"], ["SLC16A8", "0.908131", "3.38E-05", "0.001712", "4.374274", "Up", "solute carrier family 16 member 8"], ["ATP6V1G2-DDX39B", "0.990995", "3.4E-05", "0.001715", "4.372164", "Up", "ATP6V1G2-DDX39B readthrough (NMD candidate)"], ["LEMD1", "0.846889", "3.51E-05", "0.001738", "4.363856", "Up", "LEM domain containing 1"], ["KPNA7", "0.953213", "3.51E-05", "0.001738", "4.363815", "Up", "karyopherin subunit alpha 7"], ["MYH6", "0.952519", "3.56E-05", "0.001753", "4.359936", "Up", "myosin heavy chain 6"], ["FRMPD2", "0.957963", "3.68E-05", "0.001757", "4.351517", "Up", "FERM and PDZ domain containing 2"], ["SULT6B1", "0.965243", "3.69E-05", "0.001757", "4.350796", "Up", "sulfotransferase family 6B member 1"], ["HSD3B2", "0.933208", "3.7E-05", "0.001757", "4.3496", "Up", "hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2"], ["SULF1", "0.9309", "3.71E-05", "0.001757", "4.349307", "Up", "sulfatase 1"], ["G6PC", "1.038462", "3.71E-05", "0.001757", "4.349175", "Up", "glucose-6-phosphatase catalytic subunit"], ["MTRNR2L6", "1.015308", "3.72E-05", "0.001757", "4.348247", "Up", "MT-RNR2 like 6"], ["IZUMO1", "0.863468", "3.73E-05", "0.001757", "4.347643", "Up", "izumo sperm-egg fusion 1"], ["CFAP77", "0.854205", "3.75E-05", "0.001757", "4.346388", "Up", "cilia and flagella associated protein 77"], ["GPR37", "0.969013", "3.75E-05", "0.001757", "4.346128", "Up", "G protein-coupled receptor 37"], ["OR6C70", "0.996132", "3.78E-05", "0.001757", "4.344383", "Up", "olfactory receptor family 6 subfamily C member 70"], ["URGCP-MRPS24", "0.929538", "3.8E-05", "0.001759", "4.342672", "Up", "URGCP-MRPS24 readthrough"], ["SLC26A3", "0.912109", "3.84E-05", "0.001766", "4.33951", "Up", "solute carrier family 26 member 3"], ["ITGBL1", "0.89074", "3.88E-05", "0.001766", "4.337347", "Up", "integrin subunit beta like 1"], ["LOC102725072", "0.93312", "3.88E-05", "0.001766", "4.336863", "Up", "Putative uncharacterized protein DKFZp434K191"], ["BLACE", "0.837756", "3.94E-05", "0.001771", "4.332862", "Up", "B cell acute lymphoblastic leukemia expressed"], ["LOC100131496", "0.873058", "3.96E-05", "0.001771", "4.331895", "Up", "uncharacterized LOC100131496"], ["LIPF", "0.971728", "3.97E-05", "0.001771", "4.331252", "Up", "lipase F, gastric type"], ["FNDC8", "0.897073", "4E-05", "0.001771", "4.3287", "Up", "fibronectin type III domain containing 8"], ["LOC389199", "0.873159", "4.1E-05", "0.001785", "4.322016", "Up", "uncharacterized LOC389199"], ["OR2K2", "0.856644", "4.28E-05", "0.001834", "4.310597", "Up", "olfactory receptor family 2 subfamily K member 2"], ["FABP6", "0.940984", "4.31E-05", "0.001842", "4.308644", "Up", "fatty acid binding protein 6"], ["SPATA16", "0.946274", "4.37E-05", "0.001845", "4.305413", "Up", "spermatogenesis associated 16"], ["SMCO1", "1.042857", "4.36E-05", "0.001845", "4.305897", "Up", "single-pass membrane protein with coiled-coil domains 1"], ["PCDHB2", "1.169306", "4.41E-05", "0.001855", "4.302798", "Up", "protocadherin beta 2"], ["FAM243A", "0.902671", "4.49E-05", "0.001866", "4.29812", "Up", "family with sequence similarity 243 member A"], ["HOXB8", "0.886424", "4.51E-05", "0.001866", "4.296412", "Up", "homeobox B8"], ["LMO1", "0.892873", "4.53E-05", "0.00187", "4.29529", "Up", "LIM domain only 1"], ["MAS1L", "0.89613", "4.56E-05", "0.001876", "4.293436", "Up", "MAS1 proto-oncogene like, G protein-coupled receptor"], ["GLYATL3", "0.90734", "4.59E-05", "0.001876", "4.291841", "Up", "glycine-N-acyltransferase like 3"], ["UGT2A1", "0.870199", "4.69E-05", "0.001883", "4.286149", "Up", "UDP glucuronosyltransferase family 2 member A1 complex locus"], ["RERG", "0.939549", "4.69E-05", "0.001883", "4.286306", "Up", "RAS like estrogen regulated growth inhibitor"], ["CELA2A", "0.924629", "4.7E-05", "0.001883", "4.285588", "Up", "chymotrypsin like elastase 2A"], ["LRFN5", "0.946274", "4.8E-05", "0.001915", "4.279702", "Up", "leucine rich repeat and fibronectin type III domain containing 5"], ["PAX3", "0.826938", "4.83E-05", "0.001921", "4.27827", "Up", "paired box 3"], ["KIF1A", "0.973095", "4.86E-05", "0.001927", "4.276802", "Up", "kinesin family member 1A"], ["MRGPRE", "0.86341", "4.93E-05", "0.001952", "4.272623", "Up", "MAS related GPR family member E"], ["NPY", "0.877892", "4.99E-05", "0.001962", "4.269525", "Up", "neuropeptide Y"], ["EFS", "1.003465", "5E-05", "0.001962", "4.269001", "Up", "embryonal Fyn-associated substrate"], ["ZSCAN1", "0.921942", "5.02E-05", "0.001962", "4.26778", "Up", "zinc finger and SCAN domain containing 1"], ["MEIOB", "0.971239", "5.03E-05", "0.001962", "4.267016", "Up", "meiosis specific with OB-fold"], ["TMPRSS15", "0.884284", "5.02E-05", "0.001962", "4.267806", "Up", "transmembrane serine protease 15"], ["DRD2", "0.861436", "5.04E-05", "0.001962", "4.266826", "Up", "dopamine receptor D2"], ["CNMD", "0.959271", "5.05E-05", "0.001963", "4.266074", "Up", "chondromodulin"], ["AMBP", "0.883904", "5.08E-05", "0.001966", "4.264596", "Up", "alpha-1-microglobulin/bikunin precursor"], ["C8orf34", "0.874882", "5.16E-05", "0.00198", "4.260541", "Up", "chromosome 8 open reading frame 34"], ["EGR4", "0.93485", "5.19E-05", "0.001987", "4.25858", "Up", "early growth response 4"], ["LGALS7", "0.958985", "5.24E-05", "0.001987", "4.255983", "Up", "galectin 7", ""], ["INHA", "0.858348", "5.23E-05", "0.001987", "4.256562", "Up", "inhibin subunit alpha"], ["MNX1", "0.845332", "5.28E-05", "0.00199", "4.254289", "Up", "motor neuron and pancreas homeobox 1"], ["SLC10A1", "0.889098", "5.41E-05", "0.002017", "4.247721", "Up", "solute carrier family 10 member 1"], ["NPBWR1", "0.965049", "5.42E-05", "0.002017", "4.246995", "Up", "neuropeptides B and W receptor 1"], ["PMF1-BGLAP", "0.976467", "5.45E-05", "0.002025", "4.245385", "Up", "PMF1-BGLAP readthrough"], ["LHCGR", "0.897295", "5.57E-05", "0.002041", "4.239485", "Up", "luteinizing hormone/choriogonadotropin receptor"], ["NT5C1A", "0.86506", "5.59E-05", "0.002041", "4.238871", "Up", "5′-nucleotidase, cytosolic IA"], ["ASCL1", "0.918002", "5.6E-05", "0.002041", "4.238038", "Up", "achaete-scute family bHLH transcription factor 1"], ["CCDC140", "0.969595", "5.61E-05", "0.002041", "4.237583", "Up", "coiled-coil domain containing 140"], ["NEUROG3", "0.951564", "5.79E-05", "0.002073", "4.229287", "Up", "neurogenin 3"], ["TMC2", "1.236136", "5.62E-05", "0.002041", "4.237443", "Up", "transmembrane channel like 2"], ["MINDY4B", "1.034321", "5.81E-05", "0.002073", "4.228387", "Up", "MINDY family member 4B"], ["COL3A1", "0.899332", "5.86E-05", "0.002073", "4.226076", "Up", "collagen type III alpha 1 chain"], ["SLCO6A1", "0.920379", "5.89E-05", "0.002073", "4.224473", "Up", "solute carrier organic anion transporter family member 6A1"], ["THRSP", "0.891603", "5.93E-05", "0.002073", "4.222727", "Up", "thyroid hormone responsive"], ["DBX2", "0.883726", "5.93E-05", "0.002073", "4.222452", "Up", "developing brain homeobox 2"], ["OR52N5", "0.874656", "5.94E-05", "0.002073", "4.221942", "Up", "olfactory receptor family 52 subfamily N member 5"], ["ANO4", "0.891458", "5.95E-05", "0.002073", "4.22163", "Up", "anoctamin 4"], ["RPRML", "1.013736", "5.96E-05", "0.002073", "4.22104", "Up", "reprimo like"], ["LIPM", "0.857463", "5.97E-05", "0.002073", "4.220906", "Up", "lipase family member M"], ["EFCAB3", "0.930354", "5.98E-05", "0.002073", "4.220334", "Up", "EF-hand calcium binding domain 3"], ["LRRC2-AS1", "0.891603", "5.99E-05", "0.002073", "4.220002", "Up", "LRRC2 antisense RNA 1"], ["GJA1", "0.940111", "5.94E-05", "0.002073", "4.222116", "Up", "gap junction protein alpha 1"], ["OR51E1", "0.966601", "6.13E-05", "0.002103", "4.21374", "Up", "olfactory receptor family 51 subfamily E member 1"], ["ANP32D", "0.855187", "6.14E-05", "0.002103", "4.213256", "Up", "acidic nuclear phosphoprotein 32 family member D"], ["FMC1-LUC7L2", "0.914577", "6.21E-05", "0.002109", "4.21018", "Up", "FMC1-LUC7L2 readthrough"], ["PRLHR", "0.905404", "6.26E-05", "0.002114", "4.207869", "Up", "prolactin releasing hormone receptor"], ["PPFIA2", "0.962581", "6.28E-05", "0.002114", "4.206985", "Up", "PTPRF interacting protein alpha 2"], ["IRX5", "0.930915", "6.35E-05", "0.002124", "4.203899", "Up", "iroquoishomeobox 5"], ["CSRNP3", "0.893691", "6.37E-05", "0.002125", "4.20305", "Up", "cysteine and serine rich nuclear protein 3"], ["DAND5", "0.869683", "6.39E-05", "0.002125", "4.20215", "Up", "DAN domain BMP antagonist family member 5"], ["NKAIN4", "0.986106", "6.38E-05", "0.002125", "4.202648", "Up", "sodium/potassium transporting ATPase interacting 4"], ["TMPRSS11B", "0.859699", "6.45E-05", "0.002126", "4.19958", "Up", "transmembrane serine protease 11B"], ["GULP1", "0.98403", "6.48E-05", "0.002126", "4.198514", "Up", "GULP PTB domain containing engulfment adaptor 1"], ["ADGRL4", "0.967777", "6.53E-05", "0.002135", "4.196582", "Up", "adhesion G protein-coupled receptor L4"], ["HOXD8", "0.897017", "6.6E-05", "0.002143", "4.193495", "Up", "homeobox D8"], ["OR52N1", "0.839763", "6.66E-05", "0.002154", "4.191133", "Up", "olfactory receptor family 52 subfamily N member 1"], ["LINC01555", "0.897816", "6.66E-05", "0.002154", "4.190957", "Up", "long intergenic non-protein coding RNA 1555"], ["CA10", "1.011486", "6.89E-05", "0.002212", "4.181597", "Up", "carbonic anhydrase 10"], ["CYP2W1", "0.875193", "7.07E-05", "0.002224", "4.174858", "Up", "cytochrome P450 family 2 subfamily W member 1"], ["CCDC27", "0.885529", "7.08E-05", "0.002224", "4.174477", "Up", "coiled-coil domain containing 27"], ["MYH7", "0.885529", "7.08E-05", "0.002224", "4.174477", "Up", "myosin heavy chain 7"], ["GNAT1", "0.885529", "7.08E-05", "0.002224", "4.174477", "Up", "G protein subunit alpha transducin 1"], ["NPPC", "0.964362", "7.36E-05", "0.002263", "4.163694", "Up", "natriuretic peptide C"], ["CBLC", "0.891165", "7.5E-05", "0.002292", "4.158584", "Up", "Cbl proto-oncogene C"], ["TRIM55", "0.945582", "7.46E-05", "0.002284", "4.160085", "Up", "tripartite motif containing 55"], ["EEF1G", "0.83887", "7.57E-05", "0.002293", "4.155878", "Up", "eukaryotic translation elongation factor 1 gamma"], ["ADCYAP1R1", "0.896389", "7.58E-05", "0.002293", "4.155685", "Up", "ADCYAP receptor type I"], ["TAFA4", "0.838908", "7.58E-05", "0.002293", "4.155485", "Up", "TAFA chemokine like family member 4"], ["OVOL1", "0.884916", "7.57E-05", "0.002293", "4.156118", "Up", "ovo like transcriptional repressor 1"], ["EFEMP1", "0.913807", "7.67E-05", "0.002304", "4.152284", "Up", "EGF containing fibulin extracellular matrix protein 1"], ["SLC36A2", "0.897775", "7.69E-05", "0.002304", "4.151795", "Up", "solute carrier family 36 member 2"], ["SPINK13", "0.860333", "7.76E-05", "0.002322", "4.149133", "Up", "serine peptidase inhibitor, Kazal type 13 (putative)"], ["CCDC158", "0.832487", "7.97E-05", "0.002364", "4.141709", "Up", "coiled-coil domain containing 158"], ["RBAK-RBAKDN", "0.916027", "8.11E-05", "0.002396", "4.137123", "Up", "RBAK-RBAKDN readthrough"], ["CCL17", "0.896315", "8.25E-05", "0.002434", "4.132223", "Up", "C-C motif chemokine ligand 17"], ["SELE", "0.850167", "8.29E-05", "0.002443", "4.130829", "Up", "selectin E", ""], ["GOLGA6B", "0.9457", "8.37E-05", "0.002446", "4.128465", "Up", "golgin A6 family member B"], ["IGFL4", "0.850147", "8.44E-05", "0.002452", "4.125895", "Up", "IGF like family member 4"], ["CNTFR", "0.883786", "8.48E-05", "0.002457", "4.124845", "Up", "ciliaryneurotrophic factor receptor"], ["C1orf141", "0.949302", "8.51E-05", "0.00246", "4.123621", "Up", "chromosome 1 open reading frame 141"], ["NOS1", "0.932437", "8.63E-05", "0.002471", "4.119973", "Up", "nitric oxide synthase 1"], ["REG1B", "0.893055", "8.76E-05", "0.002495", "4.115883", "Up", "regenerating family member 1 beta"], ["CAPSL", "0.894376", "8.79E-05", "0.002501", "4.114845", "Up", "calcyphosine like"], ["C1QTNF7", "0.883655", "8.86E-05", "0.002513", "4.112561", "Up", "C1q and TNF related 7"], ["RHBDL2", "0.883638", "8.88E-05", "0.002513", "4.111975", "Up", "rhomboid like 2"], ["TEAD4", "0.893342", "8.91E-05", "0.002513", "4.111195", "Up", "TEA domain transcription factor 4"], ["PRRX1", "0.923623", "8.93E-05", "0.002513", "4.110382", "Up", "paired related homeobox 1"], ["SERPINB12", "0.833849", "8.95E-05", "0.002513", "4.109731", "Up", "serpin family B member 12"], ["TBX10", "0.833115", "9E-05", "0.002513", "4.108444", "Up", "T-box transcription factor 10"], ["COL6A5", "0.920311", "9.01E-05", "0.002513", "4.108069", "Up", "collagen type VI alpha 5 chain"], ["KLK4", "0.837318", "9.03E-05", "0.002513", "4.107393", "Up", "kallikrein related peptidase 4"], ["GRIN2B", "0.950071", "9.06E-05", "0.002513", "4.106573", "Up", "glutamate ionotropic receptor NMDA type subunit 2B"], ["RGS20", "0.900519", "9.07E-05", "0.002513", "4.106097", "Up", "regulator of G protein signaling 20"], ["ZNF728", "0.883605", "9.14E-05", "0.002515", "4.103954", "Up", "zinc finger protein 728"], ["SIX4", "0.85187", "9.18E-05", "0.002518", "4.102815", "Up", "SIX homeobox 4"], ["NPFFR2", "0.929088", "9.21E-05", "0.002521", "4.101991", "Up", "neuropeptide FF receptor 2"], ["ANKRD62", "0.899096", "9.23E-05", "0.002521", "4.101348", "Up", "ankyrin repeat domain 62"], ["CLLU1", "1.132069", "9.03E-05", "0.002513", "4.10742", "Up", "chronic lymphocytic leukemia up-regulated 1"], ["CNTNAP4", "0.914215", "9.32E-05", "0.002528", "4.09853", "Up", "contactin associated protein like 4"], ["COL12A1", "0.912316", "9.56E-05", "0.002587", "4.091597", "Up", "collagen type XII alpha 1 chain"], ["EBF3", "0.839069", "9.7E-05", "0.002604", "4.087742", "Up", "EBF transcription factor 3"], ["GRIA4", "0.979336", "9.8E-05", "0.002614", "4.084733", "Up", "glutamate ionotropic receptor AMPA type subunit 4"], ["PTHLH", "0.963725", "9.8E-05", "0.002614", "4.08484", "Up", "parathyroid hormone like hormone"], ["SLC9A2", "0.881992", "9.82E-05", "0.002614", "4.084262", "Up", "solute carrier family 9 member A2"], ["HEPHL1", "0.882607", "9.86E-05", "0.002619", "4.083035", "Up", "hephaestin like 1"], ["SCG3", "0.893171", "9.91E-05", "0.00262", "4.081758", "Up", "secretogranin III"], ["SIX1", "0.921197", "9.92E-05", "0.00262", "4.081507", "Up", "SIX homeobox 1"], ["TSPYL6", "0.891306", "9.97E-05", "0.002628", "4.07987", "Up", "TSPY like 6"], ["IRGC", "0.839346", "0.0001", "0.002634", "4.078065", "Up", "immunity related GTPase cinema"], ["GPR6", "0.930096", "0.000101", "0.00264", "4.076739", "Up", "G protein-coupled receptor 6"], ["SCN3B", "0.832646", "0.000101", "0.00264", "4.076478", "Up", "sodium voltage-gated channel beta subunit 3"], ["EMILIN3", "0.967257", "0.000102", "0.002653", "4.074049", "Up", "elastin microfibrilinterfacer 3"], ["EPN3", "0.914055", "0.000104", "0.002683", "4.068937", "Up", "epsin 3", ""], ["PDLIM4", "0.933994", "0.000104", "0.002683", "4.068455", "Up", "PDZ and LIM domain 4"], ["DCC", "1.037614", "0.000106", "0.002705", "4.06329", "Up", "DCC netrin 1 receptor"], ["IL9", "0.854817", "0.000107", "0.002723", "4.060443", "Up", "interleukin 9"], ["GRM5", "0.826169", "0.000108", "0.002744", "4.057559", "Up", "glutamate metabotropic receptor 5"], ["ODF3L2", "0.894219", "0.000108", "0.002744", "4.057227", "Up", "outer dense fiber of sperm tails 3 like 2"], ["C5orf60", "0.929657", "0.000113", "0.002843", "4.044374", "Up", "chromosome 5 open reading frame 60"], ["LRRC3B", "0.885916", "0.000114", "0.002843", "4.042437", "Up", "leucine rich repeat containing 3B"], ["NLRP14", "0.859959", "0.000114", "0.002843", "4.043418", "Up", "NLR family pyrin domain containing 14"], ["SLC25A51P4", "0.889805", "0.000117", "0.002902", "4.035322", "Up", "SLC25A51 pseudogene 4"], ["FOXD4L4", "0.839378", "0.00012", "0.002931", "4.028918", "Up", "forkhead box D4 like 4"], ["PGR", "0.831922", "0.00012", "0.002931", "4.028878", "Up", "progesterone receptor"], ["PRL", "1.125879", "0.000118", "0.002906", "4.034159", "Up", "prolactin", ""], ["C3orf79", "0.857368", "0.000121", "0.00294", "4.025807", "Up", "chromosome 3 open reading frame 79"], ["SERPIND1", "0.906509", "0.000121", "0.002937", "4.0271", "Up", "serpin family D member 1"], ["S100A7A", "0.847703", "0.000122", "0.002953", "4.023133", "Up", "S100 calcium binding protein A7A"], ["EN1", "0.9169", "0.000124", "0.002964", "4.018471", "Up", "engrailed homeobox 1"], ["KRT38", "1.042088", "0.000125", "0.002971", "4.016678", "Up", "keratin 38"], ["LINC02108", "0.846143", "0.000126", "0.002975", "4.014499", "Up", "long intergenic non-protein coding RNA 2108"], ["GPR158", "0.831736", "0.000126", "0.002975", "4.013975", "Up", "G protein-coupled receptor 158"], ["ACSM6", "0.908554", "0.000128", "0.002993", "4.011439", "Up", "acyl-CoA synthetase medium chain family member 6"], ["ASPA", "0.871659", "0.000129", "0.003", "4.007633", "Up", "aspartoacylase"], ["SH3GL2", "0.918924", "0.000132", "0.003024", "4.001385", "Up", "SH3 domain containing GRB2 like 2, endophilin A1"], ["HAO1", "0.826311", "0.000133", "0.00303", "4.000253", "Up", "hydroxyacid oxidase 1"], ["PDPN", "0.889264", "0.000134", "0.003031", "3.996743", "Up", "podoplanin"], ["CWH43", "0.839103", "0.000135", "0.003032", "3.996334", "Up", "cell wall biogenesis 43 C-terminal homolog"], ["OR6S1", "0.835524", "0.000135", "0.003042", "3.994961", "Up", "olfactory receptor family 6 subfamily S member 1"], ["OR51B4", "0.827743", "0.000137", "0.003053", "3.992138", "Up", "olfactory receptor family 51 subfamily B member 4"], ["NPBWR2", "0.868277", "0.000138", "0.003069", "3.989344", "Up", "neuropeptides B and W receptor 2"], ["THSD4", "0.846128", "0.000138", "0.003069", "3.988521", "Up", "thrombospondin type 1 domain containing 4"], ["ADAMTS9", "0.834461", "0.000139", "0.003069", "3.988039", "Up", "ADAM metallopeptidase with thrombospondin type 1 motif 9"], ["FOXQ1", "1.443796", "0.000136", "0.003044", "3.993401", "Up", "forkhead box Q1"], ["PLN", "0.949551", "0.000139", "0.00307", "3.986876", "Up", "phospholamban"], ["MAP3K19", "0.87061", "0.000141", "0.00309", "3.982479", "Up", "mitogen-activated protein kinase kinasekinase 19"], ["CSNK1A1L", "1.098186", "0.000141", "0.00309", "3.983183", "Up", "casein kinase 1 alpha 1 like"], ["BARX2", "0.902302", "0.000142", "0.003091", "3.981995", "Up", "BARX homeobox 2"], ["ISY1-RAB43", "0.930431", "0.000143", "0.003092", "3.980065", "Up", "ISY1-RAB43 readthrough"], ["NELL1", "0.869267", "0.000146", "0.003138", "3.972653", "Up", "neural EGFL like 1"], ["WT1", "0.833065", "0.000148", "0.003154", "3.968739", "Up", "WT1 transcription factor"], ["CTCFL", "0.834806", "0.000151", "0.003178", "3.963845", "Up", "CCCTC-binding factor like"], ["REG1A", "0.848322", "0.000151", "0.003178", "3.962989", "Up", "regenerating family member 1 alpha"], ["CELA2B", "0.861666", "0.000153", "0.003182", "3.960649", "Up", "chymotrypsin like elastase 2B"], ["PRELP", "0.854017", "0.000153", "0.003182", "3.960358", "Up", "proline and arginine rich end leucine rich repeat protein"], ["CNTN2", "0.848239", "0.000154", "0.003184", "3.958439", "Up", "contactin 2"], ["CRP", "0.836218", "0.000154", "0.003184", "3.958316", "Up", "C-reactive protein"], ["GGTLC2", "0.890003", "0.000157", "0.003207", "3.953599", "Up", "gamma-glutamyltransferase light chain 2"], ["FSD2", "0.856494", "0.000156", "0.003207", "3.953925", "Up", "fibronectin type III and SPRY domain containing 2"], ["MYH4", "0.862217", "0.000157", "0.003207", "3.953188", "Up", "myosin heavy chain 4"], ["TUBA3C", "0.881504", "0.00016", "0.003247", "3.947266", "Up", "tubulin alpha 3c"], ["HSD11B2", "0.865869", "0.000164", "0.003268", "3.941252", "Up", "hydroxysteroid 11-beta dehydrogenase 2"], ["MKRN2OS", "0.852903", "0.000164", "0.003273", "3.940266", "Up", "MKRN2 opposite strand"], ["SYT4", "0.859298", "0.000164", "0.003275", "3.939713", "Up", "synaptotagmin 4"], ["TM4SF20", "0.900136", "0.000167", "0.003292", "3.934626", "Up", "transmembrane 4 L six family member 20"], ["LRP2", "0.963595", "0.000167", "0.003292", "3.935053", "Up", "LDL receptor related protein 2"], ["ADAM7", "0.872506", "0.00017", "0.00331", "3.930757", "Up", "ADAM metallopeptidase domain 7"], ["GPR15", "0.902774", "0.000212", "0.003705", "3.867416", "Up", "G protein-coupled receptor 15"], ["SMTNL2", "0.867183", "0.000173", "0.00334", "3.92602", "Up", "smoothelin like 2"], ["APOH", "0.921926", "0.000173", "0.00334", "3.924941", "Up", "apolipoprotein H"], ["FCAMR", "0.946932", "0.000174", "0.003343", "3.924287", "Up", "Fc fragment of IgA and IgM receptor"], ["TRPA1", "0.914295", "0.000175", "0.003346", "3.922484", "Up", "transient receptor potential cation channel subfamily A member 1"], ["WIF1", "0.847809", "0.000176", "0.00336", "3.919958", "Up", "WNT inhibitory factor 1"], ["CLDN20", "0.883524", "0.000177", "0.003361", "3.919207", "Up", "claudin 20"], ["OPRM1", "0.913422", "0.000177", "0.003361", "3.919346", "Up", "opioid receptor mu 1"], ["CCDC198", "0.938346", "0.000177", "0.003364", "3.918639", "Up", "coiled-coil domain containing 198"], ["FREM3", "0.956335", "0.000182", "0.003437", "3.910621", "Up", "FRAS1 related extracellular matrix 3"], ["ANKRD18B", "1.013694", "0.000183", "0.003441", "3.908794", "Up", "ankyrin repeat domain 18B"], ["AMY1A", "0.94182", "0.000183", "0.003441", "3.908943", "Up", "amylase alpha 1A"], ["C2orf80", "0.907847", "0.000188", "0.003491", "3.902387", "Up", "chromosome 2 open reading frame 80"], ["SP9", "0.90324", "0.000188", "0.003492", "3.901414", "Up", "Sp9 transcription factor"], ["SLCO1C1", "0.9077", "0.000194", "0.003562", "3.89294", "Up", "solute carrier organic anion transporter family member 1C1"], ["RFX6", "0.897237", "0.000195", "0.003562", "3.891995", "Up", "regulatory factor X6"], ["MRO", "0.892061", "0.000195", "0.003563", "3.891612", "Up", "maestro", ""], ["THSD7B", "0.829227", "0.000196", "0.003567", "3.890001", "Up", "thrombospondin type 1 domain containing 7B"], ["C11orf44", "0.825633", "0.000197", "0.003573", "3.888583", "Up", "chromosome 11 open reading frame 44"], ["PDE11A", "0.882109", "0.0002", "0.003608", "3.88364", "Up", "phosphodiesterase 11A"], ["BTC", "0.842319", "0.000202", "0.003619", "3.881898", "Up", "betacellulin"], ["C14orf39", "0.852061", "0.000202", "0.003625", "3.881117", "Up", "chromosome 14 open reading frame 39"], ["KCNIP1", "0.831954", "0.000203", "0.003634", "3.879927", "Up", "potassium voltage-gated channel interacting protein 1"], ["DDC", "0.899141", "0.000205", "0.003655", "3.876928", "Up", "dopa decarboxylase"], ["KRTAP10–5", "0.83581", "0.000206", "0.003664", "3.875023", "Up", "keratin associated protein 10–5"], ["B3GALT1", "0.865828", "0.000207", "0.003672", "3.874106", "Up", "beta-1,3-galactosyltransferase 1"], ["KCNT2", "0.882533", "0.000209", "0.003692", "3.871085", "Up", "potassium sodium-activated channel subfamily T member 2"], ["OTOGL", "1.017886", "0.000211", "0.003705", "3.868493", "Up", "otogelin like"], ["ELAVL3", "0.837778", "0.000213", "0.00371", "3.86572", "Up", "ELAV like RNA binding protein 3"], ["CFHR1", "0.865906", "0.000214", "0.003716", "3.864405", "Up", "complement factor H related 1"], ["PLA2G5", "0.83062", "0.000216", "0.00373", "3.862104", "Up", "phospholipase A2 group V"], ["FOLH1", "0.917208", "0.000217", "0.003735", "3.861207", "Up", "folate hydrolase 1"], ["LPA", "0.875646", "0.000221", "0.003777", "3.856187", "Up", "lipoprotein(a)"], ["LOC100130449", "0.831124", "0.000221", "0.003777", "3.855362", "Up", "uncharacterized LOC100130449"], ["LINC00923", "0.918504", "0.000222", "0.003777", "3.854828", "Up", "long intergenic non-protein coding RNA 923"], ["TERB2", "0.876286", "0.000222", "0.003777", "3.854536", "Up", "telomere repeat binding bouquet formation protein 2"], ["HHIP", "0.825721", "0.000222", "0.003777", "3.854168", "Up", "hedgehog interacting protein"], ["DRGX", "0.842289", "0.000228", "0.003835", "3.846389", "Up", "dorsal root ganglia homeobox"], ["SERPINA9", "0.84755", "0.000228", "0.003835", "3.846199", "Up", "serpin family A member 9"], ["PRKAA2", "0.894063", "0.000233", "0.003871", "3.840763", "Up", "protein kinase AMP-activated catalytic subunit alpha 2"], ["MMP27", "0.867836", "0.000236", "0.003895", "3.837287", "Up", "matrix metallopeptidase 27"], ["NPNT", "0.90569", "0.000236", "0.003899", "3.836429", "Up", "nephronectin"], ["SLC51B", "0.839976", "0.000238", "0.003904", "3.834684", "Up", "solute carrier family 51 beta subunit"], ["C3orf80", "0.904281", "0.000236", "0.003895", "3.836993", "Up", "chromosome 3 open reading frame 80"], ["SOX2", "0.869644", "0.000238", "0.003904", "3.834656", "Up", "SRY-box transcription factor 2"], ["EYA1", "1.078018", "0.000237", "0.003901", "3.835456", "Up", "EYA transcriptional coactivator and phosphatase 1"], ["SI", "0.880135", "0.00024", "0.003926", "3.831805", "Up", "sucrase-isomaltase"], ["TIMP4", "0.90339", "0.000241", "0.00393", "3.83074", "Up", "TIMP metallopeptidase inhibitor 4"], ["LARP6", "0.890316", "0.00024", "0.003926", "3.831332", "Up", "La ribonucleoprotein 6, translational regulator"], ["MOGAT2", "0.833587", "0.000243", "0.003943", "3.828618", "Up", "monoacylglycerol O-acyltransferase 2"], ["OR1L3", "0.835533", "0.000243", "0.003943", "3.82828", "Up", "olfactory receptor family 1 subfamily L member 3"], ["CACNA1G", "0.912907", "0.000243", "0.003943", "3.828145", "Up", "calcium voltage-gated channel subunit alpha1 G"], ["CRX", "0.89157", "0.000243", "0.003944", "3.8278", "Up", "cone-rod homeobox"], ["PPP2R2C", "0.882852", "0.000247", "0.00397", "3.824007", "Up", "protein phosphatase 2 regulatory subunit Bgamma"], ["SLC30A3", "0.892961", "0.000248", "0.003978", "3.822534", "Up", "solute carrier family 30 member 3"], ["RHOJ", "0.860054", "0.000252", "0.004016", "3.81792", "Up", "ras homolog family member J"], ["KCNJ13", "0.853986", "0.000256", "0.004054", "3.813553", "Up", "potassium inwardly rectifying channel subfamily J member 13"], ["HAS2", "0.882356", "0.000257", "0.004062", "3.812592", "Up", "hyaluronan synthase 2"], ["KRTAP10–6", "0.879999", "0.000257", "0.004062", "3.811877", "Up", "keratin associated protein 10–6"], ["FFAR1", "0.88097", "0.000257", "0.004062", "3.812033", "Up", "free fatty acid receptor 1"], ["FGF6", "0.835818", "0.000259", "0.004077", "3.810292", "Up", "fibroblast growth factor 6"], ["OTX2", "1.0534", "0.000267", "0.004169", "3.800608", "Up", "orthodenticlehomeobox 2"], ["CLRN2", "0.823406", "0.000269", "0.004182", "3.798898", "Up", "clarin 2", ""], ["C19orf81", "0.847143", "0.000272", "0.004205", "3.795697", "Up", "chromosome 19 open reading frame 81"], ["NUPR2", "0.908781", "0.000272", "0.004205", "3.796129", "Up", "nuclear protein 2, transcriptional regulator"], ["CCN1", "0.860705", "0.000276", "0.00423", "3.791036", "Up", "cellular communication network factor 1"], ["HECW1", "0.933254", "0.000278", "0.004243", "3.789303", "Up", "HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1"], ["PTGER1", "0.840067", "0.000279", "0.004243", "3.788337", "Up", "prostaglandin E receptor 1"], ["CDH15", "0.86729", "0.00028", "0.004248", "3.787447", "Up", "cadherin 15"], ["CLVS2", "0.851515", "0.000281", "0.004253", "3.786814", "Up", "clavesin 2"], ["LY6G6F-LY6G6D", "0.856601", "0.000281", "0.004261", "3.78581", "Up", "LY6G6F-LY6G6D readthrough"], ["CYP4X1", "0.824815", "0.000288", "0.004307", "3.779012", "Up", "cytochrome P450 family 4 subfamily X member 1"], ["MYOG", "0.879018", "0.000289", "0.004307", "3.778098", "Up", "myogenin"], ["RFPL4AL1", "1.159429", "0.000295", "0.00436", "3.772636", "Up", "ret finger protein like 4A like 1"], ["LRRC8E", "0.830259", "0.0003", "0.004418", "3.767782", "Up", "leucine rich repeat containing 8 VRAC subunit E"], ["NXPE1", "0.860153", "0.000302", "0.004436", "3.765215", "Up", "neurexophilin and PC-esterase domain family member 1"], ["KIF25", "0.853635", "0.000304", "0.004441", "3.763906", "Up", "kinesin family member 25"], ["CBLN2", "0.966722", "0.000305", "0.004454", "3.762634", "Up", "cerebellin 2 precursor"], ["AREG", "0.901451", "0.000308", "0.004485", "3.759795", "Up", "amphiregulin"], ["SPATA8", "0.878422", "0.000311", "0.004508", "3.7569", "Up", "spermatogenesis associated 8"], ["GCGR", "0.86834", "0.000311", "0.004508", "3.756813", "Up", "glucagon receptor"], ["OR51E2", "1.003339", "0.000313", "0.004529", "3.754696", "Up", "olfactory receptor family 51 subfamily E member 2"], ["RPE65", "0.835844", "0.000315", "0.004549", "3.752653", "Up", "retinoid isomerohydrolase RPE65"], ["LAMA4", "0.925931", "0.000318", "0.004572", "3.750191", "Up", "laminin subunit alpha 4"], ["GABRA4", "0.9215", "0.000322", "0.004599", "3.747009", "Up", "gamma-aminobutyric acid type A receptor alpha4 subunit"], ["MFAP2", "0.972218", "0.000324", "0.004611", "3.74445", "Up", "microfibril associated protein 2"], ["WFDC5", "0.84266", "0.000328", "0.004639", "3.740917", "Up", "WAP four-disulfide core domain 5"], ["IGSF21", "0.851515", "0.000331", "0.004652", "3.738722", "Up", "immunoglobin superfamily member 21"], ["C17orf102", "0.839208", "0.000332", "0.004669", "3.737396", "Up", "chromosome 17 open reading frame 102"], ["A2ML1", "0.846661", "0.000334", "0.004675", "3.73642", "Up", "alpha-2-macroglobulin like 1"], ["PLA2G3", "0.828347", "0.000334", "0.004675", "3.73607", "Up", "phospholipase A2 group III"], ["C1orf229", "0.851752", "0.000335", "0.004681", "3.735201", "Up", "chromosome 1 open reading frame 229"], ["PLA2G10", "0.831528", "0.000345", "0.004783", "3.726918", "Up", "phospholipase A2 group X"], ["UTF1", "0.940212", "0.000346", "0.004796", "3.725564", "Up", "undifferentiated embryonic cell transcription factor 1"], ["CELF4", "0.871614", "0.00035", "0.004827", "3.722421", "Up", "CUGBP Elav-like family member 4"], ["BTBD16", "0.859346", "0.000354", "0.004868", "3.71863", "Up", "BTB domain containing 16"], ["TMPRSS12", "0.87545", "0.000356", "0.004868", "3.717707", "Up", "transmembrane serine protease 12"], ["SPRY4", "0.899144", "0.000369", "0.004997", "3.707011", "Up", "sprouty RTK signaling antagonist 4"], ["FUT6", "0.88066", "0.000369", "0.004997", "3.706933", "Up", "fucosyltransferase 6"], ["LINC01551", "0.87545", "0.000372", "0.005023", "3.704451", "Up", "long intergenic non-protein coding RNA 1551"], ["GNG12", "0.937701", "0.000372", "0.005023", "3.704226", "Up", "G protein subunit gamma 12"], ["RD3", "0.880776", "0.000374", "0.005038", "3.703076", "Up", "retinal degeneration 3, GUCY2D regulator"], ["DKK1", "0.950344", "0.000383", "0.005138", "3.695639", "Up", "dickkopf WNT signaling pathway inhibitor 1"], ["NUTM2F", "0.890116", "0.000384", "0.005147", "3.694933", "Up", "NUT family member 2F"], ["NPAP1", "0.841125", "0.000385", "0.00515", "3.694524", "Up", "nuclear pore associated protein 1"], ["PDE10A", "0.838498", "0.000402", "0.005283", "3.681647", "Up", "phosphodiesterase 10A"], ["BDKRB2", "0.859999", "0.000401", "0.005283", "3.681948", "Up", "bradykinin receptor B2"], ["HES5", "0.898473", "0.000404", "0.005292", "3.680429", "Up", "hes family bHLH transcription factor 5"], ["SCEL", "0.834584", "0.000413", "0.005347", "3.673264", "Up", "sciellin", ""], ["TMIGD1", "0.827595", "0.000413", "0.005347", "3.673264", "Up", "transmembrane and immunoglobulin domain containing 1"], ["PDE1A", "0.866557", "0.000413", "0.005347", "3.673886", "Up", "phosphodiesterase 1A"], ["GOLGA8G", "1.023375", "0.000419", "0.005389", "3.669375", "Up", "golgin A8 family member G"], ["C12orf77", "0.836295", "0.000436", "0.005501", "3.657361", "Up", "chromosome 12 open reading frame 77"], ["PRSS12", "0.917236", "0.000437", "0.005502", "3.65691", "Up", "serine protease 12"], ["RBM46", "0.951241", "0.000438", "0.005502", "3.6564", "Up", "RNA binding motif protein 46"], ["KRT78", "0.835349", "0.000439", "0.005502", "3.655735", "Up", "keratin 78"], ["TAC4", "0.866135", "0.00044", "0.005508", "3.654937", "Up", "tachykinin precursor 4"], ["KRBOX1", "0.865226", "0.000439", "0.005502", "3.655612", "Up", "KRAB box domain containing 1"], ["PERM1", "0.85926", "0.000442", "0.005508", "3.6534", "Up", "PPARGC1 and ESRR induced regulator, muscle 1"], ["CAPN9", "0.968118", "0.000455", "0.005612", "3.644617", "Up", "calpain 9", ""], ["MAS1", "0.874605", "0.000469", "0.005723", "3.635607", "Up", "MAS1 proto-oncogene, G protein-coupled receptor"], ["ALDOB", "0.840212", "0.000481", "0.005821", "3.628603", "Up", "aldolase, fructose-bisphosphate B"], ["FAM131C", "0.843355", "0.000483", "0.005829", "3.627366", "Up", "family with sequence similarity 131 member C"], ["FAM71D", "1.002051", "0.000482", "0.005825", "3.628064", "Up", "family with sequence similarity 71 member D"], ["TMEM72", "0.847662", "0.000505", "0.005976", "3.613798", "Up", "transmembrane protein 72"], ["GSX2", "0.884597", "0.000505", "0.005976", "3.613792", "Up", "GS homeobox 2"], ["RASA4B", "1.064804", "0.000499", "0.005946", "3.617563", "Up", "RAS p21 protein activator 4B"], ["HSPB2", "0.843999", "0.000508", "0.005984", "3.611888", "Up", "heat shock protein family B (small) member 2"], ["FSTL5", "0.877677", "0.000523", "0.006098", "3.603482", "Up", "follistatin like 5"], ["RAX2", "0.84501", "0.000525", "0.006112", "3.60243", "Up", "retina and anterior neural fold homeobox 2"], ["BCO1", "0.833952", "0.000536", "0.006202", "3.59581", "Up", "beta-carotene oxygenase 1"], ["GPR62", "0.86578", "0.000536", "0.006202", "3.595965", "Up", "G protein-coupled receptor 62"], ["CDH18", "0.829682", "0.00054", "0.006224", "3.593699", "Up", "cadherin 18"], ["HSPE1-MOB4", "0.902692", "0.000545", "0.006264", "3.590982", "Up", "HSPE1-MOB4 readthrough"], ["MEGF10", "0.828489", "0.000545", "0.006264", "3.590973", "Up", "multiple EGF like domains 10"], ["RASSF9", "0.833952", "0.000582", "0.006473", "3.571637", "Up", "Ras association domain family member 9"], ["PALM2AKAP2", "0.841084", "0.000608", "0.006683", "3.558351", "Up", "PALM2 and AKAP2 fusion"], ["ZFPM2", "0.83487", "0.000614", "0.00671", "3.555258", "Up", "zinc finger protein, FOG family member 2"], ["IL21", "0.872983", "0.00063", "0.006805", "3.547506", "Up", "interleukin 21"], ["TCHH", "0.913257", "0.000641", "0.006828", "3.542218", "Up", "trichohyalin"], ["DNAI1", "0.825247", "0.000645", "0.006844", "3.540376", "Up", "dynein axonemal intermediate chain 1"], ["LHX2", "0.825638", "0.000664", "0.006981", "3.531404", "Up", "LIM homeobox 2"], ["TCIM", "0.880336", "0.000669", "0.007015", "3.529277", "Up", "transcriptional and immune response regulator"], ["CHKB-CPT1B", "0.908843", "0.000671", "0.007024", "3.52834", "Up", "CHKB-CPT1B readthrough (NMD candidate)"], ["FAXC", "0.832545", "0.000693", "0.007167", "3.518441", "Up", "failed axon connections homolog, metaxin like GST domain containing"], ["SPECC1L-ADORA2A", "0.828726", "0.000728", "0.00737", "3.503843", "Up", "SPECC1L-ADORA2A readthrough (NMD candidate)"], ["DPP10", "0.834719", "0.000736", "0.007433", "3.500365", "Up", "dipeptidyl peptidase like 10"], ["AMER2", "0.854851", "0.000749", "0.00752", "3.494939", "Up", "APC membrane recruitment protein 2"], ["SPATA22", "1.255195", "0.000761", "0.007595", "3.490127", "Up", "spermatogenesis associated 22"], ["TMEM151A", "0.881109", "0.000781", "0.007713", "3.482345", "Up", "transmembrane protein 151A"], ["ATP1A4", "1.689421", "0.000778", "0.007691", "3.483567", "Up", "ATPase Na+/K+ transporting subunit alpha 4"], ["HOXB7", "0.989446", "0.000781", "0.007714", "3.482117", "Up", "homeobox B7"], ["CCDC169", "0.897611", "0.000815", "0.007946", "3.469141", "Up", "coiled-coil domain containing 169"], ["SPINK4", "0.843362", "0.000821", "0.007979", "3.466965", "Up", "serine peptidase inhibitor, Kazal type 4"], ["LKAAEAR1", "1.056911", "0.000821", "0.007979", "3.467037", "Up", "LKAAEAR motif containing 1"], ["BPIFC", "0.838473", "0.000822", "0.007982", "3.466596", "Up", "BPI fold containing family C"], ["EIF4E1B", "0.823457", "0.000847", "0.008124", "3.457562", "Up", "eukaryotic translation initiation factor 4E family member 1B"], ["COX8C", "0.823798", "0.000853", "0.008147", "3.455114", "Up", "cytochrome c oxidase subunit 8C"], ["MIF", "1.110365", "0.000941", "0.008696", "3.425057", "Up", "macrophage migration inhibitory factor"], ["LRRC71", "0.833583", "0.000886", "0.008347", "3.443592", "Up", "leucine rich repeat containing 71"], ["EPB41L4B", "1.108212", "0.000896", "0.008413", "3.440042", "Up", "erythrocyte membrane protein band 4.1 like 4B"], ["MYRIP", "0.847925", "0.000903", "0.008457", "3.437595", "Up", "myosin VIIA and Rab interacting protein"], ["CORO7-PAM16", "0.904171", "0.000939", "0.008696", "3.425726", "Up", "CORO7-PAM16 readthrough"], ["ZSWIM2", "0.880153", "0.000983", "0.008909", "3.411475", "Up", "zinc finger SWIM-type containing 2"], ["TPPP2", "0.85002", "0.000983", "0.008909", "3.411351", "Up", "tubulin polymerization promoting protein family member 2"], ["PTPN20", "0.978815", "0.000982", "0.008909", "3.411957", "Up", "protein tyrosine phosphatase non-receptor type 20"], ["CST8", "0.828046", "0.000998", "0.008992", "3.40695", "Up", "cystatin 8"], ["KCNH5", "0.840209", "0.001002", "0.009002", "3.405458", "Up", "potassium voltage-gated channel subfamily H member 5"], ["WFDC1", "0.88007", "0.001062", "0.009383", "3.387406", "Up", "WAP four-disulfide core domain 1"], ["OR3A1", "0.842916", "0.001063", "0.009383", "3.387314", "Up", "olfactory receptor family 3 subfamily A member 1 (gene/pseudogene)"], ["EXOC3L4", "0.847958", "0.001109", "0.009648", "3.374087", "Up", "exocyst complex component 3 like 4"], ["GHSR", "0.849126", "0.001113", "0.009673", "3.372795", "Up", "growth hormone secretagogue receptor"], ["GDA", "0.889672", "0.001119", "0.009709", "3.371151", "Up", "guanine deaminase"], ["SHISA8", "0.861981", "0.001118", "0.009704", "3.371469", "Up", "shisa family member 8"], ["ZSCAN10", "0.86053", "0.001192", "0.01015", "3.351508", "Up", "zinc finger and SCAN domain containing 10"], ["GDPD4", "0.825987", "0.001228", "0.010386", "3.342107", "Up", "glycerophosphodiesterphosphodiesterase domain containing 4"], ["C4orf48", "0.963154", "0.001242", "0.010457", "3.338544", "Up", "chromosome 4 open reading frame 48"], ["SPDEF", "0.881194", "0.001231", "0.010399", "3.341393", "Up", "SAM pointed domain containing ETS transcription factor"], ["PMCH", "0.938262", "0.001273", "0.010644", "3.330774", "Up", "pro-melanin concentrating hormone"], ["TMEM121", "1.161269", "0.001281", "0.010665", "3.328878", "Up", "transmembrane protein 121"], ["ESRP2", "0.86225", "0.001323", "0.010867", "3.318668", "Up", "epithelial splicing regulatory protein 2"], ["GOLGA6L9", "0.913468", "0.001369", "0.011101", "3.30796", "Up", "golgin A6 family like 9"], ["LRRTM2", "0.922665", "0.001414", "0.011348", "3.297763", "Up", "leucine rich repeat transmembrane neuronal 2"], ["RFX4", "0.831273", "0.001445", "0.011513", "3.290825", "Up", "regulatory factor X4"], ["FAP", "0.99642", "0.001437", "0.011476", "3.292583", "Up", "fibroblast activation protein alpha"], ["CTAGE6", "0.885238", "0.001484", "0.011748", "3.282458", "Up", "CTAGE family member 6"], ["GPC6", "0.897005", "0.001603", "0.012397", "3.257934", "Up", "glypican 6"], ["BOLA2B", "1.348547", "0.001587", "0.012335", "3.261001", "Up", "bolA family member 2B"], ["ANGPT4", "0.829222", "0.001678", "0.012731", "3.24332", "Up", "angiopoietin 4"], ["GLYATL1", "0.859167", "0.001744", "0.013066", "3.230845", "Up", "glycine-N-acyltransferase like 1"], ["ALPI", "0.83854", "0.001782", "0.013284", "3.223964", "Up", "alkaline phosphatase, intestinal"], ["LINC02312", "0.846436", "0.00182", "0.013468", "3.217256", "Up", "long intergenic non-protein coding RNA 2312"], ["MAGI1", "0.834329", "0.001979", "0.014332", "3.190204", "Up", "membrane associated guanylate kinase, WW and PDZ domain containing 1"], ["LOC105377590", "0.827061", "0.002067", "0.014767", "3.176133", "Up", "uncharacterized LOC105377590"], ["UGT2A3", "1.084825", "0.002072", "0.014775", "3.175415", "Up", "UDP glucuronosyltransferase family 2 member A3"], ["SEMA6B", "0.97473", "0.002148", "0.015121", "3.163707", "Up", "semaphorin 6B"], ["RFPL4A", "1.618683", "0.002173", "0.015241", "3.159916", "Up", "ret finger protein like 4A"], ["P2RX2", "0.823852", "0.002237", "0.015538", "3.150517", "Up", "purinergic receptor P2X 2"], ["COL1A2", "0.873234", "0.002262", "0.015671", "3.14683", "Up", "collagen type I alpha 2 chain"], ["CDKL2", "0.900439", "0.002301", "0.015857", "3.141203", "Up", "cyclin dependent kinase like 2"], ["CLUL1", "0.934087", "0.002373", "0.016257", "3.131195", "Up", "clusterin like 1"], ["MIPOL1", "0.862616", "0.002732", "0.017911", "3.084864", "Up", "mirror-image polydactyly 1"], ["PKNOX2", "0.859428", "0.002743", "0.017952", "3.083472", "Up", "PBX/knotted 1 homeobox 2"], ["TRHDE", "0.950234", "0.002983", "0.019018", "3.05568", "Up", "thyrotropin releasing hormone degrading enzyme"], ["BCAR1", "0.894146", "0.002995", "0.019072", "3.054351", "Up", "BCAR1 scaffold protein, Cas family member"], ["ZPLD1", "0.83027", "0.003108", "0.019559", "3.042048", "Up", "zonapellucida like domain containing 1"], ["ECM2", "0.881103", "0.003166", "0.019806", "3.035863", "Up", "extracellular matrix protein 2"], ["C8B", "0.83507", "0.003179", "0.019849", "3.034511", "Up", "complement C8 beta chain"], ["ZSCAN4", "0.824589", "0.003335", "0.020502", "3.018496", "Up", "zinc finger and SCAN domain containing 4"], ["DUSP15", "0.835463", "0.003583", "0.021602", "2.994384", "Up", "dual specificity phosphatase 15"], ["FSIP2", "1.051501", "0.003654", "0.021884", "2.987718", "Up", "fibrous sheath interacting protein 2"], ["GYPA", "0.838823", "0.003832", "0.022535", "2.971603", "Up", "glycophorin A (MNS blood group)"], ["MICU3", "0.836643", "0.004058", "0.023381", "2.952197", "Up", "mitochondrial calcium uptake family member 3"], ["ABCB5", "0.828852", "0.00415", "0.023751", "2.944524", "Up", "ATP binding cassette subfamily B member 5"], ["MTRNR2L1", "2.018372", "0.004535", "0.025279", "2.914228", "Up", "MT-RNR2 like 1"], ["TRAPPC5", "0.871477", "0.004667", "0.025812", "2.904327", "Up", "trafficking protein particle complex 5"], ["MYT1L", "1.20911", "0.004898", "0.026721", "2.88766", "Up", "myelin transcription factor 1 like"], ["DKK2", "0.89525", "0.005299", "0.028207", "2.860463", "Up", "dickkopf WNT signaling pathway inhibitor 2"], ["SRXN1", "1.018618", "0.005734", "0.029851", "2.832953", "Up", "sulfiredoxin 1"], ["HBZ", "1.056697", "0.005869", "0.030365", "2.824809", "Up", "hemoglobin subunit zeta"], ["GABRB3", "0.916767", "0.005973", "0.030651", "2.818616", "Up", "gamma-aminobutyric acid type A receptor beta3 subunit"], ["TDRD15", "0.860035", "0.006628", "0.033041", "2.781952", "Up", "tudor domain containing 15"], ["PDF", "0.908183", "0.00747", "0.036155", "2.739388", "Up", "peptide deformylase, mitochondrial"], ["CCDC144A", "1.387575", "0.007676", "0.036885", "2.729663", "Up", "coiled-coil domain containing 144A"], ["MRPL12", "1.043343", "0.011635", "0.049872", "2.57764", "Up", "mitochondrial ribosomal protein L12"], ["SIRPB2", "−0.47534", "8.44E-09", "4.63E-05", "−6.37763", "Down", "signal regulatory protein beta 2"], ["RNF122", "−0.40229", "1.36E-08", "4.63E-05", "−6.26932", "Down", "ring finger protein 122"], ["SYK", "−0.32942", "2.38E-08", "6.66E-05", "−6.1427", "Down", "spleen associated tyrosine kinase"], ["LASP1", "−0.39444", "7.15E-08", "0.000109", "−5.89021", "Down", "LIM and SH3 protein 1"], ["SLC44A2", "−0.3592", "1.09E-07", "0.000141", "−5.79236", "Down", "solute carrier family 44 member 2"], ["C5AR2", "−0.45692", "1.58E-07", "0.000165", "−5.70624", "Down", "complement component 5a receptor 2"], ["PRKACA", "−0.49178", "2.12E-07", "0.000197", "−5.63649", "Down", "protein kinase cAMP-activated catalytic subunit alpha"], ["TP53INP2", "−0.59653", "2.35E-07", "0.000198", "−5.61183", "Down", "tumor protein p53 inducible nuclear protein 2"], ["F11R", "−0.37662", "3.27E-07", "0.000198", "−5.53422", "Down", "F11 receptor"], ["INKA2", "−0.4438", "3.25E-07", "0.000198", "−5.5354", "Down", "inka box actin regulator 2"], ["GABARAP", "−0.49797", "3.53E-07", "0.000205", "−5.5156", "Down", "GABA type A receptor-associated protein"], ["CRTC2", "−0.48092", "3.66E-07", "0.000205", "−5.50724", "Down", "CREB regulated transcription coactivator 2"], ["RXRB", "−0.3761", "4.52E-07", "0.00023", "−5.45685", "Down", "retinoid X receptor beta"], ["CASP9", "−0.27139", "5.84E-07", "0.000258", "−5.39557", "Down", "caspase 9", ""], ["C6orf136", "−0.3863", "7.96E-07", "0.000297", "−5.321", "Down", "chromosome 6 open reading frame 136"], ["CTDSP2", "−0.32959", "7.48E-07", "0.000288", "−5.3362", "Down", "CTD small phosphatase 2"], ["DPEP2", "−0.41998", "7.56E-07", "0.000288", "−5.33349", "Down", "dipeptidase 2"], ["TMEM234", "−0.38446", "8.95E-07", "0.000313", "−5.29278", "Down", "transmembrane protein 234"], ["TMEM179B", "−0.27682", "9.14E-07", "0.000313", "−5.28769", "Down", "transmembrane protein 179B"], ["SNX11", "−0.32558", "9.47E-07", "0.000318", "−5.27902", "Down", "sorting nexin 11"], ["AGAP9", "−1.41788", "4.42E-07", "0.00023", "−5.46256", "Down", "ArfGAP with GTPase domain, ankyrin repeat and PH domain 9"], ["FAM219A", "−0.45019", "1.17E-06", "0.000376", "−5.22858", "Down", "family with sequence similarity 219 member A"], ["CSNK2B", "−0.29639", "1.41E-06", "0.00043", "−5.18303", "Down", "casein kinase 2 beta"], ["TMEM127", "−0.34378", "1.43E-06", "0.00043", "−5.1782", "Down", "transmembrane protein 127"], ["MEFV", "−0.52752", "1.62E-06", "0.00046", "−5.14816", "Down", "MEFV innate immuity regulator, pyrin"], ["KCTD21", "−0.31051", "1.92E-06", "0.000504", "−5.1065", "Down", "potassium channel tetramerization domain containing 21"], ["TMBIM1", "−0.32832", "1.86E-06", "0.0005", "−5.11415", "Down", "transmembrane BAX inhibitor motif containing 1"], ["IL17RA", "−0.4439", "1.99E-06", "0.000507", "−5.09788", "Down", "interleukin 17 receptor A"], ["RAB37", "−0.31838", "2.04E-06", "0.00051", "−5.09207", "Down", "RAB37, member RAS oncogene family"], ["GAB2", "−0.44824", "2.15E-06", "0.000532", "−5.07836", "Down", "GRB2 associated binding protein 2"], ["BLOC1S3", "−0.28757", "2.43E-06", "0.000544", "−5.04845", "Down", "biogenesis of lysosomal organelles complex 1 subunit 3"], ["APOL2", "−0.46372", "2.38E-06", "0.000544", "−5.05359", "Down", "apolipoprotein L2"], ["KIAA0319L", "−0.35586", "2.4E-06", "0.000544", "−5.05141", "Down", "KIAA0319 like"], ["SIPA1L1", "−0.37533", "2.84E-06", "0.000592", "−5.00972", "Down", "signal induced proliferation associated 1 like 1"], ["ARF3", "−0.39406", "2.86E-06", "0.000592", "−5.00779", "Down", "ADP ribosylation factor 3"], ["CASC3", "−0.28443", "2.89E-06", "0.000592", "−5.00572", "Down", "CASC3 exon junction complex subunit"], ["ARHGAP30", "−0.2905", "3.04E-06", "0.000593", "−4.99258", "Down", "Rho GTPase activating protein 30"], ["TOP3A", "−0.35048", "3.21E-06", "0.000593", "−4.97967", "Down", "DNA topoisomerase III alpha"], ["C16orf54", "−0.26747", "3.24E-06", "0.000593", "−4.97743", "Down", "chromosome 16 open reading frame 54"], ["BEST1", "−0.50351", "3.37E-06", "0.000593", "−4.96756", "Down", "bestrophin 1"], ["C6orf89", "−0.28041", "3.39E-06", "0.000593", "−4.96553", "Down", "chromosome 6 open reading frame 89"], ["SUSD6", "−0.37933", "3.37E-06", "0.000593", "−4.96707", "Down", "sushi domain containing 6"], ["STAT6", "−0.386", "3.46E-06", "0.000594", "−4.96042", "Down", "signal transducer and activator of transcription 6"], ["SH3D21", "−0.62962", "4.05E-06", "0.000648", "−4.92115", "Down", "SH3 domain containing 21"], ["FAM214B", "−0.36064", "3.72E-06", "0.000615", "−4.94269", "Down", "family with sequence similarity 214 member B"], ["AGPAT1", "−0.37351", "3.97E-06", "0.000641", "−4.92639", "Down", "1-acylglycerol-3-phosphate O-acyltransferase 1"], ["CPSF7", "−0.33791", "4.39E-06", "0.00067", "−4.90105", "Down", "cleavage and polyadenylation specific factor 7"], ["EGLN2", "−0.33487", "4.97E-06", "0.00072", "−4.86981", "Down", "egl-9 family hypoxia inducible factor 2"], ["VAMP2", "−0.32282", "5.23E-06", "0.000738", "−4.85729", "Down", "vesicle associated membrane protein 2"], ["ARHGAP1", "−0.46187", "5.32E-06", "0.000738", "−4.85289", "Down", "Rho GTPase activating protein 1"], ["CPT2", "−0.30399", "6.25E-06", "0.00082", "−4.81205", "Down", "carnitinepalmitoyltransferase 2"], ["OSCAR", "−0.4824", "7.26E-06", "0.000909", "−4.77404", "Down", "osteoclast associated Ig-like receptor"], ["EXTL3", "−0.44258", "7.37E-06", "0.00091", "−4.77025", "Down", "exostosin like glycosyltransferase 3"], ["NOMO2", "−0.58975", "8.27E-06", "0.000925", "−4.74093", "Down", "NODAL modulator 2"], ["PIK3R5", "−0.28302", "8.01E-06", "0.000925", "−4.74887", "Down", "phosphoinositide-3-kinase regulatory subunit 5"], ["IGF2R", "−0.52404", "8.21E-06", "0.000925", "−4.74277", "Down", "insulin like growth factor 2 receptor"], ["EPHX1", "−0.55423", "9.97E-06", "0.001014", "−4.6931", "Down", "epoxide hydrolase 1"], ["MAPKAPK2", "−0.29705", "8.55E-06", "0.000925", "−4.73251", "Down", "MAPK activated protein kinase 2"], ["STAT3", "−0.36483", "9.1E-06", "0.000967", "−4.71639", "Down", "signal transducer and activator of transcription 3"], ["NPIPB3", "−0.96437", "1.13E-05", "0.001075", "−4.66109", "Down", "nuclear pore complex interacting protein family member B3"], ["RNF19B", "−0.29623", "1.04E-05", "0.001038", "−4.681", "Down", "ring finger protein 19B"], ["PBX2", "−0.36625", "1.07E-05", "0.001047", "−4.67424", "Down", "PBX homeobox 2"], ["MTMR3", "−0.30993", "1.16E-05", "0.001078", "−4.65496", "Down", "myotubularin related protein 3"], ["PI4KB", "−0.32556", "1.17E-05", "0.001078", "−4.65218", "Down", "phosphatidylinositol 4-kinase beta"], ["GLYR1", "−0.33045", "1.23E-05", "0.001111", "−4.63863", "Down", "glyoxylatereductase 1 homolog"], ["TK2", "−0.30672", "1.33E-05", "0.001135", "−4.61837", "Down", "thymidine kinase 2"], ["RAF1", "−0.26209", "1.34E-05", "0.001139", "−4.61618", "Down", "Raf-1 proto-oncogene, serine/threonine kinase"], ["PPP1R10", "−0.32024", "1.44E-05", "0.001195", "−4.59736", "Down", "protein phosphatase 1 regulatory subunit 10"], ["ARRB2", "−0.26361", "1.45E-05", "0.001195", "−4.59727", "Down", "arrestin beta 2"], ["ATP6V0D1", "−0.39381", "1.45E-05", "0.001196", "−4.59576", "Down", "ATPase H+ transporting V0 subunit d1"], ["SMAP2", "−0.35835", "1.47E-05", "0.001201", "−4.59347", "Down", "small ArfGAP2"], ["KDELR1", "−0.34331", "1.53E-05", "0.001232", "−4.58193", "Down", "KDEL endoplasmic reticulum protein retention receptor 1"], ["ATP6V0A1", "−0.3471", "1.64E-05", "0.00127", "−4.5643", "Down", "ATPase H+ transporting V0 subunit a1"], ["NDST1", "−0.51316", "1.68E-05", "0.001284", "−4.55772", "Down", "N-deacetylase and N-sulfotransferase 1"], ["SF3A1", "−0.36624", "1.79E-05", "0.001319", "−4.54121", "Down", "splicing factor 3a subunit 1"], ["TPCN2", "−0.41036", "1.93E-05", "0.001352", "−4.52153", "Down", "two pore segment channel 2"], ["TAPBP", "−0.35224", "1.89E-05", "0.001335", "−4.52755", "Down", "TAP binding protein"], ["TRPC4AP", "−0.27784", "1.95E-05", "0.001354", "−4.51955", "Down", "transient receptor potential cation channel subfamily C member 4 associated protein"], ["NDE1", "−0.3477", "1.98E-05", "0.001369", "−4.51459", "Down", "nudE neurodevelopment protein 1"], ["PIGS", "−0.26132", "2.15E-05", "0.001407", "−4.49392", "Down", "phosphatidylinositol glycan anchor biosynthesis class S"], ["TIFAB", "−0.67622", "2.29E-05", "0.001441", "−4.47698", "Down", "TIFA inhibitor"], ["DGKG", "−0.35931", "2.61E-05", "0.001504", "−4.44284", "Down", "diacylglycerol kinase gamma"], ["CYTH2", "−0.27", "2.65E-05", "0.001515", "−4.43896", "Down", "cytohesin 2"], ["PDZD3", "−1.1876", "2.23E-05", "0.001411", "−4.48422", "Down", "PDZ domain containing 3"], ["PXN", "−0.40274", "2.8E-05", "0.00157", "−4.42421", "Down", "paxillin", ""], ["MOB3A", "−0.38776", "2.99E-05", "0.001621", "−4.40616", "Down", "MOB kinase activator 3A"], ["CHKB", "−0.69168", "3.78E-05", "0.001757", "−4.34418", "Down", "choline kinase beta"], ["TMEM121B", "−0.58616", "3.6E-05", "0.001757", "−4.35738", "Down", "transmembrane protein 121B"], ["PEAK3", "−0.64308", "3.86E-05", "0.001766", "−4.33852", "Down", "PEAK family member 3"], ["APOL1", "−0.43281", "3.39E-05", "0.001712", "−4.3734", "Down", "apolipoprotein L1"], ["IRF1", "−0.27784", "3.51E-05", "0.001738", "−4.36395", "Down", "interferon regulatory factor 1"], ["MINDY1", "−0.37272", "3.76E-05", "0.001757", "−4.34574", "Down", "MINDY lysine 48 deubiquitinase 1"], ["RNF24", "−0.38862", "3.8E-05", "0.001759", "−4.34233", "Down", "ring finger protein 24"], ["PRCC", "−0.26648", "4.35E-05", "0.001845", "−4.30641", "Down", "proline rich mitotic checkpoint control factor"], ["BORCS8", "−0.36271", "4.62E-05", "0.001879", "−4.28997", "Down", "BLOC-1 related complex subunit 8"], ["ITGA5", "−0.35353", "4.34E-05", "0.001845", "−4.30671", "Down", "integrin subunit alpha 5"], ["SMPD2", "−0.28647", "5.33E-05", "0.001995", "−4.25178", "Down", "sphingomyelinphosphodiesterase 2"], ["SMARCD1", "−0.33626", "5.11E-05", "0.001972", "−4.26291", "Down", "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1"], ["SIK3", "−0.26974", "5.36E-05", "0.002002", "−4.25023", "Down", "SIK family kinase 3"], ["C9orf129", "−1.18267", "5.01E-05", "0.001962", "−4.26853", "Down", "chromosome 9 open reading frame 129"], ["SCAMP5", "−0.60055", "7.19E-05", "0.00225", "−4.17021", "Down", "secretory carrier membrane protein 5"], ["IP6K1", "−0.32228", "5.67E-05", "0.002052", "−4.23471", "Down", "inositol hexakisphosphate kinase 1"], ["TRANK1", "−0.42013", "5.8E-05", "0.002073", "−4.22853", "Down", "tetratricopeptide repeat and ankyrin repeat containing 1"], ["PRR14L", "−0.29747", "6.19E-05", "0.002108", "−4.21102", "Down", "proline rich 14 like"], ["SETDB1", "−0.28227", "6.25E-05", "0.002114", "−4.20826", "Down", "SET domain bifurcated histone lysine methyltransferase 1"], ["ZNFX1", "−0.32602", "6.25E-05", "0.002114", "−4.20844", "Down", "zinc finger NFX1-type containing 1"], ["GSK3A", "−0.35215", "6.47E-05", "0.002126", "−4.19898", "Down", "glycogen synthase kinase 3 alpha"], ["GPSM3", "−0.38027", "6.28E-05", "0.002114", "−4.20685", "Down", "G protein signaling modulator 3"], ["CLN3", "−0.31966", "7.41E-05", "0.002275", "−4.16164", "Down", "CLN3 lysosomal/endosomaltransmembrane protein, battenin"], ["CYB561D1", "−0.30277", "7.06E-05", "0.002224", "−4.17511", "Down", "cytochrome b561 family member D1"], ["GBA2", "−0.26836", "7.06E-05", "0.002224", "−4.17523", "Down", "glucosylceramidase beta 2"], ["SEC14L1", "−0.31028", "7.06E-05", "0.002224", "−4.17493", "Down", "SEC14 like lipid binding 1"], ["KCTD2", "−0.28549", "7.52E-05", "0.002293", "−4.15781", "Down", "potassium channel tetramerization domain containing 2"], ["RGL3", "−0.75662", "8.74E-05", "0.002495", "−4.11629", "Down", "ral guanine nucleotide dissociation stimulator like 3"], ["DTX4", "−0.40937", "9.03E-05", "0.002513", "−4.1075", "Down", "deltex E3 ubiquitin ligase 4"], ["CLEC4C", "−0.88455", "0.000102", "0.002653", "−4.07383", "Down", "C-type lectin domain family 4 member C"], ["GTPBP1", "−0.41546", "8.09E-05", "0.002396", "−4.13758", "Down", "GTP binding protein 1"], ["RNF135", "−0.27712", "8.49E-05", "0.002457", "−4.12445", "Down", "ring finger protein 135"], ["ASF1B", "−0.45437", "9.24E-05", "0.002521", "−4.10114", "Down", "anti-silencing function 1B histone chaperone"], ["ARAP3", "−0.52053", "8.66E-05", "0.002477", "−4.11882", "Down", "ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3"], ["ST6GALNAC2", "−0.38956", "9.6E-05", "0.002588", "−4.09059", "Down", "ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 2"], ["VPS37C", "−0.3927", "0.000106", "0.002705", "−4.0635", "Down", "VPS37C subunit of ESCRT-I"], ["TNFRSF1B", "−0.32737", "9.6E-05", "0.002588", "−4.09033", "Down", "TNF receptor superfamily member 1B"], ["LY6G5B", "−0.41293", "0.000115", "0.002866", "−4.03965", "Down", "lymphocyte antigen 6 family member G5B"], ["PTAFR", "−0.29634", "9.8E-05", "0.002614", "−4.08471", "Down", "platelet activating factor receptor"], ["MYADM", "−0.41938", "0.000102", "0.00266", "−4.07268", "Down", "myeloid associated differentiation marker"], ["MBD6", "−0.55341", "0.000105", "0.002693", "−4.06584", "Down", "methyl-CpG binding domain protein 6"], ["RETREG2", "−0.2614", "0.000107", "0.002723", "−4.06108", "Down", "reticulophagy regulator family member 2"], ["LMBR1L", "−0.27058", "0.000114", "0.002843", "−4.04291", "Down", "limb development membrane protein 1 like"], ["BET1L", "−0.32294", "0.000118", "0.002909", "−4.03319", "Down", "Bet1 golgi vesicular membrane trafficking protein like"], ["SORT1", "−0.34943", "0.000117", "0.002904", "−4.03473", "Down", "sortilin 1", ""], ["MTF1", "−0.29397", "0.000123", "0.002957", "−4.02199", "Down", "metal regulatory transcription factor 1"], ["C19orf54", "−0.34173", "0.000147", "0.003138", "−3.97225", "Down", "chromosome 19 open reading frame 54"], ["CXCL16", "−0.35275", "0.000124", "0.002964", "−4.01814", "Down", "C-X-C motif chemokine ligand 16"], ["RUBCN", "−0.3292", "0.000126", "0.002975", "−4.01499", "Down", "rubicon autophagy regulator"], ["SNX27", "−0.26986", "0.000124", "0.002964", "−4.01952", "Down", "sorting nexin 27"], ["RAB11FIP1", "−0.29163", "0.000123", "0.002964", "−4.02057", "Down", "RAB11 family interacting protein 1"], ["LGALS9", "−0.3923", "0.000126", "0.002975", "−4.01527", "Down", "galectin 9", ""], ["PTPN18", "−0.27467", "0.000129", "0.003", "−4.00738", "Down", "protein tyrosine phosphatase non-receptor type 18"], ["SIRPA", "−0.2873", "0.00013", "0.003", "−4.00656", "Down", "signal regulatory protein alpha"], ["CHST15", "−0.27829", "0.000133", "0.003031", "−3.99914", "Down", "carbohydrate sulfotransferase 15"], ["UBN1", "−0.38058", "0.000134", "0.003031", "−3.99765", "Down", "ubinuclein 1"], ["NCOA6", "−0.32966", "0.000148", "0.003154", "−3.9687", "Down", "nuclear receptor coactivator 6"], ["ARSG", "−0.27821", "0.00017", "0.003316", "−3.92992", "Down", "arylsulfatase G"], ["EIF3CL", "−1.35741", "0.0002", "0.003608", "−3.88399", "Down", "eukaryotic translation initiation factor 3 subunit C like"], ["POLR2A", "−0.61547", "0.000153", "0.003182", "−3.96085", "Down", "RNA polymerase II subunit A"], ["AOC2", "−0.45479", "0.000182", "0.003432", "−3.91142", "Down", "amine oxidase copper containing 2"], ["NLRP12", "−0.34542", "0.00016", "0.003242", "−3.94814", "Down", "NLR family pyrin domain containing 12"], ["SEC24C", "−0.30954", "0.000158", "0.003221", "−3.95154", "Down", "SEC24 homolog C, COPII coat complex component"], ["KCNMB1", "−0.40521", "0.000212", "0.003705", "−3.86745", "Down", "potassium calcium-activated channel subfamily M regulatory beta subunit 1"], ["SLC48A1", "−0.36957", "0.000185", "0.003451", "−3.90712", "Down", "solute carrier family 48 member 1"], ["ZNF592", "−0.30397", "0.00016", "0.003247", "−3.94689", "Down", "zinc finger protein 592"], ["MEF2D", "−0.35897", "0.000165", "0.003278", "−3.93885", "Down", "myocyte enhancer factor 2D"], ["SLC25A44", "−0.26274", "0.000166", "0.003282", "−3.93716", "Down", "solute carrier family 25 member 44"], ["PPCDC", "−0.31808", "0.000179", "0.003395", "−3.91543", "Down", "phosphopantothenoylcysteine decarboxylase"], ["PLEKHO2", "−0.35445", "0.000175", "0.003346", "−3.92211", "Down", "pleckstrin homology domain containing O2"], ["PIGO", "−0.35859", "0.000198", "0.003586", "−3.88709", "Down", "phosphatidylinositol glycan anchor biosynthesis class O"], ["ZBTB22", "−0.28471", "0.000214", "0.00371", "−3.86516", "Down", "zinc finger and BTB domain containing 22"], ["ZSWIM1", "−0.29063", "0.000229", "0.003835", "−3.84574", "Down", "zinc finger SWIM-type containing 1"], ["DUSP18", "−0.46032", "0.000234", "0.003882", "−3.83938", "Down", "dual specificity phosphatase 18"], ["BAZ2A", "−0.41201", "0.000191", "0.003523", "−3.89726", "Down", "bromodomain adjacent to zinc finger domain 2A"], ["ARRB1", "−0.2686", "0.000196", "0.003567", "−3.89016", "Down", "arrestin beta 1"], ["SMG5", "−0.37995", "0.0002", "0.003608", "−3.88407", "Down", "SMG5 nonsense mediated mRNA decay factor"], ["DAP", "−0.26058", "0.000204", "0.003634", "−3.87917", "Down", "death associated protein"], ["RIMS3", "−0.50216", "0.000274", "0.004209", "−3.79409", "Down", "regulating synaptic membrane exocytosis 3"], ["WIPF2", "−0.31686", "0.000214", "0.00371", "−3.86514", "Down", "WAS/WASL interacting protein family member 2"], ["NSD1", "−0.3405", "0.000219", "0.003768", "−3.85773", "Down", "nuclear receptor binding SET domain protein 1"], ["VPS53", "−0.37707", "0.00024", "0.003926", "−3.83213", "Down", "VPS53 subunit of GARP complex"], ["RASGRP4", "−0.33615", "0.000225", "0.00382", "−3.85013", "Down", "RAS guanyl releasing protein 4"], ["FAM168A", "−0.26973", "0.000246", "0.003969", "−3.82519", "Down", "family with sequence similarity 168 member A"], ["ZBTB3", "−0.43164", "0.000328", "0.004639", "−3.74095", "Down", "zinc finger and BTB domain containing 3"], ["PHC2", "−0.37839", "0.000246", "0.003969", "−3.82531", "Down", "polyhomeotic homolog 2"], ["RGL2", "−0.40321", "0.000252", "0.004016", "−3.81807", "Down", "ral guanine nucleotide dissociation stimulator like 2"], ["SPINT1", "−0.42854", "0.00029", "0.004307", "−3.77766", "Down", "serine peptidase inhibitor, Kunitz type 1"], ["CBX7", "−0.28076", "0.000267", "0.004169", "−3.80078", "Down", "chromobox 7"], ["ADAM19", "−0.30366", "0.000284", "0.004279", "−3.78351", "Down", "ADAM metallopeptidase domain 19"], ["PRR16", "−0.99695", "0.000343", "0.004771", "−3.72824", "Down", "proline rich 16"], ["SP110", "−0.27632", "0.00029", "0.004307", "−3.77759", "Down", "SP110 nuclear body protein"], ["SIGLEC14", "−0.5177", "0.000302", "0.004436", "−3.76517", "Down", "sialic acid binding Ig like lectin 14"], ["RNPEP", "−0.35393", "0.000304", "0.004441", "−3.76372", "Down", "arginylaminopeptidase"], ["ABAT", "−0.30955", "0.000326", "0.004625", "−3.74264", "Down", "4-aminobutyrate aminotransferase"], ["ITGAX", "−0.51435", "0.000313", "0.004529", "−3.75521", "Down", "integrin subunit alpha X"], ["ARHGEF11", "−0.37753", "0.000329", "0.00464", "−3.73998", "Down", "Rho guanine nucleotide exchange factor 11"], ["SLC35F6", "−0.29772", "0.000368", "0.004997", "−3.70727", "Down", "solute carrier family 35 member F6"], ["ACP2", "−0.30411", "0.00039", "0.005185", "−3.69061", "Down", "acid phosphatase 2, lysosomal"], ["SYVN1", "−0.3935", "0.000362", "0.004927", "−3.71249", "Down", "synoviolin 1"], ["TMEM229B", "−0.33641", "0.000404", "0.005292", "−3.68022", "Down", "transmembrane protein 229B"], ["C7orf26", "−0.29812", "0.000413", "0.005347", "−3.67329", "Down", "chromosome 7 open reading frame 26"], ["ALKBH6", "−0.40327", "0.000526", "0.006123", "−3.6017", "Down", "alkB homolog 6"], ["MAST3", "−0.42877", "0.000386", "0.005167", "−3.69332", "Down", "microtubule associated serine/threonine kinase 3"], ["ADAR", "−0.28407", "0.000388", "0.005173", "−3.69224", "Down", "adenosine deaminase RNA specific"], ["MAP3K3", "−0.26552", "0.000395", "0.005231", "−3.68687", "Down", "mitogen-activated protein kinase kinasekinase 3"], ["MFSD14C", "−0.51982", "0.000578", "0.006457", "−3.57334", "Down", "major facilitator superfamily domain containing 14C"], ["PVR", "−0.35231", "0.000528", "0.006129", "−3.6006", "Down", "PVR cell adhesion molecule"], ["STIM1", "−0.32389", "0.000409", "0.005319", "−3.67666", "Down", "stromal interaction molecule 1"], ["STK35", "−0.26227", "0.000425", "0.005423", "−3.66486", "Down", "serine/threonine kinase 35"], ["PILRA", "−0.29576", "0.000415", "0.005359", "−3.67194", "Down", "paired immunoglobin like type 2 receptor alpha"], ["PRKCD", "−0.27159", "0.000419", "0.005389", "−3.66952", "Down", "protein kinase C delta"], ["PFKFB4", "−0.29916", "0.00043", "0.005461", "−3.6616", "Down", "6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4"], ["RAB3D", "−0.28769", "0.000427", "0.005423", "−3.6641", "Down", "RAB3D, member RAS oncogene family"], ["NAGK", "−0.26431", "0.000445", "0.005535", "−3.65121", "Down", "N-acetylglucosamine kinase"], ["RELL1", "−0.38387", "0.000562", "0.006383", "−3.58164", "Down", "RELT like 1"], ["LCNL1", "−1.04762", "0.000615", "0.006715", "−3.55463", "Down", "lipocalin like 1"], ["ASPRV1", "−0.51579", "0.000567", "0.006394", "−3.57928", "Down", "aspartic peptidase retroviral like 1"], ["TBC1D13", "−0.31201", "0.000496", "0.005933", "−3.61904", "Down", "TBC1 domain family member 13"], ["CANT1", "−0.26414", "0.000469", "0.005723", "−3.63568", "Down", "calcium activated nucleotidase 1"], ["GPR107", "−0.30509", "0.000479", "0.005804", "−3.62991", "Down", "G protein-coupled receptor 107"], ["ATXN1L", "−0.28945", "0.000492", "0.0059", "−3.62183", "Down", "ataxin 1 like"], ["CHST14", "−0.31667", "0.000614", "0.00671", "−3.55538", "Down", "carbohydrate sulfotransferase 14"], ["SIGLEC9", "−0.26149", "0.0005", "0.005946", "−3.61695", "Down", "sialic acid binding Ig like lectin 9"], ["FLCN", "−0.3041", "0.000527", "0.006129", "−3.60096", "Down", "folliculin", ""], ["WRAP53", "−0.28624", "0.000632", "0.006817", "−3.54662", "Down", "WD repeat containing antisense to TP53"], ["RIPK3", "−0.28326", "0.000527", "0.006129", "−3.60102", "Down", "receptor interacting serine/threonine kinase 3"], ["FAM53C", "−0.26774", "0.000505", "0.005976", "−3.61408", "Down", "family with sequence similarity 53 member C"], ["WDFY4", "−0.42866", "0.000513", "0.006018", "−3.60918", "Down", "WDFY family member 4"], ["GALNT6", "−0.30319", "0.000593", "0.006558", "−3.56589", "Down", "polypeptide N-acetylgalactosaminyltransferase 6"], ["IQCN", "−0.59607", "0.000676", "0.00706", "−3.52611", "Down", "IQ motif containing N"], ["KCNIP2", "−0.4831", "0.00077", "0.007639", "−3.48639", "Down", "potassium voltage-gated channel interacting protein 2"], ["USP22", "−0.28086", "0.000539", "0.006218", "−3.59461", "Down", "ubiquitin specific peptidase 22"], ["APOM", "−0.36363", "0.0008", "0.007857", "−3.47507", "Down", "apolipoprotein M"], ["MAFF", "−0.33734", "0.000758", "0.007573", "−3.49137", "Down", "MAF bZIP transcription factor F"], ["TNFAIP2", "−0.43598", "0.000547", "0.006267", "−3.58999", "Down", "TNF alpha induced protein 2"], ["CRISPLD2", "−0.44839", "0.000554", "0.006323", "−3.58616", "Down", "cysteine rich secretory protein LCCL domain containing 2"], ["SMURF1", "−0.28252", "0.000613", "0.006707", "−3.55597", "Down", "SMAD specific E3 ubiquitin protein ligase 1"], ["SLC35E2A", "−0.65437", "0.000832", "0.008038", "−3.46296", "Down", "solute carrier family 35 member E2A"], ["ADAMTSL4-AS1", "−0.62083", "0.00084", "0.008094", "−3.4601", "Down", "ADAMTSL4 antisense RNA 1"], ["C17orf49", "−0.35504", "0.000843", "0.008114", "−3.45892", "Down", "chromosome 17 open reading frame 49"], ["MAPK13", "−0.34929", "0.00064", "0.006828", "−3.54262", "Down", "mitogen-activated protein kinase 13"], ["MAPRE3", "−0.41136", "0.000774", "0.007663", "−3.48489", "Down", "microtubule associated protein RP/EB family member 3"], ["RIPOR1", "−0.45424", "0.000623", "0.00676", "−3.55065", "Down", "RHO family interacting cell polarization regulator 1"], ["EPS15L1", "−0.26529", "0.000638", "0.006823", "−3.54359", "Down", "epidermal growth factor receptor pathway substrate 15 like 1"], ["RERE", "−0.31584", "0.000638", "0.006823", "−3.5437", "Down", "arginine-glutamic acid dipeptide repeats"], ["DGLUCY", "−0.2802", "0.000649", "0.006868", "−3.53869", "Down", "D-glutamate cyclase"], ["CSF3R", "−0.37028", "0.000656", "0.006907", "−3.53531", "Down", "colony stimulating factor 3 receptor"], ["HCG27", "−0.41468", "0.000665", "0.006981", "−3.53133", "Down", "HLA complex group 27"], ["GNAI2", "−0.31016", "0.000678", "0.00706", "−3.52531", "Down", "G protein subunit alpha i2"], ["HSH2D", "−0.28176", "0.000684", "0.00711", "−3.52276", "Down", "hematopoietic SH2 domain containing"], ["KIAA0513", "−0.37074", "0.000709", "0.007246", "−3.5118", "Down", "KIAA0513", ""], ["SEMA4A", "−0.32944", "0.000725", "0.007356", "−3.50486", "Down", "semaphorin 4A"], ["PLBD2", "−0.42359", "0.000941", "0.008696", "−3.42516", "Down", "phospholipase B domain containing 2"], ["LRP10", "−0.35142", "0.000757", "0.007571", "−3.49174", "Down", "LDL receptor related protein 10"], ["GATAD2B", "−0.29403", "0.000784", "0.007727", "−3.48124", "Down", "GATA zinc finger domain containing 2B"], ["NICN1", "−0.31258", "0.000918", "0.008552", "−3.43258", "Down", "nicolin 1", ""], ["DIAPH1", "−0.31756", "0.000808", "0.007898", "−3.47192", "Down", "diaphanous related formin 1"], ["ITGAL", "−0.35006", "0.000857", "0.008169", "−3.45376", "Down", "integrin subunit alpha L"], ["ZNF784", "−0.32453", "0.001326", "0.010881", "−3.31793", "Down", "zinc finger protein 784"], ["ARHGAP9", "−0.32141", "0.000888", "0.00836", "−3.44285", "Down", "Rho GTPase activating protein 9"], ["WWP2", "−0.3584", "0.000901", "0.008438", "−3.43845", "Down", "WW domain containing E3 ubiquitin protein ligase 2"], ["MICALL1", "−0.44326", "0.001108", "0.009644", "−3.37439", "Down", "MICAL like 1"], ["TP53", "−0.28135", "0.000961", "0.008834", "−3.4185", "Down", "tumor protein p53"], ["WDTC1", "−0.41259", "0.000934", "0.008664", "−3.4274", "Down", "WD and tetratricopeptide repeats 1"], ["UBE2C", "−0.37342", "0.001447", "0.011521", "−3.29045", "Down", "ubiquitin conjugating enzyme E2 C"], ["ORAI2", "−0.26578", "0.000971", "0.008867", "−3.41533", "Down", "ORAI calcium release-activated calcium modulator 2"], ["TMEM63C", "−0.66345", "0.001471", "0.011659", "−3.28516", "Down", "transmembrane protein 63C"], ["NAPA", "−0.30533", "0.00099", "0.008953", "−3.40941", "Down", "NSF attachment protein alpha"], ["SCAMP2", "−0.27934", "0.000995", "0.008979", "−3.40775", "Down", "secretory carrier membrane protein 2"], ["PSAP", "−0.26071", "0.001008", "0.009037", "−3.40361", "Down", "prosaposin"], ["ZNF385A", "−0.44893", "0.001055", "0.009343", "−3.38947", "Down", "zinc finger protein 385A"], ["XPO6", "−0.28059", "0.001023", "0.009125", "−3.3991", "Down", "exportin 6"], ["TREML2", "−0.29456", "0.001038", "0.009222", "−3.39466", "Down", "triggering receptor expressed on myeloid cells like 2"], ["TMEM106A", "−0.35251", "0.001317", "0.010844", "−3.32008", "Down", "transmembrane protein 106A"], ["CNNM4", "−0.30466", "0.001368", "0.011101", "−3.30823", "Down", "cyclin and CBS domain divalent metal cation transport mediator 4"], ["ADA2", "−0.32201", "0.001086", "0.009543", "−3.38059", "Down", "adenosine deaminase 2"], ["MPEG1", "−0.26839", "0.001092", "0.009571", "−3.37885", "Down", "macrophage expressed 1"], ["SLC9A1", "−0.40045", "0.001164", "0.009954", "−3.3589", "Down", "solute carrier family 9 member A1"], ["INTS3", "−0.34455", "0.001156", "0.00991", "−3.36104", "Down", "integrator complex subunit 3"], ["APOBEC3D", "−0.30439", "0.001328", "0.010888", "−3.31758", "Down", "apolipoprotein B mRNA editing enzyme catalytic subunit 3D"], ["ZNF324", "−0.29262", "0.001606", "0.012416", "−3.2573", "Down", "zinc finger protein 324"], ["SIDT2", "−0.35226", "0.001217", "0.010314", "−3.34508", "Down", "SID1 transmembrane family member 2"], ["TMEM214", "−0.29447", "0.001256", "0.010538", "−3.33517", "Down", "transmembrane protein 214"], ["ZNF687", "−0.33153", "0.001277", "0.010659", "−3.32985", "Down", "zinc finger protein 687"], ["MFN2", "−0.28625", "0.001236", "0.01042", "−3.34017", "Down", "mitofusin 2"], ["RAB36", "−0.43526", "0.001925", "0.014054", "−3.19916", "Down", "RAB36, member RAS oncogene family"], ["PLPPR2", "−0.40458", "0.001273", "0.010644", "−3.33082", "Down", "phospholipid phosphatase related 2"], ["DYSF", "−0.45611", "0.00128", "0.010665", "−3.32913", "Down", "dysferlin", ""], ["FIZ1", "−0.28749", "0.001808", "0.013394", "−3.21933", "Down", "FLT3 interacting zinc finger 1"], ["STK10", "−0.26283", "0.001306", "0.010781", "−3.3227", "Down", "serine/threonine kinase 10"], ["MAML3", "−0.28886", "0.001556", "0.012181", "−3.26737", "Down", "mastermind like transcriptional coactivator 3"], ["KSR1", "−0.37381", "0.001394", "0.011257", "−3.30217", "Down", "kinase suppressor of ras 1"], ["TRIM62", "−0.30433", "0.001646", "0.012623", "−3.2494", "Down", "tripartite motif containing 62"], ["SESN2", "−0.3122", "0.00169", "0.012795", "−3.24092", "Down", "sestrin 2"], ["MARK2", "−0.31865", "0.00141", "0.011332", "−3.29873", "Down", "microtubule affinity regulating kinase 2"], ["CDIP1", "−0.31975", "0.00157", "0.012243", "−3.26456", "Down", "cell death inducing p53 target 1"], ["PAQR6", "−0.61509", "0.002215", "0.015442", "−3.15361", "Down", "progestin and adipoQ receptor family member 6"], ["PISD", "−0.27421", "0.001455", "0.011557", "−3.28858", "Down", "phosphatidylserine decarboxylase"], ["TNFSF12", "−0.28316", "0.001722", "0.012942", "−3.2349", "Down", "TNF superfamily member 12"], ["MAP11", "−0.31678", "0.001495", "0.011825", "−3.2801", "Down", "microtubule associated protein 11"], ["IQCE", "−0.31488", "0.001787", "0.013302", "−3.22309", "Down", "IQ motif containing E"], ["ADGRE5", "−0.39217", "0.001542", "0.012114", "−3.27021", "Down", "adhesion G protein-coupled receptor E5"], ["SCAP", "−0.32181", "0.001592", "0.012352", "−3.26013", "Down", "SREBF chaperone"], ["NECTIN1", "−0.4398", "0.002047", "0.014673", "−3.17924", "Down", "nectin cell adhesion molecule 1"], ["CDK5RAP3", "−0.34828", "0.001582", "0.01231", "−3.26209", "Down", "CDK5 regulatory subunit associated protein 3"], ["DAPK2", "−0.30512", "0.001699", "0.012832", "−3.23936", "Down", "death associated protein kinase 2"], ["PLAGL2", "−0.27659", "0.001719", "0.012929", "−3.23551", "Down", "PLAG1 like zinc finger 2"], ["ZDHHC18", "−0.29438", "0.001667", "0.012699", "−3.24539", "Down", "zinc finger DHHC-type containing 18"], ["CD4", "−0.29252", "0.001675", "0.012725", "−3.24392", "Down", "CD4 molecule"], ["ATG16L2", "−0.47049", "0.001688", "0.012792", "−3.24146", "Down", "autophagy related 16 like 2"], ["GBGT1", "−0.30319", "0.002212", "0.015431", "−3.15412", "Down", "globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (FORS blood group)"], ["SKIV2L", "−0.32579", "0.001807", "0.013394", "−3.2196", "Down", "Ski2 like RNA helicase"], ["TTC4", "−0.34101", "0.003031", "0.019228", "−3.05037", "Down", "tetratricopeptide repeat domain 4"], ["RAD54L2", "−0.37561", "0.002087", "0.014855", "−3.17303", "Down", "RAD54 like 2"], ["PI4K2A", "−0.26735", "0.00229", "0.015792", "−3.14278", "Down", "phosphatidylinositol 4-kinase type 2 alpha"], ["JAK3", "−0.30717", "0.001914", "0.013982", "−3.20098", "Down", "Janus kinase 3"], ["FLT3", "−0.35297", "0.002633", "0.017514", "−3.09708", "Down", "fms related tyrosine kinase 3"], ["RNF31", "−0.33297", "0.002109", "0.014969", "−3.16959", "Down", "ring finger protein 31"], ["POMZP3", "−0.4664", "0.002875", "0.018477", "−3.06791", "Down", "POM121 and ZP3 fusion"], ["LMTK2", "−0.26618", "0.002202", "0.015375", "−3.15558", "Down", "lemur tyrosine kinase 2"], ["AOC3", "−0.44883", "0.002455", "0.016657", "−3.12003", "Down", "amine oxidase copper containing 3"], ["FANCA", "−0.35504", "0.002422", "0.016499", "−3.12447", "Down", "FA complementation group A"], ["WBP2", "−0.31533", "0.002039", "0.014631", "−3.1806", "Down", "WW domain binding protein 2"], ["OGFOD2", "−0.38737", "0.003433", "0.020952", "−3.00876", "Down", "2-oxoglutarate and iron dependent oxygenase domain containing 2"], ["ITIH4", "−0.7173", "0.003584", "0.021602", "−2.99422", "Down", "inter-alpha-trypsin inhibitor heavy chain 4"], ["ITGAM", "−0.28014", "0.002099", "0.01493", "−3.17112", "Down", "integrin subunit alpha M"], ["CHD8", "−0.28304", "0.002143", "0.015097", "−3.16436", "Down", "chromodomain helicase DNA binding protein 8"], ["DENND1A", "−0.31755", "0.002347", "0.016118", "−3.13479", "Down", "DENN domain containing 1A"], ["TRIM41", "−0.26057", "0.00236", "0.016189", "−3.13294", "Down", "tripartite motif containing 41"], ["NLRP1", "−0.3423", "0.002242", "0.01557", "−3.14971", "Down", "NLR family pyrin domain containing 1"], ["MMP25", "−0.48039", "0.002249", "0.01561", "−3.1487", "Down", "matrix metallopeptidase 25"], ["POPDC2", "−0.32941", "0.003559", "0.021496", "−2.99664", "Down", "popeye domain containing 2"], ["CPNE9", "−0.66459", "0.003856", "0.022604", "−2.96956", "Down", "copine family member 9"], ["LAG3", "−0.46043", "0.003252", "0.020199", "−3.02693", "Down", "lymphocyte activating 3"], ["NDRG2", "−0.27747", "0.003018", "0.019177", "−3.05186", "Down", "NDRG family member 2"], ["INPP5B", "−0.31274", "0.002511", "0.016952", "−3.11262", "Down", "inositol polyphosphate-5-phosphatase B"], ["BMF", "−0.26451", "0.002523", "0.017008", "−3.11107", "Down", "Bcl2 modifying factor"], ["INPP5D", "−0.26393", "0.002376", "0.016265", "−3.13076", "Down", "inositol polyphosphate-5-phosphatase D"], ["PAPLN", "−0.52955", "0.004162", "0.023765", "−2.94356", "Down", "papilin, proteoglycan like sulfated glycoprotein"], ["SLC27A3", "−0.31556", "0.002609", "0.017417", "−3.10008", "Down", "solute carrier family 27 member 3"], ["XKR8", "−0.26542", "0.002565", "0.017192", "−3.10567", "Down", "XK related 8"], ["DOP1B", "−0.26995", "0.002714", "0.017839", "−3.08698", "Down", "DOP1 leucine zipper like protein B"], ["GMIP", "−0.3929", "0.002527", "0.017026", "−3.11057", "Down", "GEM interacting protein"], ["PNKD", "−0.29826", "0.002802", "0.018154", "−3.07643", "Down", "PNKD metallo-beta-lactamase domain containing"], ["ZNF264", "−0.26952", "0.003525", "0.021391", "−2.99983", "Down", "zinc finger protein 264"], ["PLXNA2", "−0.4063", "0.003836", "0.022539", "−2.97125", "Down", "plexin A2"], ["TAF8", "−0.30568", "0.00284", "0.018306", "−3.07201", "Down", "TATA-box binding protein associated factor 8"], ["GYS1", "−0.30134", "0.002951", "0.018854", "−3.05932", "Down", "glycogen synthase 1"], ["SLC1A4", "−0.36474", "0.003534", "0.021412", "−2.99901", "Down", "solute carrier family 1 member 4"], ["SLC15A3", "−0.28569", "0.002848", "0.01835", "−3.07109", "Down", "solute carrier family 15 member 3"], ["TLE3", "−0.32824", "0.002748", "0.017961", "−3.08292", "Down", "TLE family member 3, transcriptional corepressor"], ["SLC16A5", "−0.31497", "0.003097", "0.01951", "−3.04325", "Down", "solute carrier family 16 member 5"], ["OGDH", "−0.32269", "0.002818", "0.018207", "−3.07457", "Down", "oxoglutarate dehydrogenase"], ["RTN1", "−0.33417", "0.003191", "0.019886", "−3.03327", "Down", "reticulon 1"], ["THBS3", "−0.34867", "0.003237", "0.020126", "−3.0284", "Down", "thrombospondin 3"], ["BCL3", "−0.36376", "0.003035", "0.019247", "−3.04991", "Down", "BCL3 transcription coactivator"], ["ADCY4", "−0.36448", "0.003609", "0.021672", "−2.99194", "Down", "adenylatecyclase 4"], ["ZNF530", "−0.32785", "0.004519", "0.025209", "−2.91541", "Down", "zinc finger protein 530"], ["ZMYND15", "−0.48374", "0.004583", "0.02545", "−2.9106", "Down", "zinc finger MYND-type containing 15"], ["AMY1B", "−0.72088", "0.005292", "0.028186", "−2.86091", "Down", "amylase alpha 1B"], ["ZNF417", "−0.30434", "0.003838", "0.022543", "−2.97107", "Down", "zinc finger protein 417"], ["GTF2IRD2", "−0.3548", "0.004795", "0.02631", "−2.89503", "Down", "GTF2I repeat domain containing 2"], ["PRSS21", "−0.78843", "0.005521", "0.02903", "−2.84617", "Down", "serine protease 21"], ["CADM4", "−0.3036", "0.005273", "0.028121", "−2.86213", "Down", "cell adhesion molecule 4"], ["HIP1", "−0.45352", "0.003301", "0.020406", "−3.02192", "Down", "huntingtin interacting protein 1"], ["STIMATE-MUSTN1", "−0.54123", "0.005515", "0.029012", "−2.8465", "Down", "STIMATE-MUSTN1 readthrough"], ["KCTD11", "−0.2781", "0.004312", "0.024369", "−2.93148", "Down", "potassium channel tetramerization domain containing 11"], ["ZNF70", "−0.57012", "0.005544", "0.029142", "−2.84472", "Down", "zinc finger protein 70"], ["HIVEP3", "−0.39006", "0.004369", "0.024627", "−2.92696", "Down", "HIVEP zinc finger 3"], ["LOC100129697", "−0.60899", "0.005981", "0.030664", "−2.81815", "Down", "uncharacterized LOC100129697"], ["CIITA", "−0.43886", "0.003378", "0.020711", "−3.01412", "Down", "class II major histocompatibility complex transactivator"], ["EPOR", "−0.27146", "0.004472", "0.025006", "−2.91898", "Down", "erythropoietin receptor"], ["SHISA4", "−0.64173", "0.005489", "0.028917", "−2.84818", "Down", "shisa family member 4"], ["STIMATE", "−0.30689", "0.006148", "0.031273", "−2.80846", "Down", "STIM activating enhancer"], ["ADAT1", "−0.27445", "0.004127", "0.023668", "−2.94646", "Down", "adenosine deaminasetRNA specific 1"], ["TTLL11", "−0.30463", "0.006288", "0.031761", "−2.80055", "Down", "tubulin tyrosine ligase like 11"], ["H6PD", "−0.40411", "0.00368", "0.021976", "−2.9853", "Down", "hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase"], ["RAPGEFL1", "−0.46135", "0.004927", "0.02685", "−2.88567", "Down", "Rap guanine nucleotide exchange factor like 1"], ["TMEM63B", "−0.31929", "0.004159", "0.023761", "−2.94384", "Down", "transmembrane protein 63B"], ["PSPN", "−0.32479", "0.006167", "0.031326", "−2.80738", "Down", "persephin"], ["HLA-DQA1", "−1.05471", "0.004016", "0.023213", "−2.95571", "Down", "major histocompatibility complex, class II, DQ alpha 1"], ["TRAPPC9", "−0.31907", "0.004124", "0.023668", "−2.94672", "Down", "trafficking protein particle complex 9"], ["CCNJL", "−0.30896", "0.00384", "0.022544", "−2.97093", "Down", "cyclin J like"], ["MAP1A", "−0.48755", "0.005854", "0.030316", "−2.8257", "Down", "microtubule associated protein 1A"], ["PPP1R12B", "−0.32586", "0.003774", "0.022328", "−2.9768", "Down", "protein phosphatase 1 regulatory subunit 12B"], ["DNMBP", "−0.36414", "0.004698", "0.025936", "−2.9021", "Down", "dynamin binding protein"], ["CLEC17A", "−0.48511", "0.005274", "0.028121", "−2.86207", "Down", "C-type lectin domain containing 17A"], ["PACS1", "−0.35178", "0.003745", "0.022242", "−2.97938", "Down", "phosphofurin acidic cluster sorting protein 1"], ["TRIM25", "−0.26502", "0.00377", "0.022316", "−2.97712", "Down", "tripartite motif containing 25"], ["DSP", "−1.74666", "0.007097", "0.034701", "−2.75765", "Down", "desmoplakin"], ["PHF7", "−0.33686", "0.006229", "0.031548", "−2.80388", "Down", "PHD finger protein 7"], ["ADGRG3", "−0.36957", "0.003871", "0.022639", "−2.96821", "Down", "adhesion G protein-coupled receptor G3"], ["SULT1A2", "−0.76588", "0.007036", "0.034482", "−2.76074", "Down", "sulfotransferase family 1A member 2"], ["SPIB", "−0.38425", "0.004951", "0.026919", "−2.884", "Down", "Spi-B transcription factor"], ["DRICH1", "−0.66714", "0.007466", "0.036148", "−2.73956", "Down", "aspartate rich 1"], ["ZNF445", "−0.34371", "0.004446", "0.024908", "−2.921", "Down", "zinc finger protein 445"], ["USP19", "−0.27666", "0.004041", "0.023332", "−2.95362", "Down", "ubiquitin specific peptidase 19"], ["STK36", "−0.29142", "0.005018", "0.027206", "−2.87931", "Down", "serine/threonine kinase 36"], ["CDKN2A", "−0.69258", "0.007729", "0.037039", "−2.72716", "Down", "cyclin dependent kinase inhibitor 2A"], ["METTL7A", "−0.27873", "0.004291", "0.024292", "−2.93314", "Down", "methyltransferase like 7A"], ["TTLL3", "−0.40446", "0.004358", "0.024578", "−2.92787", "Down", "tubulin tyrosine ligase like 3"], ["C19orf84", "−0.73685", "0.007933", "0.037785", "−2.71782", "Down", "chromosome 19 open reading frame 84"], ["ARHGAP31", "−0.30623", "0.005156", "0.02773", "−2.86992", "Down", "Rho GTPase activating protein 31"], ["C2CD2L", "−0.26804", "0.004428", "0.024824", "−2.9224", "Down", "C2CD2 like"], ["PLEKHG3", "−0.35043", "0.00427", "0.024204", "−2.93484", "Down", "pleckstrin homology and RhoGEF domain containing G3"], ["GBF1", "−0.35336", "0.004328", "0.02444", "−2.93017", "Down", "golgibrefeldin A resistant guanine nucleotide exchange factor 1"], ["SLC6A16", "−0.36797", "0.006412", "0.032156", "−2.79366", "Down", "solute carrier family 6 member 16"], ["VARS2", "−0.38504", "0.005076", "0.027413", "−2.87536", "Down", "valyl-tRNAsynthetase 2, mitochondrial"], ["PLEKHM1", "−0.31734", "0.004414", "0.024784", "−2.92345", "Down", "pleckstrin homology and RUN domain containing M1"], ["SMIM34A", "−0.72037", "0.008217", "0.038787", "−2.70514", "Down", "small integral membrane protein 34A"], ["MARK4", "−0.3283", "0.005433", "0.028678", "−2.85174", "Down", "microtubule affinity regulating kinase 4"], ["SLC38A7", "−0.28303", "0.005751", "0.029924", "−2.83191", "Down", "solute carrier family 38 member 7"], ["SLC25A35", "−0.2993", "0.006192", "0.031428", "−2.80596", "Down", "solute carrier family 25 member 35"], ["VAT1", "−0.27067", "0.004901", "0.026728", "−2.88746", "Down", "vesicle amine transport 1"], ["C15orf39", "−0.40438", "0.004391", "0.024697", "−2.92529", "Down", "chromosome 15 open reading frame 39"], ["NF2", "−0.28694", "0.005349", "0.028401", "−2.8572", "Down", "neurofibromin 2"], ["BSCL2", "−0.26614", "0.007512", "0.036312", "−2.73739", "Down", "BSCL2 lipid droplet biogenesis associated, seipin"], ["VDR", "−0.2684", "0.005304", "0.028225", "−2.86013", "Down", "vitamin D receptor"], ["PADI4", "−0.44486", "0.004656", "0.025758", "−2.90517", "Down", "peptidyl arginine deiminase 4"], ["ABCG1", "−0.29576", "0.005169", "0.027735", "−2.86904", "Down", "ATP binding cassette subfamily G member 1"], ["ABTB2", "−0.44053", "0.008044", "0.038142", "−2.71281", "Down", "ankyrin repeat and BTB domain containing 2"], ["SLC16A13", "−0.28493", "0.007676", "0.036885", "−2.72966", "Down", "solute carrier family 16 member 13"], ["FHOD1", "−0.31983", "0.00504", "0.027298", "−2.87781", "Down", "formin homology 2 domain containing 1"], ["ARID1A", "−0.31182", "0.004979", "0.027052", "−2.88206", "Down", "AT-rich interaction domain 1A"], ["GPR157", "−0.33012", "0.007318", "0.03555", "−2.74675", "Down", "G protein-coupled receptor 157"], ["DAAM2", "−1.17025", "0.008639", "0.040251", "−2.68706", "Down", "dishevelled associated activator of morphogenesis 2"], ["INCA1", "−0.60309", "0.009868", "0.04423", "−2.63853", "Down", "inhibitor of CDK, cyclin A1 interacting protein 1"], ["TIGD3", "−0.368", "0.006217", "0.031506", "−2.80456", "Down", "tigger transposable element derived 3"], ["ENTPD2", "−0.85818", "0.009711", "0.043759", "−2.64442", "Down", "ectonucleoside triphosphate diphosphohydrolase 2"], ["ARHGEF5", "−0.39012", "0.009339", "0.042517", "−2.6587", "Down", "Rho guanine nucleotide exchange factor 5"], ["PLD2", "−0.28888", "0.005989", "0.030695", "−2.81768", "Down", "phospholipase D2"], ["POLR1A", "−0.3791", "0.006226", "0.031544", "−2.80404", "Down", "RNA polymerase I subunit A"], ["KIAA0556", "−0.31343", "0.005811", "0.030142", "−2.82826", "Down", "KIAA0556", ""], ["RAP1GAP2", "−0.32685", "0.005276", "0.028122", "−2.86195", "Down", "RAP1 GTPase activating protein 2"], ["ADD1", "−0.26923", "0.005269", "0.02812", "−2.86242", "Down", "adducin 1"], ["EHBP1L1", "−0.35615", "0.005468", "0.028814", "−2.84954", "Down", "EH domain binding protein 1 like 1"], ["FAM160A1", "−0.7446", "0.010863", "0.047396", "−2.60316", "Down", "family with sequence similarity 160 member A1"], ["SOGA1", "−0.42952", "0.007824", "0.037374", "−2.72278", "Down", "suppressor of glucose, autophagy associated 1"], ["TNFRSF21", "−0.61534", "0.01054", "0.046315", "−2.61431", "Down", "TNF receptor superfamily member 21"], ["NFAM1", "−0.29308", "0.005706", "0.029771", "−2.83465", "Down", "NFAT activating protein with ITAM motif 1"], ["CNOT3", "−0.30586", "0.005959", "0.030608", "−2.81943", "Down", "CCR4-NOT transcription complex subunit 3"], ["RSKR", "−0.56514", "0.010578", "0.046421", "−2.61296", "Down", "ribosomal protein S6 kinase related"], ["PLXNA4", "−0.50001", "0.010531", "0.04631", "−2.61461", "Down", "plexin A4"], ["CNTROB", "−0.29089", "0.006896", "0.033945", "−2.76788", "Down", "centrobin, centriole duplication and spindle assembly protein"], ["TBC1D10B", "−0.26939", "0.006094", "0.031079", "−2.81158", "Down", "TBC1 domain family member 10B"], ["NOXRED1", "−0.34558", "0.011102", "0.048163", "−2.59509", "Down", "NADP dependent oxidoreductase domain containing 1"], ["HYOU1", "−0.30667", "0.006028", "0.030859", "−2.81539", "Down", "hypoxia up-regulated 1"], ["SUPT5H", "−0.27837", "0.005938", "0.030542", "−2.82067", "Down", "SPT5 homolog, DSIF elongation factor subunit"], ["CLPB", "−0.26559", "0.008773", "0.040714", "−2.68144", "Down", "ClpB homolog, mitochondrial AAA ATPase chaperonin"], ["SIGLEC5", "−0.30815", "0.006387", "0.032082", "−2.79502", "Down", "sialic acid binding Ig like lectin 5"], ["NCR1", "−0.46793", "0.008972", "0.041383", "−2.67332", "Down", "natural cytotoxicity triggering receptor 1"], ["LRRC20", "−0.28981", "0.010509", "0.046236", "−2.6154", "Down", "leucine rich repeat containing 20"], ["MAP7D1", "−0.30089", "0.006066", "0.030993", "−2.81322", "Down", "MAP7 domain containing 1"], ["GHRL", "−0.28653", "0.008139", "0.038516", "−2.70858", "Down", "ghrelin and obestatinprepropeptide"], ["KDM6B", "−0.4334", "0.006275", "0.031734", "−2.80128", "Down", "lysine demethylase 6B"], ["CCDC17", "−0.32392", "0.009183", "0.041985", "−2.66487", "Down", "coiled-coil domain containing 17"], ["U2AF1L4", "−0.26211", "0.008081", "0.038264", "−2.71116", "Down", "U2 small nuclear RNA auxiliary factor 1 like 4"], ["CEACAM4", "−0.30283", "0.006663", "0.033138", "−2.78007", "Down", "CEA cell adhesion molecule 4"], ["TNS3", "−0.28418", "0.007707", "0.036969", "−2.72819", "Down", "tensin 3"], ["ADAP2", "−0.27485", "0.00825", "0.038875", "−2.70371", "Down", "ArfGAP with dual PH domains 2"], ["NLRX1", "−0.2759", "0.007971", "0.037933", "−2.71612", "Down", "NLR family member X1"], ["RABL2A", "−0.30042", "0.009208", "0.042068", "−2.66386", "Down", "RAB, member of RAS oncogene family like 2A"], ["PROSER3", "−0.47732", "0.009247", "0.042198", "−2.66234", "Down", "proline and serine rich 3"], ["MIDN", "−0.29956", "0.006943", "0.034146", "−2.76547", "Down", "midnolin"], ["DENND4B", "−0.31441", "0.006859", "0.033811", "−2.76981", "Down", "DENN domain containing 4B"], ["SORBS3", "−0.40358", "0.00832", "0.039149", "−2.70067", "Down", "sorbin and SH3 domain containing 3"], ["PLB1", "−0.36701", "0.007831", "0.037384", "−2.72248", "Down", "phospholipase B1"], ["DPEP3", "−0.34095", "0.009581", "0.043304", "−2.64937", "Down", "dipeptidase 3"], ["SEMA4B", "−0.31138", "0.007518", "0.036312", "−2.73711", "Down", "semaphorin 4B"], ["WASF2", "−0.28093", "0.007388", "0.035832", "−2.74331", "Down", "WASP family member 2"], ["NUCB1", "−0.34217", "0.007574", "0.036492", "−2.73442", "Down", "nucleobindin 1"], ["SH3BP2", "−0.28179", "0.007608", "0.036623", "−2.73283", "Down", "SH3 domain binding protein 2"], ["P2RX5", "−0.37743", "0.008788", "0.040771", "−2.68084", "Down", "purinergic receptor P2X 5"], ["SPN", "−0.3575", "0.007702", "0.036969", "−2.72842", "Down", "sialophorin"], ["KRTCAP2", "−0.27178", "0.010587", "0.046448", "−2.61265", "Down", "keratinocyte associated protein 2"], ["MRTFA", "−0.32285", "0.007914", "0.037715", "−2.7187", "Down", "myocardin related transcription factor A"], ["MBOAT7", "−0.29593", "0.007972", "0.037933", "−2.71605", "Down", "membrane bound O-acyltransferase domain containing 7"], ["PREX1", "−0.30088", "0.008158", "0.038573", "−2.70775", "Down", "phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 1"], ["YLPM1", "−0.28757", "0.008714", "0.040515", "−2.68392", "Down", "YLP motif containing 1"], ["STK40", "−0.26465", "0.008277", "0.038982", "−2.70252", "Down", "serine/threonine kinase 40"], ["ARHGAP17", "−0.33169", "0.009266", "0.04223", "−2.66157", "Down", "Rho GTPase activating protein 17"], ["VNN3", "−0.30084", "0.008574", "0.040052", "−2.68977", "Down", "vanin 3"], ["SLC9A8", "−0.26299", "0.008652", "0.040285", "−2.68649", "Down", "solute carrier family 9 member A8"], ["RPGRIP1", "−0.27294", "0.010455", "0.046081", "−2.6173", "Down", "RPGR interacting protein 1"], ["LRRC4", "−0.27126", "0.009351", "0.042557", "−2.65825", "Down", "leucine rich repeat containing 4"], ["MAVS", "−0.37027", "0.009896", "0.04429", "−2.63751", "Down", "mitochondrial antiviral signaling protein"], ["DENND3", "−0.29167", "0.008663", "0.040323", "−2.68605", "Down", "DENN domain containing 3"], ["BAG6", "−0.29939", "0.008921", "0.041228", "−2.67539", "Down", "BCL2 associated athanogene 6"], ["STAT2", "−0.3148", "0.008975", "0.041387", "−2.67319", "Down", "signal transducer and activator of transcription 2"], ["TAGLN", "−0.47191", "0.01024", "0.045397", "−2.62496", "Down", "transgelin"], ["ARHGEF40", "−0.30666", "0.009153", "0.041943", "−2.66604", "Down", "Rho guanine nucleotide exchange factor 40"], ["HEATR6", "−0.28169", "0.011601", "0.049803", "−2.57873", "Down", "HEAT repeat containing 6"], ["DGAT2", "−0.26818", "0.009139", "0.041901", "−2.6666", "Down", "diacylglycerol O-acyltransferase 2"], ["PRKD2", "−0.30467", "0.009203", "0.042065", "−2.66408", "Down", "protein kinase D2"], ["AGER", "−0.3384", "0.009421", "0.042727", "−2.65554", "Down", "advanced glycosylation end-product specific receptor"], ["UBA7", "−0.26693", "0.009299", "0.042344", "−2.66029", "Down", "ubiquitin like modifier activating enzyme 7"], ["CAMKK1", "−0.29228", "0.011032", "0.047934", "−2.59743", "Down", "calcium/calmodulin dependent protein kinase kinase 1"], ["DLGAP4", "−0.29263", "0.009963", "0.044477", "−2.63502", "Down", "DLG associated protein 4"], ["REC8", "−0.3437", "0.010365", "0.04582", "−2.62047", "Down", "REC8 meiotic recombination protein"], ["TLN1", "−0.4416", "0.009401", "0.042661", "−2.65628", "Down", "talin 1"], ["QSOX1", "−0.28813", "0.009808", "0.044044", "−2.64077", "Down", "quiescin sulfhydryl oxidase 1"], ["ZNF692", "−0.27196", "0.010424", "0.045995", "−2.6184", "Down", "zinc finger protein 692"], ["CSF1R", "−0.29204", "0.00998", "0.044538", "−2.63442", "Down", "colony stimulating factor 1 receptor"], ["ABCC10", "−0.3171", "0.01149", "0.04946", "−2.58231", "Down", "ATP binding cassette subfamily C member 10"], ["ABTB1", "−0.33918", "0.010031", "0.044708", "−2.63253", "Down", "ankyrin repeat and BTB domain containing 1"], ["GALNS", "−0.2628", "0.011209", "0.048514", "−2.59152", "Down", "galactosamine (N-acetyl)-6-sulfatase"], ["PRRC2A", "−0.42124", "0.010301", "0.045643", "−2.62278", "Down", "proline rich coiled-coil 2A"], ["SLC11A1", "−0.32785", "0.010591", "0.046449", "−2.61254", "Down", "solute carrier family 11 member 1"], ["TEP1", "−0.27091", "0.011336", "0.048899", "−2.58735", "Down", "telomerase associated protein 1"], ["P2RX1", "−0.33856", "0.011621", "0.049837", "−2.57809", "Down", "purinergic receptor P2X 1"]], "row_count": 992, "column_count": 8, "numeric_cells": 5003, "header_rows": 1, "locator": "section[12]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:33827531:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a92929b7f7bafd039a28f6652847a8f5d0b83558dfd3c5ec0f435e43943fb67c", "bytes": 1941, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#Tab3", "version": null, "note": "The enriched pathway terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8028841", "section_index": 5, "section_title": "Gene Ontology (GO) and pathway enrichment analyses of DEGs", "row_count": 15, "column_count": 8}, "table": {"label": "Table 3", "caption": "The enriched pathway terms of the up and down regulated differentially expressed genes", "rows": [["Pathway ID", "Pathway Name", "P-value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["1,269,543", "Signaling by GPCR", "3.16E-03", "1.94E-01", "1.00E+00", "7.89E-01", "16", "OR2T29,NPBWR1,TRHR,AVP,GPR37,OR10J3,GRIN2B, RGS4,PTHLH,CRHR2,OR51E2,OR51E1,EGFR,OR6C70, CCL13,CCL19"], ["1,269,868", "Muscle contraction", "5.98E-03", "1.94E-01", "1.00E+00", "1.00E+00", "5", "MYH6,NPPC,KCNK4,ATP1A4,PLN"], ["1,269,958", "Digestion of dietary carbohydrate", "5.00E-02", "2.98E-01", "1.00E+00", "1.00E+00", "1", "AMY1A"], ["1,457,790", "Keratinization", "1.22E-01", "1.00E+00", "3.53E-01", "1.00E+00", "3", "KRT39,KRT20,KRT38"], ["1,270,189", "Biological oxidations", "1.41E-01", "3.67E-01", "1.00E+00", "1.00E+00", "3", "CYP2F1,AS3MT,UGT2A3"], ["1,269,907", "SLC-mediated transmembrane transport", "4.87E-01", "6.38E-01", "1.00E+00", "1.00E+00", "2", "AVP,G6PC"], ["Down regulated genes"], ["1,269,203", "Innate Immune System", "1.03E-02", "3.35E-01", "1.00E+00", "1.00E+00", "16", "CRISPLD2,DSP,OSCAR,C5AR2,SIGLEC14,ITGAX,MEFV,GAB2,MMP25,IGF2R,ATP6V0D1,DTX4,TLN1,PRKACA,ADGRE5,CLEC4C"], ["1,269,310", "Cytokine Signaling in Immune system", "1.26E-01", "5.91E-01", "1.00E+00", "1.00E+00", "8", "HLA-DQA1,ITGAX,GAB2,LGALS9,CIITA,TLN1,PRKACA,IL17RA"], ["1,269,957", "Metabolism of carbohydrates", "1.31E-01", "5.91E-01", "1.00E+00", "1.00E+00", "4", "NDST1,AMY1B,SLC9A1,PRKACA"], ["1,269,876", "Vesicle-mediated transport", "1.41E-01", "5.91E-01", "1.00E+00", "1.00E+00", "7", "VPS37C,HIP1,GABARAP,APOL1,ARF3,RAB36,IGF2R"], ["1,269,507", "Signaling by Rho GTPases", "3.11E-01", "6.03E-01", "1.00E+00", "1.00E+00", "4", "ARHGEF5,GMIP,ARHGAP1,ARAP3"], ["1,269,649", "Gene Expression", "9.87E-01", "9.89E-01", "1.00E+00", "1.00E+00", "6", "CDKN2A,POLR2A,ZNF385A,EIF3CL,BAZ2A,ZNF70"]], "row_count": 15, "column_count": 8, "numeric_cells": 78, "header_rows": 1, "locator": "section[13]/table-wrap[1]#Tab3"}}, {"id": "asset:table:pmid:33827531:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d562384dbb1fa5d7c550c4b2014445aa67929168dc0263d46e9effda35c511cc", "bytes": 2799, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[2]#Tab4", "version": null, "note": "The enriched GO terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8028841", "section_index": 5, "section_title": "Gene Ontology (GO) and pathway enrichment analyses of DEGs", "row_count": 15, "column_count": 9}, "table": {"label": "Table 4", "caption": "The enriched GO terms of the up and down regulated differentially expressed genes", "rows": [["GO ID", "CATEGORY", "GO Name", "P Value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["GO:0007267", "BP", "cell-cell signaling", "6.48E-03", "1.84E-01", "1.00E+00", "1.00E+00", "22", "TRHDE,NPBWR1,MYH6,AVP,PPFIA2,IL17B,PCDHB10,PCDHB2,GRIA4,GRIN2B,DCC,RGS4,PTHLH,CRHR2,GJA1,CSNK1A1L,DKK1,EGFR,SNAP91,RIMS4,LRP2,CCL13"], ["GO:0022414", "BP", "reproductive process", "1.22E-02", "1.99E-01", "1.00E+00", "1.00E+00", "19", "NPPC,AVP,BTBD18,MEIOB,RAD21L1,TEX15,PTHLH,GJA1,EGFR,SPATA16,MIF,OSR1,LRP2,HFM1,ACSBG2,SPATA22,ATP1A4,PRL,UTF1"], ["GO:0005887", "CC", "integral component of plasma membrane", "1.14E-03", "1.17E-01", "7.35E-01", "3.43E-01", "22", "TRHDE,SEMA6B,RDH8,NPBWR1,TMC2,TRHR,GPR37,PCDHB10,PCDHB2,TM4SF5,GRIA4,GRIN2B,DCC,KCNK4,PTPRT,CRHR2,ADGRL4,GJA1,EGFR,LRFN5,UPK1B,ATP1A4"], ["GO:0099512", "CC", "supramolecularfiber", "1.65E-02", "1.84E-01", "1.00E+00", "1.00E+00", "17", "ABRA,DNAH3,MYH6,MYOT,NRAP,TMC2,MYH13,KIF1A,GRIN2B,GJA1,KRT39,MFAP2,TRIM55,LRP2,KRT20,KRT38,PTPN20"], ["GO:0038023", "MF", "signaling receptor activity", "1.59E-03", "1.30E-01", "8.79E-01", "7.75E-01", "22", "OR2T29,NPBWR1,MYOT,TRHR,GPR37,OR10J3,GRIA4,GRIN2B,DCC,PTPRT,CRHR2,ADGRL4,MTRNR2L1,OR51E2,MTRNR2L6,OR51E1,DKK1,EGFR,OR6C70,LRP2,ADGRF4,FCAMR"], ["GO:0005198", "MF", "structural molecule activity", "3.67E-02", "2.51E-01", "1.00E+00", "1.00E+00", "10", "MYOT,EPB41L4B,MRPL12,PPFIA2,EMILIN3,KRT39,MFAP2,UPK1B,KRT20,KRT38"], ["Down regulated genes"], ["GO:0006906", "BP", "vesicle fusion", "1.55E-04", "7.94E-02", "6.71E-01", "4.06E-01", "17", "CRISPLD2,DSP,RIMS3,OSCAR,SIGLEC14,DYSF,ITGAX,ITIH4,GAB2,LGALS9,MMP25,IGF2R,SCAMP5,TLN1,ADGRE5,TNFAIP2,CLEC4C"], ["GO:0022610", "BP", "biological adhesion", "2.52E-03", "2.18E-01", "1.00E+00", "1.00E+00", "19", "CDKN2A,MYADM,DSP,HLA-DQA1,LAG3,SIGLEC14,DYSF,ITGAX,TNFRSF21,LGALS9,SLC9A1,TLN1,NECTIN1,SORBS3,AOC3,PLXNA4,PXN,ADGRE5,PLXNA2"], ["GO:0098805", "CC", "whole membrane", "4.42E-03", "1.66E-01", "1.00E+00", "1.00E+00", "21", "VPS37C,MYADM,HIP1,TPCN2,DSP,HLA-DQA1,SIGLEC14,GABARAP,DYSF,ITGAX,MICALL1,MMP25,ARHGAP1,SLC9A1,IGF2R,ATP6V0D1,SCAMP5,PRKACA,ADGRE5,CLEC4C,ATG16L2"], ["GO:0030054", "CC", "cell junction", "2.83E-02", "3.05E-01", "1.00E+00", "1.00E+00", "15", "MYADM,DSP,ARHGEF5,RIMS3,LASP1,SLC9A1,IGF2R,SCAMP5,TLN1,NECTIN1,SORBS3,PXN,ADGRE5,ALKBH6,PDZD3"], ["GO:0008289", "MF", "lipid binding", "2.91E-03", "1.08E-01", "7.31E-01", "1.00E+00", "13", "HIP1,CPNE9,ARHGEF5,PAQR6,APOL1,DYSF,GAB2,MICALL1,SLC9A1,IGF2R,ARAP3,TLN1,APOL2"], ["GO:0051020", "MF", "GTPase binding", "5.51E-03", "1.08E-01", "7.31E-01", "1.00E+00", "10", "ARHGEF5,RGL3,RIMS3,MICALL1,ARHGAP1,PRKACA,DAAM2,RIPOR1,RGL2,RAPGEFL1"]], "row_count": 15, "column_count": 9, "numeric_cells": 81, "header_rows": 1, "locator": "section[13]/table-wrap[2]#Tab4"}}, {"id": "asset:table:pmid:33827531:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3bdd31668dbfacf02e690dbc34efbb3fbc31b4d530156b49012cfff60f552d39", "bytes": 12296, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab5", "version": null, "note": "Topology table for up and down regulated genes", "structure": {"pmcid": "PMC8028841", "section_index": 6, "section_title": "PPI network construction and module analysis", "row_count": 233, "column_count": 6}, "table": {"label": "Table 5", "caption": "Topology table for up and down regulated genes", "rows": [["Regulation", "Node", "Degree", "Betweenness", "Stress", "Closeness"], ["Up", "EGFR", "1343", "0.514227", "4.35E+08", "0.441893"], ["Up", "GRIN2B", "195", "0.008701", "14,535,992", "0.282164"], ["Up", "GJA1", "170", "0.03151", "64,939,702", "0.31364"], ["Up", "CAP2", "108", "0.004218", "888,128", "0.325945"], ["Up", "MIF", "99", "0.025028", "7,627,912", "0.362124"], ["Up", "DCC", "98", "0.009465", "15,166,420", "0.286956"], ["Up", "PRL", "89", "0.001208", "656,482", "0.239894"], ["Up", "EYA1", "72", "0.003864", "4,335,792", "0.271944"], ["Up", "RGS4", "63", "0.003414", "1,243,420", "0.31129"], ["Up", "GRIA4", "55", "0.001352", "431,502", "0.292547"], ["Up", "CCL19", "50", "0.001236", "1,457,894", "0.1951"], ["Up", "DKK1", "50", "0.003569", "4,044,234", "0.25252"], ["Up", "PLN", "43", "0.003324", "524,170", "0.286083"], ["Up", "GPR37", "41", "0.021208", "9,337,328", "0.303261"], ["Up", "LRP2", "39", "0.023544", "9,018,868", "0.307583"], ["Up", "PTHLH", "38", "0.001269", "1,103,574", "0.257729"], ["Up", "PPFIA2", "33", "0.002618", "3,942,042", "0.269956"], ["Up", "KIF1A", "31", "0.011317", "2,986,868", "0.345485"], ["Up", "HOXB7", "31", "0.002165", "2,106,446", "0.268893"], ["Up", "MYOT", "28", "0.003103", "475,758", "0.275841"], ["Up", "OTX2", "28", "0.003016", "868,076", "0.271263"], ["Up", "NPPC", "27", "0.003211", "986,326", "0.247419"], ["Up", "KRT20", "26", "0.005296", "5,544,830", "0.279444"], ["Up", "MRPL12", "25", "0.050618", "70,486,194", "0.310399"], ["Up", "NPBWR1", "23", "4.01E-04", "207,170", "0.174777"], ["Up", "TRHR", "22", "4.10E-04", "210,106", "0.238152"], ["Up", "CCL13", "20", "0.003552", "1,650,164", "0.263645"], ["Up", "MFAP2", "19", "0.002005", "451,990", "0.228053"], ["Up", "TRIM55", "18", "0.021705", "17,474,648", "0.300609"], ["Up", "NEUROG3", "18", "0.011467", "9,544,416", "0.269256"], ["Up", "NRAP", "18", "0.001974", "406,892", "0.285085"], ["Up", "PTPRT", "18", "0.00104", "208,946", "0.324523"], ["Up", "OSR1", "17", "4.56E-04", "195,068", "0.226447"], ["Up", "EFS", "17", "0.003557", "2,975,070", "0.285232"], ["Up", "HBZ", "17", "0.006623", "4,433,868", "0.287818"], ["Up", "KCNK4", "16", "4.01E-04", "117,736", "0.247125"], ["Up", "AVP", "16", "0.006488", "3,769,102", "0.26391"], ["Up", "SOX18", "16", "8.04E-04", "761,526", "0.244028"], ["Up", "NACA2", "15", "0.002639", "3,304,692", "0.274822"], ["Up", "SRXN1", "15", "0.005715", "9,265,020", "0.276852"], ["Up", "UTF1", "13", "1", "12", "1"], ["Up", "RNF180", "13", "4.01E-04", "186,722", "0.235697"], ["Up", "KRT38", "12", "0.011531", "15,515,646", "0.273676"], ["Up", "FAP", "12", "0.005985", "10,442,836", "0.259379"], ["Up", "GULP1", "12", "0.001542", "1,584,446", "0.281416"], ["Up", "IL17B", "12", "4.02E-04", "151,558", "0.24843"], ["Up", "CRHR2", "11", "0.002005", "1,044,220", "0.245978"], ["Up", "RFPL4A", "10", "9.09E-06", "2638", "0.1894"], ["Up", "SNAP91", "10", "0.001514", "2,227,728", "0.265994"], ["Up", "ADGRL4", "10", "0", "0", "0"], ["Up", "FBXO10", "10", "0.002727", "598,280", "0.287801"], ["Up", "CST6", "9", "0.009382", "6,670,420", "0.28234"], ["Up", "PADI3", "9", "0.003682", "1,684,994", "0.267321"], ["Up", "LIPF", "9", "0.002462", "1,222,458", "0.239008"], ["Up", "CA10", "8", "0.00882", "3,036,648", "0.251628"], ["Up", "EPB41L4B", "8", "0.00328", "3,044,266", "0.280229"], ["Up", "OR51E2", "8", "0.002481", "1,735,460", "0.249674"], ["Up", "RIMS4", "8", "4.46E-04", "187,102", "0.255497"], ["Up", "MYT1L", "8", "1.71E-04", "156,968", "0.255523"], ["Up", "C4orf48", "7", "4.02E-04", "410,864", "0.238654"], ["Up", "EMILIN3", "7", "0.002789", "890,368", "0.2335"], ["Up", "CSNK1A1L", "6", "0.002373", "3,707,900", "0.264526"], ["Up", "ATP1A4", "6", "0.001778", "1,343,858", "0.269795"], ["Up", "OR6C70", "6", "0", "0", "1"], ["Up", "MEIOB", "6", "1.19E-04", "55,294", "0.237857"], ["Up", "UPK1B", "5", "0.001266", "639,316", "0.238883"], ["Up", "TEX15", "5", "8.47E-04", "384,696", "0.261104"], ["Up", "CAMK1G", "5", "0.001061", "955,066", "0.263353"], ["Up", "FOXQ1", "5", "0.02441", "34,422,300", "0.29497"], ["Up", "MYH13", "4", "0.007248", "6,307,480", "0.276193"], ["Up", "MYH6", "4", "0.006387", "8,432,142", "0.276223"], ["Up", "SPATA22", "4", "0.001497", "616,922", "0.255628"], ["Up", "TRHDE", "4", "0.004478", "568,880", "0.325562"], ["Up", "CCDC144A", "4", "0.001246", "906,138", "0.212789"], ["Up", "PCDHB10", "4", "8.03E-04", "313,938", "0.212698"], ["Up", "CNMD", "4", "0.001108", "411,030", "0.251134"], ["Up", "ABRA", "4", "0.001639", "940,076", "0.263019"], ["Up", "MS4A5", "4", "0", "0", "0.246088"], ["Up", "DNAH3", "3", "5.51E-04", "333,004", "0.269839"], ["Up", "MTRNR2L1", "3", "9.66E-04", "646,606", "0.269168"], ["Up", "KPNA7", "3", "4.63E-04", "356,676", "0.259541"], ["Up", "CBLN2", "3", "0", "0", "1"], ["Up", "FSIP2", "3", "4.14E-04", "158,112", "0.250276"], ["Up", "SPATA16", "3", "0", "0", "0.237426"], ["Up", "ZNF214", "2", "0.004409", "2,022,086", "0.235753"], ["Up", "CCDC140", "2", "4.01E-04", "96,422", "0.215353"], ["Up", "UGT2A3", "2", "8.95E-04", "518,942", "0.239952"], ["Up", "FAM71D", "2", "4.04E-04", "236,600", "0.24016"], ["Up", "GOLGA6B", "2", "0", "0", "0.221585"], ["Up", "C2orf73", "2", "8.02E-04", "393,150", "0.236301"], ["Up", "GOLGA8G", "2", "0", "0", "1"], ["Up", "SMCO1", "1", "4.28E-04", "175,370", "0.225341"], ["Up", "ANKRD30B", "1", "0", "0", "1"], ["Up", "FCAMR", "1", "0", "0", "0.225719"], ["Up", "HFM1", "1", "8.96E-05", "46,366", "0.226673"], ["Up", "BTBD18", "1", "0", "0", "0.306486"], ["Up", "ACSBG2", "1", "4.02E-04", "116,692", "0.247358"], ["Up", "KRT39", "1", "0", "0", "0.251806"], ["Up", "G6PC", "1", "0.001203", "289,260", "0.215428"], ["Up", "RBM46", "1", "1.99E-06", "1374", "0.252879"], ["Up", "PCDHB2", "1", "0", "0", "1"], ["Up", "AS3MT", "1", "0", "0", "0.210364"], ["Up", "RAD21L1", "1", "0", "0", "1"], ["Up", "CAPN9", "1", "2.61E-06", "2714", "0.211893"], ["Up", "FABP6", "1", "0", "0", "1"], ["Down", "POLR2A", "512", "0.095104", "2E+08", "0.3738"], ["Down", "PRKACA", "350", "0.104658", "44,280,174", "0.378052"], ["Down", "GABARAP", "322", "0.144708", "36,234,824", "0.358401"], ["Down", "TLN1", "223", "0.027406", "67,578,124", "0.35998"], ["Down", "PXN", "173", "0.029203", "29,047,866", "0.360318"], ["Down", "HIP1", "146", "0.007469", "12,022,620", "0.347944"], ["Down", "GAB2", "118", "0.014217", "38,718,180", "0.340041"], ["Down", "SYVN1", "114", "0.025941", "12,050,404", "0.307887"], ["Down", "KCNIP2", "110", "0.002849", "14,186,360", "0.253084"], ["Down", "ARHGAP1", "106", "0.011263", "27,047,958", "0.348406"], ["Down", "NECTIN1", "102", "0.003189", "17,978,038", "0.252469"], ["Down", "RGL2", "88", "0.003069", "3,605,218", "0.263534"], ["Down", "ASF1B", "85", "0.00926", "21,237,598", "0.2861"], ["Down", "IGF2R", "78", "0.010589", "26,691,414", "0.303021"], ["Down", "SLC9A1", "75", "0.009561", "24,396,634", "0.292461"], ["Down", "VPS37C", "75", "0.006908", "5,646,832", "0.29327"], ["Down", "MEFV", "72", "0.001361", "31,003,730", "0.301081"], ["Down", "CDKN2A", "72", "0.051693", "14,128,370", "0.321613"], ["Down", "MAP1A", "63", "0.008662", "3,403,950", "0.291879"], ["Down", "ARF3", "60", "0.004127", "11,523,596", "0.287784"], ["Down", "CIITA", "59", "0.006319", "10,301,788", "0.302892"], ["Down", "WDTC1", "57", "0.005909", "19,161,622", "0.278569"], ["Down", "MICALL1", "53", "0.005986", "7,902,576", "0.285919"], ["Down", "ITGAX", "53", "0.001212", "13,088,030", "0.238757"], ["Down", "SORBS3", "51", "0.016308", "10,468,808", "0.314749"], ["Down", "DSP", "47", "0.039735", "2,314,856", "0.347581"], ["Down", "BAZ2A", "45", "0.004013", "13,101,300", "0.289472"], ["Down", "MAPRE3", "44", "0.006813", "4,554,084", "0.28533"], ["Down", "CRTC2", "44", "0.004812", "11,994,716", "0.296709"], ["Down", "PADI4", "43", "0.002174", "7,728,076", "0.275765"], ["Down", "SPINT1", "42", "0.001717", "6,257,478", "0.263492"], ["Down", "ARHGEF5", "40", "0.003561", "7,025,544", "0.336483"], ["Down", "LASP1", "40", "0.021943", "9,410,452", "0.31303"], ["Down", "PDZD3", "39", "0.005273", "6,150,510", "0.249549"], ["Down", "HIVEP3", "39", "0.001859", "4,355,942", "0.26672"], ["Down", "TNFRSF21", "36", "0.001781", "3,131,524", "0.274883"], ["Down", "SOGA1", "36", "0.005248", "10,217,032", "0.291623"], ["Down", "MBD6", "34", "0.002017", "1,737,436", "0.231979"], ["Down", "ATP6V0D1", "33", "0.026324", "1,957,202", "0.303649"], ["Down", "IQCN", "32", "0.015047", "5,650,026", "0.283239"], ["Down", "IL17RA", "30", "0.020601", "4,651,714", "0.286807"], ["Down", "ABTB2", "29", "0.001793", "4,772,698", "0.279695"], ["Down", "INCA1", "29", "0.011463", "2,924,018", "0.276668"], ["Down", "MAST3", "28", "0.019115", "4,567,048", "0.308592"], ["Down", "BEST1", "28", "4.42E-04", "3,684,990", "0.260082"], ["Down", "PRSS21", "28", "0.001117", "5,817,460", "0.25749"], ["Down", "TPCN2", "27", "0.014228", "4,144,602", "0.284792"], ["Down", "LAG3", "26", "4.41E-06", "6,746,636", "0.238038"], ["Down", "GMIP", "24", "8.12E-04", "3,636,310", "0.263896"], ["Down", "CLEC4C", "24", "4.01E-04", "725,910", "0.175956"], ["Down", "TAGLN", "23", "0.016019", "4,532,938", "0.283771"], ["Down", "FAM219A", "20", "0.008105", "916,962", "0.287867"], ["Down", "NCR1", "20", "0.002234", "349,872", "0.271381"], ["Down", "PRRC2A", "18", "0.015874", "2,767,592", "0.307261"], ["Down", "KCNMB1", "18", "8.42E-04", "2,984,594", "0.257118"], ["Down", "EIF3CL", "17", "0.003808", "1,129,844", "0.284272"], ["Down", "H6PD", "17", "5.55E-04", "3,133,402", "0.259123"], ["Down", "MMP25", "17", "4.01E-04", "2,598,252", "0.238837"], ["Down", "ENTPD2", "16", "1", "2,170,770", "1"], ["Down", "DYSF", "16", "0.009592", "704,606", "0.292839"], ["Down", "LGALS9", "16", "0.01981", "1,417,206", "0.288134"], ["Down", "DPEP2", "16", "0.007617", "1,500,838", "0.260885"], ["Down", "POMZP3", "14", "8.35E-05", "836,800", "0.254857"], ["Down", "EXTL3", "13", "0.004948", "611,924", "0.27899"], ["Down", "EPHX1", "13", "0.006221", "2,003,020", "0.279491"], ["Down", "C15orf39", "12", "0.00794", "610,110", "0.291793"], ["Down", "PLXNA2", "12", "0.009415", "1,162,970", "0.277268"], ["Down", "PLPPR2", "12", "0.006567", "1,448,934", "0.253961"], ["Down", "MYADM", "11", "0.007222", "952,256", "0.283771"], ["Down", "GTPBP1", "11", "0.005922", "1,877,862", "0.299976"], ["Down", "ADGRE5", "10", "0.014659", "888,184", "0.289203"], ["Down", "SULT1A2", "10", "0.00172", "1,783,464", "0.247973"], ["Down", "INKA2", "10", "0.00214", "1,184,052", "0.279616"], ["Down", "NDST1", "10", "0.001942", "1,716,840", "0.257383"], ["Down", "TTLL3", "9", "0.002348", "134,132", "0.261694"], ["Down", "DRICH1", "9", "0.002408", "1,799,342", "0.237302"], ["Down", "APOL2", "9", "0.007736", "489,254", "0.289489"], ["Down", "ZNF70", "9", "0.001286", "3,985,632", "0.223763"], ["Down", "ASPRV1", "9", "0.00395", "1,038,668", "0.290552"], ["Down", "PLXNA4", "8", "0.001243", "473,354", "0.262534"], ["Down", "FAM160A1", "8", "4.10E-04", "882,848", "0.241043"], ["Down", "PLBD2", "8", "0.002764", "1,265,098", "0.278057"], ["Down", "RNF122", "8", "0.001044", "1,049,362", "0.265329"], ["Down", "PAQR6", "8", "4.10E-04", "868,456", "0.23693"], ["Down", "CHKB", "7", "0", "602,254", "0.217363"], ["Down", "CRISPLD2", "7", "3.80E-06", "943,864", "0.256153"], ["Down", "DUSP18", "7", "0.002971", "325,170", "0.315506"], ["Down", "TRANK1", "7", "4.02E-04", "801,248", "0.245821"], ["Down", "TP53INP2", "6", "1.70E-07", "703,508", "0.247198"], ["Down", "ARAP3", "6", "4.92E-04", "286,916", "0.268169"], ["Down", "TNFAIP2", "6", "0.001439", "633,692", "0.254324"], ["Down", "APOL1", "5", "6.25E-04", "48,364", "0.233895"], ["Down", "PRR16", "5", "0.001298", "158,878", "0.26692"], ["Down", "ITIH4", "5", "4.46E-04", "356,728", "0.266806"], ["Down", "SIGLEC14", "5", "0", "273,222", "1"], ["Down", "C5AR2", "5", "0.019084", "54,700", "0.270983"], ["Down", "DTX4", "5", "8.06E-04", "445,430", "0.256483"], ["Down", "SCAMP5", "5", "0.002526", "469,900", "0.229016"], ["Down", "SH3D21", "5", "1.03E-04", "675,458", "0.314928"], ["Down", "LY6G5B", "4", "6.87E-04", "43,440", "0.259947"], ["Down", "TMEM121B", "4", "0", "217,638", "0.1804"], ["Down", "AOC3", "4", "0.002207", "251,106", "0.268748"], ["Down", "DAAM2", "3", "0.00264", "78,488", "0.259838"], ["Down", "ZBTB3", "3", "0.006264", "225,562", "0.267838"], ["Down", "LCNL1", "3", "9.23E-05", "198,214", "0.235286"], ["Down", "RIMS3", "2", "4.16E-04", "11,332", "0.223944"], ["Down", "ZNF385A", "2", "6.60E-04", "3498", "0.264948"], ["Down", "RIPOR1", "2", "6.43E-04", "1512", "0.277964"], ["Down", "KDM6B", "2", "0.003441", "321,702", "0.271411"], ["Down", "PAPLN", "2", "0.001857", "53,928", "0.244759"], ["Down", "RAB36", "2", "4.01E-04", "4276", "0.188797"], ["Down", "NOMO2", "2", "5.94E-04", "78", "0.280182"], ["Down", "AOC2", "2", "5.51E-04", "3886", "0.250113"], ["Down", "PROSER3", "2", "4.60E-05", "2", "0.23941"], ["Down", "WDFY4", "2", "2.38E-06", "184,474", "0.236975"], ["Down", "ATG16L2", "2", "0.001016", "322,434", "0.299651"], ["Down", "RAPGEFL1", "2", "7.68E-05", "9928", "0.260599"], ["Down", "CPNE9", "1", "9.19E-05", "0", "0.23639"], ["Down", "RSKR", "1", "4.69E-06", "0", "0.247739"], ["Down", "RGL3", "1", "0", "0", "0.234621"], ["Down", "SHISA4", "1", "0", "0", "1"], ["Down", "TMEM63C", "1", "0", "0", "0.24945"], ["Down", "NPIPB3", "1", "8.84E-06", "0", "0.229639"], ["Down", "CLEC17A", "1", "0", "0", "0.209331"], ["Down", "TIFAB", "1", "0", "0", "1"], ["Down", "OSCAR", "1", "0", "0", "1"], ["Down", "AGAP9", "1", "0", "0", "0.236256"]], "row_count": 233, "column_count": 6, "numeric_cells": 981, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab5"}}, {"id": "asset:table:pmid:33827531:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c9295058ff9955a5449c21ae6063c01dfcb3a804f400f578fa7adbc77b7ce028", "bytes": 919, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#Tab1", "version": null, "note": "The sequences of primers for quantitative RT-PCR", "structure": {"pmcid": "PMC8028841", "section_index": 9, "section_title": "Validation of hub genes", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of primers for quantitative RT-PCR", "rows": [["Genes", "Primers", "Length of target fragment, bp"], ["EGFR", "F: AGGCACGAGTAACAAGCTCACR: ATGAGGACATAACCAGCCACC", "2121"], ["GRIN2B", "F: TCTGACCGGAAGATCCAGGGR: TCCATGATGTTGAGCATTACGG", "2022"], ["GJA1", "F: GGTGACTGGAGCGCCTTAGR: GCGCACATGAGAGATTGGGA", "1920"], ["CAP2", "F: CCCTGCCCTTGGATGGATAGR: ACGCTGATACTGTGGATGCTA", "2021"], ["MIF", "F: CTCTCCGAGCTCACCCAGCAGR: CGCGTTCATGTCGTAATAGTT", "2121"], ["POLR2A", "F: GGGTGGCATCAAATACCCAGAR: AGACACAGCGCAAAACTTTCA", "2121"], ["PRKACA", "F: AGCCCACTTGGATCAGTTTGAR: GTTCCCGGTCTCCTTGTGT", "2119"], ["GABARAP", "F: AGAAGAGCATCCGTTCGAGAAR: CCAGGTCTCCTATCCGAGCTT", "2121"], ["TLN1", "F: GACGATGCAGTTTGAGCCGR: GGTCATCATCTGACAGAAAGAG", "1923"], ["PXN", "F: CTGCTGGAACTGAACGCTGTAR: GGGGCTGTTAGTCTCTGGGA", "2120"]], "row_count": 11, "column_count": 3, "numeric_cells": 10, "header_rows": 1, "locator": "section[9]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:33827531:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:01288106df1f7283fb78129885bf8b350967ffd439671430a6410e493adcddfa", "bytes": 96122, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#Tab2", "version": null, "note": "The statistical metrics for key differentially expressed genes (DEGs)", "structure": {"pmcid": "PMC8028841", "section_index": 12, "section_title": "Identification of DEGs", "row_count": 992, "column_count": 8}, "table": {"label": "Table 2", "caption": "The statistical metrics for key differentially expressed genes (DEGs)", "rows": [["GeneSymbol", "logFC", "p Value", "adj. P.Val", "t value", "Regulations", "GeneName"], ["ARMS2", "1.105122", "3.28E-07", "0.000198", "5.53328", "Up", "age-related maculopathy susceptibility 2"], ["PRSS46P", "1.005863", "1.59E-06", "0.000459", "5.153257", "Up", "serine protease 46, pseudogene"], ["MYH13", "1.03327", "1.64E-06", "0.00046", "5.144666", "Up", "myosin heavy chain 13"], ["RAD21L1", "1.367492", "2.87E-06", "0.000592", "5.007555", "Up", "RAD21 cohesin complex component like 1"], ["AS3MT", "1.172185", "2.97E-06", "0.000593", "4.998809", "Up", "arsenitemethyltransferase"], ["UPK1B", "1.142189", "4.25E-06", "0.000663", "4.909531", "Up", "uroplakin 1B"], ["CRHR2", "1.057435", "4.66E-06", "0.000686", "4.886267", "Up", "corticotropin releasing hormone receptor 2"], ["KRT20", "1.041956", "5.47E-06", "0.000738", "4.845569", "Up", "keratin 20"], ["CYP2F1", "0.996571", "5.49E-06", "0.000738", "4.844967", "Up", "cytochrome P450 family 2 subfamily F member 1"], ["TBX20", "0.915545", "6.65E-06", "0.000852", "4.796325", "Up", "T-box transcription factor 20"], ["TEX15", "1.040483", "6.7E-06", "0.000852", "4.794446", "Up", "testis expressed 15, meiosis and synapsis associated"], ["REN", "0.918655", "7.4E-06", "0.00091", "4.769059", "Up", "renin", ""], ["RDH8", "1.031642", "8.2E-06", "0.000925", "4.743027", "Up", "retinol dehydrogenase 8"], ["PADI3", "1.004196", "8.23E-06", "0.000925", "4.742198", "Up", "peptidyl arginine deiminase 3"], ["RIMS4", "1.005408", "8.44E-06", "0.000925", "4.735751", "Up", "regulating synaptic membrane exocytosis 4"], ["MS4A5", "0.988204", "8.45E-06", "0.000925", "4.735279", "Up", "membrane spanning 4-domains A5"], ["HFM1", "1.083591", "1.04E-05", "0.001038", "4.683383", "Up", "helicase for meiosis 1"], ["EGFR", "1.045618", "1.16E-05", "0.001078", "4.655195", "Up", "epidermal growth factor receptor"], ["C10orf113", "0.984302", "1.27E-05", "0.001122", "4.629975", "Up", "chromosome 10 open reading frame 113"], ["RGS4", "0.968679", "1.28E-05", "0.001122", "4.629106", "Up", "regulator of G protein signaling 4"], ["C2orf73", "0.965222", "1.29E-05", "0.001122", "4.626793", "Up", "chromosome 2 open reading frame 73"], ["ACSBG2", "1.181896", "1.27E-05", "0.001122", "4.631273", "Up", "acyl-CoA synthetasebubblegum family member 2"], ["BTBD18", "0.963267", "1.41E-05", "0.001181", "4.604073", "Up", "BTB domain containing 18"], ["DPPA5", "0.954617", "1.44E-05", "0.001195", "4.598614", "Up", "developmental pluripotency associated 5"], ["OR10J3", "0.985446", "1.56E-05", "0.001237", "4.578119", "Up", "olfactory receptor family 10 subfamily J member 3"], ["KCNK4", "1.033357", "1.57E-05", "0.001237", "4.575705", "Up", "potassium two pore domain channel subfamily K member 4"], ["LRAT", "0.925599", "1.61E-05", "0.001259", "4.568727", "Up", "lecithin retinol acyltransferase"], ["IL17B", "0.958598", "1.72E-05", "0.001302", "4.551641", "Up", "interleukin 17B"], ["FBXO10", "1.012141", "1.76E-05", "0.001319", "4.545579", "Up", "F-box protein 10"], ["LRRC74A", "0.894289", "1.78E-05", "0.001319", "4.54289", "Up", "leucine rich repeat containing 74A"], ["TM4SF5", "0.988935", "1.86E-05", "0.001335", "4.531217", "Up", "transmembrane 4 L six family member 5"], ["OR2T29", "0.956232", "1.89E-05", "0.001335", "4.527962", "Up", "olfactory receptor family 2 subfamily T member 29"], ["RNF180", "1.050934", "1.89E-05", "0.001335", "4.526775", "Up", "ring finger protein 180"], ["MYOT", "0.998153", "1.9E-05", "0.001335", "4.525922", "Up", "myotilin", ""], ["SLC22A25", "0.905085", "2.1E-05", "0.001407", "4.499193", "Up", "solute carrier family 22 member 25"], ["CMA1", "0.871927", "2.12E-05", "0.001407", "4.497403", "Up", "chymase 1"], ["PCDHB10", "1.017337", "2.14E-05", "0.001407", "4.494598", "Up", "protocadherin beta 10"], ["HRCT1", "0.931584", "2.16E-05", "0.001407", "4.492152", "Up", "histidine rich carboxyl terminus 1"], ["TRHR", "0.967196", "2.17E-05", "0.001407", "4.491435", "Up", "thyrotropin releasing hormone receptor"], ["NACA2", "1.235555", "2.15E-05", "0.001407", "4.494057", "Up", "nascent polypeptide associated complex subunit alpha 2"], ["CCL19", "1.05675", "2.17E-05", "0.001407", "4.490985", "Up", "C-C motif chemokine ligand 19"], ["DMRTA2", "0.919949", "2.31E-05", "0.001446", "4.474549", "Up", "DMRT like family A2"], ["NRAP", "0.970444", "2.42E-05", "0.001479", "4.46211", "Up", "nebulin related anchoring protein"], ["DNAH3", "0.948597", "2.46E-05", "0.001483", "4.458656", "Up", "dynein axonemal heavy chain 3"], ["CCL13", "1.008793", "2.46E-05", "0.001483", "4.458373", "Up", "C-C motif chemokine ligand 13"], ["OSR1", "0.99949", "2.47E-05", "0.001483", "4.456576", "Up", "odd-skipped related transcription factor 1"], ["TMEM145", "0.966024", "2.46E-05", "0.001483", "4.457613", "Up", "transmembrane protein 145"], ["AVP", "0.940076", "2.5E-05", "0.00149", "4.453465", "Up", "arginine vasopressin"], ["CSHL1", "0.84012", "2.55E-05", "0.001496", "4.44882", "Up", "chorionic somatomammotropin hormone like 1"], ["LHFPL3", "1.029874", "2.56E-05", "0.001497", "4.44723", "Up", "LHFPL tetraspan subfamily member 3"], ["SNAP91", "1.023292", "2.57E-05", "0.001497", "4.446795", "Up", "synaptosome associated protein 91"], ["SOX18", "1.029443", "2.6E-05", "0.001504", "4.44371", "Up", "SRY-box transcription factor 18"], ["CAP2", "1.0769", "2.63E-05", "0.001511", "4.440701", "Up", "cyclase associated actin cytoskeleton regulatory protein 2"], ["C1orf146", "0.912546", "2.69E-05", "0.001529", "4.434806", "Up", "chromosome 1 open reading frame 146"], ["PDE6C", "0.880944", "2.82E-05", "0.001574", "4.421773", "Up", "phosphodiesterase 6C"], ["CRYAA", "0.894932", "2.89E-05", "0.001596", "4.41523", "Up", "crystallin alpha A"], ["NR0B2", "0.903675", "2.9E-05", "0.001596", "4.414618", "Up", "nuclear receptor subfamily 0 group B member 2"], ["ANKRD30B", "0.953544", "2.93E-05", "0.001599", "4.411547", "Up", "ankyrin repeat domain 30B"], ["CST6", "0.946705", "3.04E-05", "0.001632", "4.401733", "Up", "cystatin E/M"], ["CAMK1G", "0.956887", "3.05E-05", "0.001632", "4.401395", "Up", "calcium/calmodulin dependent protein kinase IG"], ["CYP39A1", "0.879266", "3.08E-05", "0.001632", "4.399046", "Up", "cytochrome P450 family 39 subfamily A member 1"], ["ZNF214", "0.948008", "3.14E-05", "0.001653", "4.393435", "Up", "zinc finger protein 214"], ["MRGPRF", "0.936902", "3.18E-05", "0.001666", "4.390434", "Up", "MAS related GPR family member F"], ["PTPRT", "1.102577", "3.22E-05", "0.001674", "4.386782", "Up", "protein tyrosine phosphatase receptor type T"], ["KRT39", "1.081629", "3.21E-05", "0.001674", "4.387502", "Up", "keratin 39"], ["PHF21B", "0.897853", "3.26E-05", "0.001681", "4.383695", "Up", "PHD finger protein 21B"], ["ABRA", "0.967897", "3.26E-05", "0.001681", "4.383147", "Up", "actin binding Rho activating protein"], ["ADGRF4", "0.958187", "3.3E-05", "0.001693", "4.380467", "Up", "adhesion G protein-coupled receptor F4"], ["ABCC12", "0.932702", "3.35E-05", "0.001709", "4.376353", "Up", "ATP binding cassette subfamily C member 12"], ["SLC16A8", "0.908131", "3.38E-05", "0.001712", "4.374274", "Up", "solute carrier family 16 member 8"], ["ATP6V1G2-DDX39B", "0.990995", "3.4E-05", "0.001715", "4.372164", "Up", "ATP6V1G2-DDX39B readthrough (NMD candidate)"], ["LEMD1", "0.846889", "3.51E-05", "0.001738", "4.363856", "Up", "LEM domain containing 1"], ["KPNA7", "0.953213", "3.51E-05", "0.001738", "4.363815", "Up", "karyopherin subunit alpha 7"], ["MYH6", "0.952519", "3.56E-05", "0.001753", "4.359936", "Up", "myosin heavy chain 6"], ["FRMPD2", "0.957963", "3.68E-05", "0.001757", "4.351517", "Up", "FERM and PDZ domain containing 2"], ["SULT6B1", "0.965243", "3.69E-05", "0.001757", "4.350796", "Up", "sulfotransferase family 6B member 1"], ["HSD3B2", "0.933208", "3.7E-05", "0.001757", "4.3496", "Up", "hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2"], ["SULF1", "0.9309", "3.71E-05", "0.001757", "4.349307", "Up", "sulfatase 1"], ["G6PC", "1.038462", "3.71E-05", "0.001757", "4.349175", "Up", "glucose-6-phosphatase catalytic subunit"], ["MTRNR2L6", "1.015308", "3.72E-05", "0.001757", "4.348247", "Up", "MT-RNR2 like 6"], ["IZUMO1", "0.863468", "3.73E-05", "0.001757", "4.347643", "Up", "izumo sperm-egg fusion 1"], ["CFAP77", "0.854205", "3.75E-05", "0.001757", "4.346388", "Up", "cilia and flagella associated protein 77"], ["GPR37", "0.969013", "3.75E-05", "0.001757", "4.346128", "Up", "G protein-coupled receptor 37"], ["OR6C70", "0.996132", "3.78E-05", "0.001757", "4.344383", "Up", "olfactory receptor family 6 subfamily C member 70"], ["URGCP-MRPS24", "0.929538", "3.8E-05", "0.001759", "4.342672", "Up", "URGCP-MRPS24 readthrough"], ["SLC26A3", "0.912109", "3.84E-05", "0.001766", "4.33951", "Up", "solute carrier family 26 member 3"], ["ITGBL1", "0.89074", "3.88E-05", "0.001766", "4.337347", "Up", "integrin subunit beta like 1"], ["LOC102725072", "0.93312", "3.88E-05", "0.001766", "4.336863", "Up", "Putative uncharacterized protein DKFZp434K191"], ["BLACE", "0.837756", "3.94E-05", "0.001771", "4.332862", "Up", "B cell acute lymphoblastic leukemia expressed"], ["LOC100131496", "0.873058", "3.96E-05", "0.001771", "4.331895", "Up", "uncharacterized LOC100131496"], ["LIPF", "0.971728", "3.97E-05", "0.001771", "4.331252", "Up", "lipase F, gastric type"], ["FNDC8", "0.897073", "4E-05", "0.001771", "4.3287", "Up", "fibronectin type III domain containing 8"], ["LOC389199", "0.873159", "4.1E-05", "0.001785", "4.322016", "Up", "uncharacterized LOC389199"], ["OR2K2", "0.856644", "4.28E-05", "0.001834", "4.310597", "Up", "olfactory receptor family 2 subfamily K member 2"], ["FABP6", "0.940984", "4.31E-05", "0.001842", "4.308644", "Up", "fatty acid binding protein 6"], ["SPATA16", "0.946274", "4.37E-05", "0.001845", "4.305413", "Up", "spermatogenesis associated 16"], ["SMCO1", "1.042857", "4.36E-05", "0.001845", "4.305897", "Up", "single-pass membrane protein with coiled-coil domains 1"], ["PCDHB2", "1.169306", "4.41E-05", "0.001855", "4.302798", "Up", "protocadherin beta 2"], ["FAM243A", "0.902671", "4.49E-05", "0.001866", "4.29812", "Up", "family with sequence similarity 243 member A"], ["HOXB8", "0.886424", "4.51E-05", "0.001866", "4.296412", "Up", "homeobox B8"], ["LMO1", "0.892873", "4.53E-05", "0.00187", "4.29529", "Up", "LIM domain only 1"], ["MAS1L", "0.89613", "4.56E-05", "0.001876", "4.293436", "Up", "MAS1 proto-oncogene like, G protein-coupled receptor"], ["GLYATL3", "0.90734", "4.59E-05", "0.001876", "4.291841", "Up", "glycine-N-acyltransferase like 3"], ["UGT2A1", "0.870199", "4.69E-05", "0.001883", "4.286149", "Up", "UDP glucuronosyltransferase family 2 member A1 complex locus"], ["RERG", "0.939549", "4.69E-05", "0.001883", "4.286306", "Up", "RAS like estrogen regulated growth inhibitor"], ["CELA2A", "0.924629", "4.7E-05", "0.001883", "4.285588", "Up", "chymotrypsin like elastase 2A"], ["LRFN5", "0.946274", "4.8E-05", "0.001915", "4.279702", "Up", "leucine rich repeat and fibronectin type III domain containing 5"], ["PAX3", "0.826938", "4.83E-05", "0.001921", "4.27827", "Up", "paired box 3"], ["KIF1A", "0.973095", "4.86E-05", "0.001927", "4.276802", "Up", "kinesin family member 1A"], ["MRGPRE", "0.86341", "4.93E-05", "0.001952", "4.272623", "Up", "MAS related GPR family member E"], ["NPY", "0.877892", "4.99E-05", "0.001962", "4.269525", "Up", "neuropeptide Y"], ["EFS", "1.003465", "5E-05", "0.001962", "4.269001", "Up", "embryonal Fyn-associated substrate"], ["ZSCAN1", "0.921942", "5.02E-05", "0.001962", "4.26778", "Up", "zinc finger and SCAN domain containing 1"], ["MEIOB", "0.971239", "5.03E-05", "0.001962", "4.267016", "Up", "meiosis specific with OB-fold"], ["TMPRSS15", "0.884284", "5.02E-05", "0.001962", "4.267806", "Up", "transmembrane serine protease 15"], ["DRD2", "0.861436", "5.04E-05", "0.001962", "4.266826", "Up", "dopamine receptor D2"], ["CNMD", "0.959271", "5.05E-05", "0.001963", "4.266074", "Up", "chondromodulin"], ["AMBP", "0.883904", "5.08E-05", "0.001966", "4.264596", "Up", "alpha-1-microglobulin/bikunin precursor"], ["C8orf34", "0.874882", "5.16E-05", "0.00198", "4.260541", "Up", "chromosome 8 open reading frame 34"], ["EGR4", "0.93485", "5.19E-05", "0.001987", "4.25858", "Up", "early growth response 4"], ["LGALS7", "0.958985", "5.24E-05", "0.001987", "4.255983", "Up", "galectin 7", ""], ["INHA", "0.858348", "5.23E-05", "0.001987", "4.256562", "Up", "inhibin subunit alpha"], ["MNX1", "0.845332", "5.28E-05", "0.00199", "4.254289", "Up", "motor neuron and pancreas homeobox 1"], ["SLC10A1", "0.889098", "5.41E-05", "0.002017", "4.247721", "Up", "solute carrier family 10 member 1"], ["NPBWR1", "0.965049", "5.42E-05", "0.002017", "4.246995", "Up", "neuropeptides B and W receptor 1"], ["PMF1-BGLAP", "0.976467", "5.45E-05", "0.002025", "4.245385", "Up", "PMF1-BGLAP readthrough"], ["LHCGR", "0.897295", "5.57E-05", "0.002041", "4.239485", "Up", "luteinizing hormone/choriogonadotropin receptor"], ["NT5C1A", "0.86506", "5.59E-05", "0.002041", "4.238871", "Up", "5′-nucleotidase, cytosolic IA"], ["ASCL1", "0.918002", "5.6E-05", "0.002041", "4.238038", "Up", "achaete-scute family bHLH transcription factor 1"], ["CCDC140", "0.969595", "5.61E-05", "0.002041", "4.237583", "Up", "coiled-coil domain containing 140"], ["NEUROG3", "0.951564", "5.79E-05", "0.002073", "4.229287", "Up", "neurogenin 3"], ["TMC2", "1.236136", "5.62E-05", "0.002041", "4.237443", "Up", "transmembrane channel like 2"], ["MINDY4B", "1.034321", "5.81E-05", "0.002073", "4.228387", "Up", "MINDY family member 4B"], ["COL3A1", "0.899332", "5.86E-05", "0.002073", "4.226076", "Up", "collagen type III alpha 1 chain"], ["SLCO6A1", "0.920379", "5.89E-05", "0.002073", "4.224473", "Up", "solute carrier organic anion transporter family member 6A1"], ["THRSP", "0.891603", "5.93E-05", "0.002073", "4.222727", "Up", "thyroid hormone responsive"], ["DBX2", "0.883726", "5.93E-05", "0.002073", "4.222452", "Up", "developing brain homeobox 2"], ["OR52N5", "0.874656", "5.94E-05", "0.002073", "4.221942", "Up", "olfactory receptor family 52 subfamily N member 5"], ["ANO4", "0.891458", "5.95E-05", "0.002073", "4.22163", "Up", "anoctamin 4"], ["RPRML", "1.013736", "5.96E-05", "0.002073", "4.22104", "Up", "reprimo like"], ["LIPM", "0.857463", "5.97E-05", "0.002073", "4.220906", "Up", "lipase family member M"], ["EFCAB3", "0.930354", "5.98E-05", "0.002073", "4.220334", "Up", "EF-hand calcium binding domain 3"], ["LRRC2-AS1", "0.891603", "5.99E-05", "0.002073", "4.220002", "Up", "LRRC2 antisense RNA 1"], ["GJA1", "0.940111", "5.94E-05", "0.002073", "4.222116", "Up", "gap junction protein alpha 1"], ["OR51E1", "0.966601", "6.13E-05", "0.002103", "4.21374", "Up", "olfactory receptor family 51 subfamily E member 1"], ["ANP32D", "0.855187", "6.14E-05", "0.002103", "4.213256", "Up", "acidic nuclear phosphoprotein 32 family member D"], ["FMC1-LUC7L2", "0.914577", "6.21E-05", "0.002109", "4.21018", "Up", "FMC1-LUC7L2 readthrough"], ["PRLHR", "0.905404", "6.26E-05", "0.002114", "4.207869", "Up", "prolactin releasing hormone receptor"], ["PPFIA2", "0.962581", "6.28E-05", "0.002114", "4.206985", "Up", "PTPRF interacting protein alpha 2"], ["IRX5", "0.930915", "6.35E-05", "0.002124", "4.203899", "Up", "iroquoishomeobox 5"], ["CSRNP3", "0.893691", "6.37E-05", "0.002125", "4.20305", "Up", "cysteine and serine rich nuclear protein 3"], ["DAND5", "0.869683", "6.39E-05", "0.002125", "4.20215", "Up", "DAN domain BMP antagonist family member 5"], ["NKAIN4", "0.986106", "6.38E-05", "0.002125", "4.202648", "Up", "sodium/potassium transporting ATPase interacting 4"], ["TMPRSS11B", "0.859699", "6.45E-05", "0.002126", "4.19958", "Up", "transmembrane serine protease 11B"], ["GULP1", "0.98403", "6.48E-05", "0.002126", "4.198514", "Up", "GULP PTB domain containing engulfment adaptor 1"], ["ADGRL4", "0.967777", "6.53E-05", "0.002135", "4.196582", "Up", "adhesion G protein-coupled receptor L4"], ["HOXD8", "0.897017", "6.6E-05", "0.002143", "4.193495", "Up", "homeobox D8"], ["OR52N1", "0.839763", "6.66E-05", "0.002154", "4.191133", "Up", "olfactory receptor family 52 subfamily N member 1"], ["LINC01555", "0.897816", "6.66E-05", "0.002154", "4.190957", "Up", "long intergenic non-protein coding RNA 1555"], ["CA10", "1.011486", "6.89E-05", "0.002212", "4.181597", "Up", "carbonic anhydrase 10"], ["CYP2W1", "0.875193", "7.07E-05", "0.002224", "4.174858", "Up", "cytochrome P450 family 2 subfamily W member 1"], ["CCDC27", "0.885529", "7.08E-05", "0.002224", "4.174477", "Up", "coiled-coil domain containing 27"], ["MYH7", "0.885529", "7.08E-05", "0.002224", "4.174477", "Up", "myosin heavy chain 7"], ["GNAT1", "0.885529", "7.08E-05", "0.002224", "4.174477", "Up", "G protein subunit alpha transducin 1"], ["NPPC", "0.964362", "7.36E-05", "0.002263", "4.163694", "Up", "natriuretic peptide C"], ["CBLC", "0.891165", "7.5E-05", "0.002292", "4.158584", "Up", "Cbl proto-oncogene C"], ["TRIM55", "0.945582", "7.46E-05", "0.002284", "4.160085", "Up", "tripartite motif containing 55"], ["EEF1G", "0.83887", "7.57E-05", "0.002293", "4.155878", "Up", "eukaryotic translation elongation factor 1 gamma"], ["ADCYAP1R1", "0.896389", "7.58E-05", "0.002293", "4.155685", "Up", "ADCYAP receptor type I"], ["TAFA4", "0.838908", "7.58E-05", "0.002293", "4.155485", "Up", "TAFA chemokine like family member 4"], ["OVOL1", "0.884916", "7.57E-05", "0.002293", "4.156118", "Up", "ovo like transcriptional repressor 1"], ["EFEMP1", "0.913807", "7.67E-05", "0.002304", "4.152284", "Up", "EGF containing fibulin extracellular matrix protein 1"], ["SLC36A2", "0.897775", "7.69E-05", "0.002304", "4.151795", "Up", "solute carrier family 36 member 2"], ["SPINK13", "0.860333", "7.76E-05", "0.002322", "4.149133", "Up", "serine peptidase inhibitor, Kazal type 13 (putative)"], ["CCDC158", "0.832487", "7.97E-05", "0.002364", "4.141709", "Up", "coiled-coil domain containing 158"], ["RBAK-RBAKDN", "0.916027", "8.11E-05", "0.002396", "4.137123", "Up", "RBAK-RBAKDN readthrough"], ["CCL17", "0.896315", "8.25E-05", "0.002434", "4.132223", "Up", "C-C motif chemokine ligand 17"], ["SELE", "0.850167", "8.29E-05", "0.002443", "4.130829", "Up", "selectin E", ""], ["GOLGA6B", "0.9457", "8.37E-05", "0.002446", "4.128465", "Up", "golgin A6 family member B"], ["IGFL4", "0.850147", "8.44E-05", "0.002452", "4.125895", "Up", "IGF like family member 4"], ["CNTFR", "0.883786", "8.48E-05", "0.002457", "4.124845", "Up", "ciliaryneurotrophic factor receptor"], ["C1orf141", "0.949302", "8.51E-05", "0.00246", "4.123621", "Up", "chromosome 1 open reading frame 141"], ["NOS1", "0.932437", "8.63E-05", "0.002471", "4.119973", "Up", "nitric oxide synthase 1"], ["REG1B", "0.893055", "8.76E-05", "0.002495", "4.115883", "Up", "regenerating family member 1 beta"], ["CAPSL", "0.894376", "8.79E-05", "0.002501", "4.114845", "Up", "calcyphosine like"], ["C1QTNF7", "0.883655", "8.86E-05", "0.002513", "4.112561", "Up", "C1q and TNF related 7"], ["RHBDL2", "0.883638", "8.88E-05", "0.002513", "4.111975", "Up", "rhomboid like 2"], ["TEAD4", "0.893342", "8.91E-05", "0.002513", "4.111195", "Up", "TEA domain transcription factor 4"], ["PRRX1", "0.923623", "8.93E-05", "0.002513", "4.110382", "Up", "paired related homeobox 1"], ["SERPINB12", "0.833849", "8.95E-05", "0.002513", "4.109731", "Up", "serpin family B member 12"], ["TBX10", "0.833115", "9E-05", "0.002513", "4.108444", "Up", "T-box transcription factor 10"], ["COL6A5", "0.920311", "9.01E-05", "0.002513", "4.108069", "Up", "collagen type VI alpha 5 chain"], ["KLK4", "0.837318", "9.03E-05", "0.002513", "4.107393", "Up", "kallikrein related peptidase 4"], ["GRIN2B", "0.950071", "9.06E-05", "0.002513", "4.106573", "Up", "glutamate ionotropic receptor NMDA type subunit 2B"], ["RGS20", "0.900519", "9.07E-05", "0.002513", "4.106097", "Up", "regulator of G protein signaling 20"], ["ZNF728", "0.883605", "9.14E-05", "0.002515", "4.103954", "Up", "zinc finger protein 728"], ["SIX4", "0.85187", "9.18E-05", "0.002518", "4.102815", "Up", "SIX homeobox 4"], ["NPFFR2", "0.929088", "9.21E-05", "0.002521", "4.101991", "Up", "neuropeptide FF receptor 2"], ["ANKRD62", "0.899096", "9.23E-05", "0.002521", "4.101348", "Up", "ankyrin repeat domain 62"], ["CLLU1", "1.132069", "9.03E-05", "0.002513", "4.10742", "Up", "chronic lymphocytic leukemia up-regulated 1"], ["CNTNAP4", "0.914215", "9.32E-05", "0.002528", "4.09853", "Up", "contactin associated protein like 4"], ["COL12A1", "0.912316", "9.56E-05", "0.002587", "4.091597", "Up", "collagen type XII alpha 1 chain"], ["EBF3", "0.839069", "9.7E-05", "0.002604", "4.087742", "Up", "EBF transcription factor 3"], ["GRIA4", "0.979336", "9.8E-05", "0.002614", "4.084733", "Up", "glutamate ionotropic receptor AMPA type subunit 4"], ["PTHLH", "0.963725", "9.8E-05", "0.002614", "4.08484", "Up", "parathyroid hormone like hormone"], ["SLC9A2", "0.881992", "9.82E-05", "0.002614", "4.084262", "Up", "solute carrier family 9 member A2"], ["HEPHL1", "0.882607", "9.86E-05", "0.002619", "4.083035", "Up", "hephaestin like 1"], ["SCG3", "0.893171", "9.91E-05", "0.00262", "4.081758", "Up", "secretogranin III"], ["SIX1", "0.921197", "9.92E-05", "0.00262", "4.081507", "Up", "SIX homeobox 1"], ["TSPYL6", "0.891306", "9.97E-05", "0.002628", "4.07987", "Up", "TSPY like 6"], ["IRGC", "0.839346", "0.0001", "0.002634", "4.078065", "Up", "immunity related GTPase cinema"], ["GPR6", "0.930096", "0.000101", "0.00264", "4.076739", "Up", "G protein-coupled receptor 6"], ["SCN3B", "0.832646", "0.000101", "0.00264", "4.076478", "Up", "sodium voltage-gated channel beta subunit 3"], ["EMILIN3", "0.967257", "0.000102", "0.002653", "4.074049", "Up", "elastin microfibrilinterfacer 3"], ["EPN3", "0.914055", "0.000104", "0.002683", "4.068937", "Up", "epsin 3", ""], ["PDLIM4", "0.933994", "0.000104", "0.002683", "4.068455", "Up", "PDZ and LIM domain 4"], ["DCC", "1.037614", "0.000106", "0.002705", "4.06329", "Up", "DCC netrin 1 receptor"], ["IL9", "0.854817", "0.000107", "0.002723", "4.060443", "Up", "interleukin 9"], ["GRM5", "0.826169", "0.000108", "0.002744", "4.057559", "Up", "glutamate metabotropic receptor 5"], ["ODF3L2", "0.894219", "0.000108", "0.002744", "4.057227", "Up", "outer dense fiber of sperm tails 3 like 2"], ["C5orf60", "0.929657", "0.000113", "0.002843", "4.044374", "Up", "chromosome 5 open reading frame 60"], ["LRRC3B", "0.885916", "0.000114", "0.002843", "4.042437", "Up", "leucine rich repeat containing 3B"], ["NLRP14", "0.859959", "0.000114", "0.002843", "4.043418", "Up", "NLR family pyrin domain containing 14"], ["SLC25A51P4", "0.889805", "0.000117", "0.002902", "4.035322", "Up", "SLC25A51 pseudogene 4"], ["FOXD4L4", "0.839378", "0.00012", "0.002931", "4.028918", "Up", "forkhead box D4 like 4"], ["PGR", "0.831922", "0.00012", "0.002931", "4.028878", "Up", "progesterone receptor"], ["PRL", "1.125879", "0.000118", "0.002906", "4.034159", "Up", "prolactin", ""], ["C3orf79", "0.857368", "0.000121", "0.00294", "4.025807", "Up", "chromosome 3 open reading frame 79"], ["SERPIND1", "0.906509", "0.000121", "0.002937", "4.0271", "Up", "serpin family D member 1"], ["S100A7A", "0.847703", "0.000122", "0.002953", "4.023133", "Up", "S100 calcium binding protein A7A"], ["EN1", "0.9169", "0.000124", "0.002964", "4.018471", "Up", "engrailed homeobox 1"], ["KRT38", "1.042088", "0.000125", "0.002971", "4.016678", "Up", "keratin 38"], ["LINC02108", "0.846143", "0.000126", "0.002975", "4.014499", "Up", "long intergenic non-protein coding RNA 2108"], ["GPR158", "0.831736", "0.000126", "0.002975", "4.013975", "Up", "G protein-coupled receptor 158"], ["ACSM6", "0.908554", "0.000128", "0.002993", "4.011439", "Up", "acyl-CoA synthetase medium chain family member 6"], ["ASPA", "0.871659", "0.000129", "0.003", "4.007633", "Up", "aspartoacylase"], ["SH3GL2", "0.918924", "0.000132", "0.003024", "4.001385", "Up", "SH3 domain containing GRB2 like 2, endophilin A1"], ["HAO1", "0.826311", "0.000133", "0.00303", "4.000253", "Up", "hydroxyacid oxidase 1"], ["PDPN", "0.889264", "0.000134", "0.003031", "3.996743", "Up", "podoplanin"], ["CWH43", "0.839103", "0.000135", "0.003032", "3.996334", "Up", "cell wall biogenesis 43 C-terminal homolog"], ["OR6S1", "0.835524", "0.000135", "0.003042", "3.994961", "Up", "olfactory receptor family 6 subfamily S member 1"], ["OR51B4", "0.827743", "0.000137", "0.003053", "3.992138", "Up", "olfactory receptor family 51 subfamily B member 4"], ["NPBWR2", "0.868277", "0.000138", "0.003069", "3.989344", "Up", "neuropeptides B and W receptor 2"], ["THSD4", "0.846128", "0.000138", "0.003069", "3.988521", "Up", "thrombospondin type 1 domain containing 4"], ["ADAMTS9", "0.834461", "0.000139", "0.003069", "3.988039", "Up", "ADAM metallopeptidase with thrombospondin type 1 motif 9"], ["FOXQ1", "1.443796", "0.000136", "0.003044", "3.993401", "Up", "forkhead box Q1"], ["PLN", "0.949551", "0.000139", "0.00307", "3.986876", "Up", "phospholamban"], ["MAP3K19", "0.87061", "0.000141", "0.00309", "3.982479", "Up", "mitogen-activated protein kinase kinasekinase 19"], ["CSNK1A1L", "1.098186", "0.000141", "0.00309", "3.983183", "Up", "casein kinase 1 alpha 1 like"], ["BARX2", "0.902302", "0.000142", "0.003091", "3.981995", "Up", "BARX homeobox 2"], ["ISY1-RAB43", "0.930431", "0.000143", "0.003092", "3.980065", "Up", "ISY1-RAB43 readthrough"], ["NELL1", "0.869267", "0.000146", "0.003138", "3.972653", "Up", "neural EGFL like 1"], ["WT1", "0.833065", "0.000148", "0.003154", "3.968739", "Up", "WT1 transcription factor"], ["CTCFL", "0.834806", "0.000151", "0.003178", "3.963845", "Up", "CCCTC-binding factor like"], ["REG1A", "0.848322", "0.000151", "0.003178", "3.962989", "Up", "regenerating family member 1 alpha"], ["CELA2B", "0.861666", "0.000153", "0.003182", "3.960649", "Up", "chymotrypsin like elastase 2B"], ["PRELP", "0.854017", "0.000153", "0.003182", "3.960358", "Up", "proline and arginine rich end leucine rich repeat protein"], ["CNTN2", "0.848239", "0.000154", "0.003184", "3.958439", "Up", "contactin 2"], ["CRP", "0.836218", "0.000154", "0.003184", "3.958316", "Up", "C-reactive protein"], ["GGTLC2", "0.890003", "0.000157", "0.003207", "3.953599", "Up", "gamma-glutamyltransferase light chain 2"], ["FSD2", "0.856494", "0.000156", "0.003207", "3.953925", "Up", "fibronectin type III and SPRY domain containing 2"], ["MYH4", "0.862217", "0.000157", "0.003207", "3.953188", "Up", "myosin heavy chain 4"], ["TUBA3C", "0.881504", "0.00016", "0.003247", "3.947266", "Up", "tubulin alpha 3c"], ["HSD11B2", "0.865869", "0.000164", "0.003268", "3.941252", "Up", "hydroxysteroid 11-beta dehydrogenase 2"], ["MKRN2OS", "0.852903", "0.000164", "0.003273", "3.940266", "Up", "MKRN2 opposite strand"], ["SYT4", "0.859298", "0.000164", "0.003275", "3.939713", "Up", "synaptotagmin 4"], ["TM4SF20", "0.900136", "0.000167", "0.003292", "3.934626", "Up", "transmembrane 4 L six family member 20"], ["LRP2", "0.963595", "0.000167", "0.003292", "3.935053", "Up", "LDL receptor related protein 2"], ["ADAM7", "0.872506", "0.00017", "0.00331", "3.930757", "Up", "ADAM metallopeptidase domain 7"], ["GPR15", "0.902774", "0.000212", "0.003705", "3.867416", "Up", "G protein-coupled receptor 15"], ["SMTNL2", "0.867183", "0.000173", "0.00334", "3.92602", "Up", "smoothelin like 2"], ["APOH", "0.921926", "0.000173", "0.00334", "3.924941", "Up", "apolipoprotein H"], ["FCAMR", "0.946932", "0.000174", "0.003343", "3.924287", "Up", "Fc fragment of IgA and IgM receptor"], ["TRPA1", "0.914295", "0.000175", "0.003346", "3.922484", "Up", "transient receptor potential cation channel subfamily A member 1"], ["WIF1", "0.847809", "0.000176", "0.00336", "3.919958", "Up", "WNT inhibitory factor 1"], ["CLDN20", "0.883524", "0.000177", "0.003361", "3.919207", "Up", "claudin 20"], ["OPRM1", "0.913422", "0.000177", "0.003361", "3.919346", "Up", "opioid receptor mu 1"], ["CCDC198", "0.938346", "0.000177", "0.003364", "3.918639", "Up", "coiled-coil domain containing 198"], ["FREM3", "0.956335", "0.000182", "0.003437", "3.910621", "Up", "FRAS1 related extracellular matrix 3"], ["ANKRD18B", "1.013694", "0.000183", "0.003441", "3.908794", "Up", "ankyrin repeat domain 18B"], ["AMY1A", "0.94182", "0.000183", "0.003441", "3.908943", "Up", "amylase alpha 1A"], ["C2orf80", "0.907847", "0.000188", "0.003491", "3.902387", "Up", "chromosome 2 open reading frame 80"], ["SP9", "0.90324", "0.000188", "0.003492", "3.901414", "Up", "Sp9 transcription factor"], ["SLCO1C1", "0.9077", "0.000194", "0.003562", "3.89294", "Up", "solute carrier organic anion transporter family member 1C1"], ["RFX6", "0.897237", "0.000195", "0.003562", "3.891995", "Up", "regulatory factor X6"], ["MRO", "0.892061", "0.000195", "0.003563", "3.891612", "Up", "maestro", ""], ["THSD7B", "0.829227", "0.000196", "0.003567", "3.890001", "Up", "thrombospondin type 1 domain containing 7B"], ["C11orf44", "0.825633", "0.000197", "0.003573", "3.888583", "Up", "chromosome 11 open reading frame 44"], ["PDE11A", "0.882109", "0.0002", "0.003608", "3.88364", "Up", "phosphodiesterase 11A"], ["BTC", "0.842319", "0.000202", "0.003619", "3.881898", "Up", "betacellulin"], ["C14orf39", "0.852061", "0.000202", "0.003625", "3.881117", "Up", "chromosome 14 open reading frame 39"], ["KCNIP1", "0.831954", "0.000203", "0.003634", "3.879927", "Up", "potassium voltage-gated channel interacting protein 1"], ["DDC", "0.899141", "0.000205", "0.003655", "3.876928", "Up", "dopa decarboxylase"], ["KRTAP10–5", "0.83581", "0.000206", "0.003664", "3.875023", "Up", "keratin associated protein 10–5"], ["B3GALT1", "0.865828", "0.000207", "0.003672", "3.874106", "Up", "beta-1,3-galactosyltransferase 1"], ["KCNT2", "0.882533", "0.000209", "0.003692", "3.871085", "Up", "potassium sodium-activated channel subfamily T member 2"], ["OTOGL", "1.017886", "0.000211", "0.003705", "3.868493", "Up", "otogelin like"], ["ELAVL3", "0.837778", "0.000213", "0.00371", "3.86572", "Up", "ELAV like RNA binding protein 3"], ["CFHR1", "0.865906", "0.000214", "0.003716", "3.864405", "Up", "complement factor H related 1"], ["PLA2G5", "0.83062", "0.000216", "0.00373", "3.862104", "Up", "phospholipase A2 group V"], ["FOLH1", "0.917208", "0.000217", "0.003735", "3.861207", "Up", "folate hydrolase 1"], ["LPA", "0.875646", "0.000221", "0.003777", "3.856187", "Up", "lipoprotein(a)"], ["LOC100130449", "0.831124", "0.000221", "0.003777", "3.855362", "Up", "uncharacterized LOC100130449"], ["LINC00923", "0.918504", "0.000222", "0.003777", "3.854828", "Up", "long intergenic non-protein coding RNA 923"], ["TERB2", "0.876286", "0.000222", "0.003777", "3.854536", "Up", "telomere repeat binding bouquet formation protein 2"], ["HHIP", "0.825721", "0.000222", "0.003777", "3.854168", "Up", "hedgehog interacting protein"], ["DRGX", "0.842289", "0.000228", "0.003835", "3.846389", "Up", "dorsal root ganglia homeobox"], ["SERPINA9", "0.84755", "0.000228", "0.003835", "3.846199", "Up", "serpin family A member 9"], ["PRKAA2", "0.894063", "0.000233", "0.003871", "3.840763", "Up", "protein kinase AMP-activated catalytic subunit alpha 2"], ["MMP27", "0.867836", "0.000236", "0.003895", "3.837287", "Up", "matrix metallopeptidase 27"], ["NPNT", "0.90569", "0.000236", "0.003899", "3.836429", "Up", "nephronectin"], ["SLC51B", "0.839976", "0.000238", "0.003904", "3.834684", "Up", "solute carrier family 51 beta subunit"], ["C3orf80", "0.904281", "0.000236", "0.003895", "3.836993", "Up", "chromosome 3 open reading frame 80"], ["SOX2", "0.869644", "0.000238", "0.003904", "3.834656", "Up", "SRY-box transcription factor 2"], ["EYA1", "1.078018", "0.000237", "0.003901", "3.835456", "Up", "EYA transcriptional coactivator and phosphatase 1"], ["SI", "0.880135", "0.00024", "0.003926", "3.831805", "Up", "sucrase-isomaltase"], ["TIMP4", "0.90339", "0.000241", "0.00393", "3.83074", "Up", "TIMP metallopeptidase inhibitor 4"], ["LARP6", "0.890316", "0.00024", "0.003926", "3.831332", "Up", "La ribonucleoprotein 6, translational regulator"], ["MOGAT2", "0.833587", "0.000243", "0.003943", "3.828618", "Up", "monoacylglycerol O-acyltransferase 2"], ["OR1L3", "0.835533", "0.000243", "0.003943", "3.82828", "Up", "olfactory receptor family 1 subfamily L member 3"], ["CACNA1G", "0.912907", "0.000243", "0.003943", "3.828145", "Up", "calcium voltage-gated channel subunit alpha1 G"], ["CRX", "0.89157", "0.000243", "0.003944", "3.8278", "Up", "cone-rod homeobox"], ["PPP2R2C", "0.882852", "0.000247", "0.00397", "3.824007", "Up", "protein phosphatase 2 regulatory subunit Bgamma"], ["SLC30A3", "0.892961", "0.000248", "0.003978", "3.822534", "Up", "solute carrier family 30 member 3"], ["RHOJ", "0.860054", "0.000252", "0.004016", "3.81792", "Up", "ras homolog family member J"], ["KCNJ13", "0.853986", "0.000256", "0.004054", "3.813553", "Up", "potassium inwardly rectifying channel subfamily J member 13"], ["HAS2", "0.882356", "0.000257", "0.004062", "3.812592", "Up", "hyaluronan synthase 2"], ["KRTAP10–6", "0.879999", "0.000257", "0.004062", "3.811877", "Up", "keratin associated protein 10–6"], ["FFAR1", "0.88097", "0.000257", "0.004062", "3.812033", "Up", "free fatty acid receptor 1"], ["FGF6", "0.835818", "0.000259", "0.004077", "3.810292", "Up", "fibroblast growth factor 6"], ["OTX2", "1.0534", "0.000267", "0.004169", "3.800608", "Up", "orthodenticlehomeobox 2"], ["CLRN2", "0.823406", "0.000269", "0.004182", "3.798898", "Up", "clarin 2", ""], ["C19orf81", "0.847143", "0.000272", "0.004205", "3.795697", "Up", "chromosome 19 open reading frame 81"], ["NUPR2", "0.908781", "0.000272", "0.004205", "3.796129", "Up", "nuclear protein 2, transcriptional regulator"], ["CCN1", "0.860705", "0.000276", "0.00423", "3.791036", "Up", "cellular communication network factor 1"], ["HECW1", "0.933254", "0.000278", "0.004243", "3.789303", "Up", "HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1"], ["PTGER1", "0.840067", "0.000279", "0.004243", "3.788337", "Up", "prostaglandin E receptor 1"], ["CDH15", "0.86729", "0.00028", "0.004248", "3.787447", "Up", "cadherin 15"], ["CLVS2", "0.851515", "0.000281", "0.004253", "3.786814", "Up", "clavesin 2"], ["LY6G6F-LY6G6D", "0.856601", "0.000281", "0.004261", "3.78581", "Up", "LY6G6F-LY6G6D readthrough"], ["CYP4X1", "0.824815", "0.000288", "0.004307", "3.779012", "Up", "cytochrome P450 family 4 subfamily X member 1"], ["MYOG", "0.879018", "0.000289", "0.004307", "3.778098", "Up", "myogenin"], ["RFPL4AL1", "1.159429", "0.000295", "0.00436", "3.772636", "Up", "ret finger protein like 4A like 1"], ["LRRC8E", "0.830259", "0.0003", "0.004418", "3.767782", "Up", "leucine rich repeat containing 8 VRAC subunit E"], ["NXPE1", "0.860153", "0.000302", "0.004436", "3.765215", "Up", "neurexophilin and PC-esterase domain family member 1"], ["KIF25", "0.853635", "0.000304", "0.004441", "3.763906", "Up", "kinesin family member 25"], ["CBLN2", "0.966722", "0.000305", "0.004454", "3.762634", "Up", "cerebellin 2 precursor"], ["AREG", "0.901451", "0.000308", "0.004485", "3.759795", "Up", "amphiregulin"], ["SPATA8", "0.878422", "0.000311", "0.004508", "3.7569", "Up", "spermatogenesis associated 8"], ["GCGR", "0.86834", "0.000311", "0.004508", "3.756813", "Up", "glucagon receptor"], ["OR51E2", "1.003339", "0.000313", "0.004529", "3.754696", "Up", "olfactory receptor family 51 subfamily E member 2"], ["RPE65", "0.835844", "0.000315", "0.004549", "3.752653", "Up", "retinoid isomerohydrolase RPE65"], ["LAMA4", "0.925931", "0.000318", "0.004572", "3.750191", "Up", "laminin subunit alpha 4"], ["GABRA4", "0.9215", "0.000322", "0.004599", "3.747009", "Up", "gamma-aminobutyric acid type A receptor alpha4 subunit"], ["MFAP2", "0.972218", "0.000324", "0.004611", "3.74445", "Up", "microfibril associated protein 2"], ["WFDC5", "0.84266", "0.000328", "0.004639", "3.740917", "Up", "WAP four-disulfide core domain 5"], ["IGSF21", "0.851515", "0.000331", "0.004652", "3.738722", "Up", "immunoglobin superfamily member 21"], ["C17orf102", "0.839208", "0.000332", "0.004669", "3.737396", "Up", "chromosome 17 open reading frame 102"], ["A2ML1", "0.846661", "0.000334", "0.004675", "3.73642", "Up", "alpha-2-macroglobulin like 1"], ["PLA2G3", "0.828347", "0.000334", "0.004675", "3.73607", "Up", "phospholipase A2 group III"], ["C1orf229", "0.851752", "0.000335", "0.004681", "3.735201", "Up", "chromosome 1 open reading frame 229"], ["PLA2G10", "0.831528", "0.000345", "0.004783", "3.726918", "Up", "phospholipase A2 group X"], ["UTF1", "0.940212", "0.000346", "0.004796", "3.725564", "Up", "undifferentiated embryonic cell transcription factor 1"], ["CELF4", "0.871614", "0.00035", "0.004827", "3.722421", "Up", "CUGBP Elav-like family member 4"], ["BTBD16", "0.859346", "0.000354", "0.004868", "3.71863", "Up", "BTB domain containing 16"], ["TMPRSS12", "0.87545", "0.000356", "0.004868", "3.717707", "Up", "transmembrane serine protease 12"], ["SPRY4", "0.899144", "0.000369", "0.004997", "3.707011", "Up", "sprouty RTK signaling antagonist 4"], ["FUT6", "0.88066", "0.000369", "0.004997", "3.706933", "Up", "fucosyltransferase 6"], ["LINC01551", "0.87545", "0.000372", "0.005023", "3.704451", "Up", "long intergenic non-protein coding RNA 1551"], ["GNG12", "0.937701", "0.000372", "0.005023", "3.704226", "Up", "G protein subunit gamma 12"], ["RD3", "0.880776", "0.000374", "0.005038", "3.703076", "Up", "retinal degeneration 3, GUCY2D regulator"], ["DKK1", "0.950344", "0.000383", "0.005138", "3.695639", "Up", "dickkopf WNT signaling pathway inhibitor 1"], ["NUTM2F", "0.890116", "0.000384", "0.005147", "3.694933", "Up", "NUT family member 2F"], ["NPAP1", "0.841125", "0.000385", "0.00515", "3.694524", "Up", "nuclear pore associated protein 1"], ["PDE10A", "0.838498", "0.000402", "0.005283", "3.681647", "Up", "phosphodiesterase 10A"], ["BDKRB2", "0.859999", "0.000401", "0.005283", "3.681948", "Up", "bradykinin receptor B2"], ["HES5", "0.898473", "0.000404", "0.005292", "3.680429", "Up", "hes family bHLH transcription factor 5"], ["SCEL", "0.834584", "0.000413", "0.005347", "3.673264", "Up", "sciellin", ""], ["TMIGD1", "0.827595", "0.000413", "0.005347", "3.673264", "Up", "transmembrane and immunoglobulin domain containing 1"], ["PDE1A", "0.866557", "0.000413", "0.005347", "3.673886", "Up", "phosphodiesterase 1A"], ["GOLGA8G", "1.023375", "0.000419", "0.005389", "3.669375", "Up", "golgin A8 family member G"], ["C12orf77", "0.836295", "0.000436", "0.005501", "3.657361", "Up", "chromosome 12 open reading frame 77"], ["PRSS12", "0.917236", "0.000437", "0.005502", "3.65691", "Up", "serine protease 12"], ["RBM46", "0.951241", "0.000438", "0.005502", "3.6564", "Up", "RNA binding motif protein 46"], ["KRT78", "0.835349", "0.000439", "0.005502", "3.655735", "Up", "keratin 78"], ["TAC4", "0.866135", "0.00044", "0.005508", "3.654937", "Up", "tachykinin precursor 4"], ["KRBOX1", "0.865226", "0.000439", "0.005502", "3.655612", "Up", "KRAB box domain containing 1"], ["PERM1", "0.85926", "0.000442", "0.005508", "3.6534", "Up", "PPARGC1 and ESRR induced regulator, muscle 1"], ["CAPN9", "0.968118", "0.000455", "0.005612", "3.644617", "Up", "calpain 9", ""], ["MAS1", "0.874605", "0.000469", "0.005723", "3.635607", "Up", "MAS1 proto-oncogene, G protein-coupled receptor"], ["ALDOB", "0.840212", "0.000481", "0.005821", "3.628603", "Up", "aldolase, fructose-bisphosphate B"], ["FAM131C", "0.843355", "0.000483", "0.005829", "3.627366", "Up", "family with sequence similarity 131 member C"], ["FAM71D", "1.002051", "0.000482", "0.005825", "3.628064", "Up", "family with sequence similarity 71 member D"], ["TMEM72", "0.847662", "0.000505", "0.005976", "3.613798", "Up", "transmembrane protein 72"], ["GSX2", "0.884597", "0.000505", "0.005976", "3.613792", "Up", "GS homeobox 2"], ["RASA4B", "1.064804", "0.000499", "0.005946", "3.617563", "Up", "RAS p21 protein activator 4B"], ["HSPB2", "0.843999", "0.000508", "0.005984", "3.611888", "Up", "heat shock protein family B (small) member 2"], ["FSTL5", "0.877677", "0.000523", "0.006098", "3.603482", "Up", "follistatin like 5"], ["RAX2", "0.84501", "0.000525", "0.006112", "3.60243", "Up", "retina and anterior neural fold homeobox 2"], ["BCO1", "0.833952", "0.000536", "0.006202", "3.59581", "Up", "beta-carotene oxygenase 1"], ["GPR62", "0.86578", "0.000536", "0.006202", "3.595965", "Up", "G protein-coupled receptor 62"], ["CDH18", "0.829682", "0.00054", "0.006224", "3.593699", "Up", "cadherin 18"], ["HSPE1-MOB4", "0.902692", "0.000545", "0.006264", "3.590982", "Up", "HSPE1-MOB4 readthrough"], ["MEGF10", "0.828489", "0.000545", "0.006264", "3.590973", "Up", "multiple EGF like domains 10"], ["RASSF9", "0.833952", "0.000582", "0.006473", "3.571637", "Up", "Ras association domain family member 9"], ["PALM2AKAP2", "0.841084", "0.000608", "0.006683", "3.558351", "Up", "PALM2 and AKAP2 fusion"], ["ZFPM2", "0.83487", "0.000614", "0.00671", "3.555258", "Up", "zinc finger protein, FOG family member 2"], ["IL21", "0.872983", "0.00063", "0.006805", "3.547506", "Up", "interleukin 21"], ["TCHH", "0.913257", "0.000641", "0.006828", "3.542218", "Up", "trichohyalin"], ["DNAI1", "0.825247", "0.000645", "0.006844", "3.540376", "Up", "dynein axonemal intermediate chain 1"], ["LHX2", "0.825638", "0.000664", "0.006981", "3.531404", "Up", "LIM homeobox 2"], ["TCIM", "0.880336", "0.000669", "0.007015", "3.529277", "Up", "transcriptional and immune response regulator"], ["CHKB-CPT1B", "0.908843", "0.000671", "0.007024", "3.52834", "Up", "CHKB-CPT1B readthrough (NMD candidate)"], ["FAXC", "0.832545", "0.000693", "0.007167", "3.518441", "Up", "failed axon connections homolog, metaxin like GST domain containing"], ["SPECC1L-ADORA2A", "0.828726", "0.000728", "0.00737", "3.503843", "Up", "SPECC1L-ADORA2A readthrough (NMD candidate)"], ["DPP10", "0.834719", "0.000736", "0.007433", "3.500365", "Up", "dipeptidyl peptidase like 10"], ["AMER2", "0.854851", "0.000749", "0.00752", "3.494939", "Up", "APC membrane recruitment protein 2"], ["SPATA22", "1.255195", "0.000761", "0.007595", "3.490127", "Up", "spermatogenesis associated 22"], ["TMEM151A", "0.881109", "0.000781", "0.007713", "3.482345", "Up", "transmembrane protein 151A"], ["ATP1A4", "1.689421", "0.000778", "0.007691", "3.483567", "Up", "ATPase Na+/K+ transporting subunit alpha 4"], ["HOXB7", "0.989446", "0.000781", "0.007714", "3.482117", "Up", "homeobox B7"], ["CCDC169", "0.897611", "0.000815", "0.007946", "3.469141", "Up", "coiled-coil domain containing 169"], ["SPINK4", "0.843362", "0.000821", "0.007979", "3.466965", "Up", "serine peptidase inhibitor, Kazal type 4"], ["LKAAEAR1", "1.056911", "0.000821", "0.007979", "3.467037", "Up", "LKAAEAR motif containing 1"], ["BPIFC", "0.838473", "0.000822", "0.007982", "3.466596", "Up", "BPI fold containing family C"], ["EIF4E1B", "0.823457", "0.000847", "0.008124", "3.457562", "Up", "eukaryotic translation initiation factor 4E family member 1B"], ["COX8C", "0.823798", "0.000853", "0.008147", "3.455114", "Up", "cytochrome c oxidase subunit 8C"], ["MIF", "1.110365", "0.000941", "0.008696", "3.425057", "Up", "macrophage migration inhibitory factor"], ["LRRC71", "0.833583", "0.000886", "0.008347", "3.443592", "Up", "leucine rich repeat containing 71"], ["EPB41L4B", "1.108212", "0.000896", "0.008413", "3.440042", "Up", "erythrocyte membrane protein band 4.1 like 4B"], ["MYRIP", "0.847925", "0.000903", "0.008457", "3.437595", "Up", "myosin VIIA and Rab interacting protein"], ["CORO7-PAM16", "0.904171", "0.000939", "0.008696", "3.425726", "Up", "CORO7-PAM16 readthrough"], ["ZSWIM2", "0.880153", "0.000983", "0.008909", "3.411475", "Up", "zinc finger SWIM-type containing 2"], ["TPPP2", "0.85002", "0.000983", "0.008909", "3.411351", "Up", "tubulin polymerization promoting protein family member 2"], ["PTPN20", "0.978815", "0.000982", "0.008909", "3.411957", "Up", "protein tyrosine phosphatase non-receptor type 20"], ["CST8", "0.828046", "0.000998", "0.008992", "3.40695", "Up", "cystatin 8"], ["KCNH5", "0.840209", "0.001002", "0.009002", "3.405458", "Up", "potassium voltage-gated channel subfamily H member 5"], ["WFDC1", "0.88007", "0.001062", "0.009383", "3.387406", "Up", "WAP four-disulfide core domain 1"], ["OR3A1", "0.842916", "0.001063", "0.009383", "3.387314", "Up", "olfactory receptor family 3 subfamily A member 1 (gene/pseudogene)"], ["EXOC3L4", "0.847958", "0.001109", "0.009648", "3.374087", "Up", "exocyst complex component 3 like 4"], ["GHSR", "0.849126", "0.001113", "0.009673", "3.372795", "Up", "growth hormone secretagogue receptor"], ["GDA", "0.889672", "0.001119", "0.009709", "3.371151", "Up", "guanine deaminase"], ["SHISA8", "0.861981", "0.001118", "0.009704", "3.371469", "Up", "shisa family member 8"], ["ZSCAN10", "0.86053", "0.001192", "0.01015", "3.351508", "Up", "zinc finger and SCAN domain containing 10"], ["GDPD4", "0.825987", "0.001228", "0.010386", "3.342107", "Up", "glycerophosphodiesterphosphodiesterase domain containing 4"], ["C4orf48", "0.963154", "0.001242", "0.010457", "3.338544", "Up", "chromosome 4 open reading frame 48"], ["SPDEF", "0.881194", "0.001231", "0.010399", "3.341393", "Up", "SAM pointed domain containing ETS transcription factor"], ["PMCH", "0.938262", "0.001273", "0.010644", "3.330774", "Up", "pro-melanin concentrating hormone"], ["TMEM121", "1.161269", "0.001281", "0.010665", "3.328878", "Up", "transmembrane protein 121"], ["ESRP2", "0.86225", "0.001323", "0.010867", "3.318668", "Up", "epithelial splicing regulatory protein 2"], ["GOLGA6L9", "0.913468", "0.001369", "0.011101", "3.30796", "Up", "golgin A6 family like 9"], ["LRRTM2", "0.922665", "0.001414", "0.011348", "3.297763", "Up", "leucine rich repeat transmembrane neuronal 2"], ["RFX4", "0.831273", "0.001445", "0.011513", "3.290825", "Up", "regulatory factor X4"], ["FAP", "0.99642", "0.001437", "0.011476", "3.292583", "Up", "fibroblast activation protein alpha"], ["CTAGE6", "0.885238", "0.001484", "0.011748", "3.282458", "Up", "CTAGE family member 6"], ["GPC6", "0.897005", "0.001603", "0.012397", "3.257934", "Up", "glypican 6"], ["BOLA2B", "1.348547", "0.001587", "0.012335", "3.261001", "Up", "bolA family member 2B"], ["ANGPT4", "0.829222", "0.001678", "0.012731", "3.24332", "Up", "angiopoietin 4"], ["GLYATL1", "0.859167", "0.001744", "0.013066", "3.230845", "Up", "glycine-N-acyltransferase like 1"], ["ALPI", "0.83854", "0.001782", "0.013284", "3.223964", "Up", "alkaline phosphatase, intestinal"], ["LINC02312", "0.846436", "0.00182", "0.013468", "3.217256", "Up", "long intergenic non-protein coding RNA 2312"], ["MAGI1", "0.834329", "0.001979", "0.014332", "3.190204", "Up", "membrane associated guanylate kinase, WW and PDZ domain containing 1"], ["LOC105377590", "0.827061", "0.002067", "0.014767", "3.176133", "Up", "uncharacterized LOC105377590"], ["UGT2A3", "1.084825", "0.002072", "0.014775", "3.175415", "Up", "UDP glucuronosyltransferase family 2 member A3"], ["SEMA6B", "0.97473", "0.002148", "0.015121", "3.163707", "Up", "semaphorin 6B"], ["RFPL4A", "1.618683", "0.002173", "0.015241", "3.159916", "Up", "ret finger protein like 4A"], ["P2RX2", "0.823852", "0.002237", "0.015538", "3.150517", "Up", "purinergic receptor P2X 2"], ["COL1A2", "0.873234", "0.002262", "0.015671", "3.14683", "Up", "collagen type I alpha 2 chain"], ["CDKL2", "0.900439", "0.002301", "0.015857", "3.141203", "Up", "cyclin dependent kinase like 2"], ["CLUL1", "0.934087", "0.002373", "0.016257", "3.131195", "Up", "clusterin like 1"], ["MIPOL1", "0.862616", "0.002732", "0.017911", "3.084864", "Up", "mirror-image polydactyly 1"], ["PKNOX2", "0.859428", "0.002743", "0.017952", "3.083472", "Up", "PBX/knotted 1 homeobox 2"], ["TRHDE", "0.950234", "0.002983", "0.019018", "3.05568", "Up", "thyrotropin releasing hormone degrading enzyme"], ["BCAR1", "0.894146", "0.002995", "0.019072", "3.054351", "Up", "BCAR1 scaffold protein, Cas family member"], ["ZPLD1", "0.83027", "0.003108", "0.019559", "3.042048", "Up", "zonapellucida like domain containing 1"], ["ECM2", "0.881103", "0.003166", "0.019806", "3.035863", "Up", "extracellular matrix protein 2"], ["C8B", "0.83507", "0.003179", "0.019849", "3.034511", "Up", "complement C8 beta chain"], ["ZSCAN4", "0.824589", "0.003335", "0.020502", "3.018496", "Up", "zinc finger and SCAN domain containing 4"], ["DUSP15", "0.835463", "0.003583", "0.021602", "2.994384", "Up", "dual specificity phosphatase 15"], ["FSIP2", "1.051501", "0.003654", "0.021884", "2.987718", "Up", "fibrous sheath interacting protein 2"], ["GYPA", "0.838823", "0.003832", "0.022535", "2.971603", "Up", "glycophorin A (MNS blood group)"], ["MICU3", "0.836643", "0.004058", "0.023381", "2.952197", "Up", "mitochondrial calcium uptake family member 3"], ["ABCB5", "0.828852", "0.00415", "0.023751", "2.944524", "Up", "ATP binding cassette subfamily B member 5"], ["MTRNR2L1", "2.018372", "0.004535", "0.025279", "2.914228", "Up", "MT-RNR2 like 1"], ["TRAPPC5", "0.871477", "0.004667", "0.025812", "2.904327", "Up", "trafficking protein particle complex 5"], ["MYT1L", "1.20911", "0.004898", "0.026721", "2.88766", "Up", "myelin transcription factor 1 like"], ["DKK2", "0.89525", "0.005299", "0.028207", "2.860463", "Up", "dickkopf WNT signaling pathway inhibitor 2"], ["SRXN1", "1.018618", "0.005734", "0.029851", "2.832953", "Up", "sulfiredoxin 1"], ["HBZ", "1.056697", "0.005869", "0.030365", "2.824809", "Up", "hemoglobin subunit zeta"], ["GABRB3", "0.916767", "0.005973", "0.030651", "2.818616", "Up", "gamma-aminobutyric acid type A receptor beta3 subunit"], ["TDRD15", "0.860035", "0.006628", "0.033041", "2.781952", "Up", "tudor domain containing 15"], ["PDF", "0.908183", "0.00747", "0.036155", "2.739388", "Up", "peptide deformylase, mitochondrial"], ["CCDC144A", "1.387575", "0.007676", "0.036885", "2.729663", "Up", "coiled-coil domain containing 144A"], ["MRPL12", "1.043343", "0.011635", "0.049872", "2.57764", "Up", "mitochondrial ribosomal protein L12"], ["SIRPB2", "−0.47534", "8.44E-09", "4.63E-05", "−6.37763", "Down", "signal regulatory protein beta 2"], ["RNF122", "−0.40229", "1.36E-08", "4.63E-05", "−6.26932", "Down", "ring finger protein 122"], ["SYK", "−0.32942", "2.38E-08", "6.66E-05", "−6.1427", "Down", "spleen associated tyrosine kinase"], ["LASP1", "−0.39444", "7.15E-08", "0.000109", "−5.89021", "Down", "LIM and SH3 protein 1"], ["SLC44A2", "−0.3592", "1.09E-07", "0.000141", "−5.79236", "Down", "solute carrier family 44 member 2"], ["C5AR2", "−0.45692", "1.58E-07", "0.000165", "−5.70624", "Down", "complement component 5a receptor 2"], ["PRKACA", "−0.49178", "2.12E-07", "0.000197", "−5.63649", "Down", "protein kinase cAMP-activated catalytic subunit alpha"], ["TP53INP2", "−0.59653", "2.35E-07", "0.000198", "−5.61183", "Down", "tumor protein p53 inducible nuclear protein 2"], ["F11R", "−0.37662", "3.27E-07", "0.000198", "−5.53422", "Down", "F11 receptor"], ["INKA2", "−0.4438", "3.25E-07", "0.000198", "−5.5354", "Down", "inka box actin regulator 2"], ["GABARAP", "−0.49797", "3.53E-07", "0.000205", "−5.5156", "Down", "GABA type A receptor-associated protein"], ["CRTC2", "−0.48092", "3.66E-07", "0.000205", "−5.50724", "Down", "CREB regulated transcription coactivator 2"], ["RXRB", "−0.3761", "4.52E-07", "0.00023", "−5.45685", "Down", "retinoid X receptor beta"], ["CASP9", "−0.27139", "5.84E-07", "0.000258", "−5.39557", "Down", "caspase 9", ""], ["C6orf136", "−0.3863", "7.96E-07", "0.000297", "−5.321", "Down", "chromosome 6 open reading frame 136"], ["CTDSP2", "−0.32959", "7.48E-07", "0.000288", "−5.3362", "Down", "CTD small phosphatase 2"], ["DPEP2", "−0.41998", "7.56E-07", "0.000288", "−5.33349", "Down", "dipeptidase 2"], ["TMEM234", "−0.38446", "8.95E-07", "0.000313", "−5.29278", "Down", "transmembrane protein 234"], ["TMEM179B", "−0.27682", "9.14E-07", "0.000313", "−5.28769", "Down", "transmembrane protein 179B"], ["SNX11", "−0.32558", "9.47E-07", "0.000318", "−5.27902", "Down", "sorting nexin 11"], ["AGAP9", "−1.41788", "4.42E-07", "0.00023", "−5.46256", "Down", "ArfGAP with GTPase domain, ankyrin repeat and PH domain 9"], ["FAM219A", "−0.45019", "1.17E-06", "0.000376", "−5.22858", "Down", "family with sequence similarity 219 member A"], ["CSNK2B", "−0.29639", "1.41E-06", "0.00043", "−5.18303", "Down", "casein kinase 2 beta"], ["TMEM127", "−0.34378", "1.43E-06", "0.00043", "−5.1782", "Down", "transmembrane protein 127"], ["MEFV", "−0.52752", "1.62E-06", "0.00046", "−5.14816", "Down", "MEFV innate immuity regulator, pyrin"], ["KCTD21", "−0.31051", "1.92E-06", "0.000504", "−5.1065", "Down", "potassium channel tetramerization domain containing 21"], ["TMBIM1", "−0.32832", "1.86E-06", "0.0005", "−5.11415", "Down", "transmembrane BAX inhibitor motif containing 1"], ["IL17RA", "−0.4439", "1.99E-06", "0.000507", "−5.09788", "Down", "interleukin 17 receptor A"], ["RAB37", "−0.31838", "2.04E-06", "0.00051", "−5.09207", "Down", "RAB37, member RAS oncogene family"], ["GAB2", "−0.44824", "2.15E-06", "0.000532", "−5.07836", "Down", "GRB2 associated binding protein 2"], ["BLOC1S3", "−0.28757", "2.43E-06", "0.000544", "−5.04845", "Down", "biogenesis of lysosomal organelles complex 1 subunit 3"], ["APOL2", "−0.46372", "2.38E-06", "0.000544", "−5.05359", "Down", "apolipoprotein L2"], ["KIAA0319L", "−0.35586", "2.4E-06", "0.000544", "−5.05141", "Down", "KIAA0319 like"], ["SIPA1L1", "−0.37533", "2.84E-06", "0.000592", "−5.00972", "Down", "signal induced proliferation associated 1 like 1"], ["ARF3", "−0.39406", "2.86E-06", "0.000592", "−5.00779", "Down", "ADP ribosylation factor 3"], ["CASC3", "−0.28443", "2.89E-06", "0.000592", "−5.00572", "Down", "CASC3 exon junction complex subunit"], ["ARHGAP30", "−0.2905", "3.04E-06", "0.000593", "−4.99258", "Down", "Rho GTPase activating protein 30"], ["TOP3A", "−0.35048", "3.21E-06", "0.000593", "−4.97967", "Down", "DNA topoisomerase III alpha"], ["C16orf54", "−0.26747", "3.24E-06", "0.000593", "−4.97743", "Down", "chromosome 16 open reading frame 54"], ["BEST1", "−0.50351", "3.37E-06", "0.000593", "−4.96756", "Down", "bestrophin 1"], ["C6orf89", "−0.28041", "3.39E-06", "0.000593", "−4.96553", "Down", "chromosome 6 open reading frame 89"], ["SUSD6", "−0.37933", "3.37E-06", "0.000593", "−4.96707", "Down", "sushi domain containing 6"], ["STAT6", "−0.386", "3.46E-06", "0.000594", "−4.96042", "Down", "signal transducer and activator of transcription 6"], ["SH3D21", "−0.62962", "4.05E-06", "0.000648", "−4.92115", "Down", "SH3 domain containing 21"], ["FAM214B", "−0.36064", "3.72E-06", "0.000615", "−4.94269", "Down", "family with sequence similarity 214 member B"], ["AGPAT1", "−0.37351", "3.97E-06", "0.000641", "−4.92639", "Down", "1-acylglycerol-3-phosphate O-acyltransferase 1"], ["CPSF7", "−0.33791", "4.39E-06", "0.00067", "−4.90105", "Down", "cleavage and polyadenylation specific factor 7"], ["EGLN2", "−0.33487", "4.97E-06", "0.00072", "−4.86981", "Down", "egl-9 family hypoxia inducible factor 2"], ["VAMP2", "−0.32282", "5.23E-06", "0.000738", "−4.85729", "Down", "vesicle associated membrane protein 2"], ["ARHGAP1", "−0.46187", "5.32E-06", "0.000738", "−4.85289", "Down", "Rho GTPase activating protein 1"], ["CPT2", "−0.30399", "6.25E-06", "0.00082", "−4.81205", "Down", "carnitinepalmitoyltransferase 2"], ["OSCAR", "−0.4824", "7.26E-06", "0.000909", "−4.77404", "Down", "osteoclast associated Ig-like receptor"], ["EXTL3", "−0.44258", "7.37E-06", "0.00091", "−4.77025", "Down", "exostosin like glycosyltransferase 3"], ["NOMO2", "−0.58975", "8.27E-06", "0.000925", "−4.74093", "Down", "NODAL modulator 2"], ["PIK3R5", "−0.28302", "8.01E-06", "0.000925", "−4.74887", "Down", "phosphoinositide-3-kinase regulatory subunit 5"], ["IGF2R", "−0.52404", "8.21E-06", "0.000925", "−4.74277", "Down", "insulin like growth factor 2 receptor"], ["EPHX1", "−0.55423", "9.97E-06", "0.001014", "−4.6931", "Down", "epoxide hydrolase 1"], ["MAPKAPK2", "−0.29705", "8.55E-06", "0.000925", "−4.73251", "Down", "MAPK activated protein kinase 2"], ["STAT3", "−0.36483", "9.1E-06", "0.000967", "−4.71639", "Down", "signal transducer and activator of transcription 3"], ["NPIPB3", "−0.96437", "1.13E-05", "0.001075", "−4.66109", "Down", "nuclear pore complex interacting protein family member B3"], ["RNF19B", "−0.29623", "1.04E-05", "0.001038", "−4.681", "Down", "ring finger protein 19B"], ["PBX2", "−0.36625", "1.07E-05", "0.001047", "−4.67424", "Down", "PBX homeobox 2"], ["MTMR3", "−0.30993", "1.16E-05", "0.001078", "−4.65496", "Down", "myotubularin related protein 3"], ["PI4KB", "−0.32556", "1.17E-05", "0.001078", "−4.65218", "Down", "phosphatidylinositol 4-kinase beta"], ["GLYR1", "−0.33045", "1.23E-05", "0.001111", "−4.63863", "Down", "glyoxylatereductase 1 homolog"], ["TK2", "−0.30672", "1.33E-05", "0.001135", "−4.61837", "Down", "thymidine kinase 2"], ["RAF1", "−0.26209", "1.34E-05", "0.001139", "−4.61618", "Down", "Raf-1 proto-oncogene, serine/threonine kinase"], ["PPP1R10", "−0.32024", "1.44E-05", "0.001195", "−4.59736", "Down", "protein phosphatase 1 regulatory subunit 10"], ["ARRB2", "−0.26361", "1.45E-05", "0.001195", "−4.59727", "Down", "arrestin beta 2"], ["ATP6V0D1", "−0.39381", "1.45E-05", "0.001196", "−4.59576", "Down", "ATPase H+ transporting V0 subunit d1"], ["SMAP2", "−0.35835", "1.47E-05", "0.001201", "−4.59347", "Down", "small ArfGAP2"], ["KDELR1", "−0.34331", "1.53E-05", "0.001232", "−4.58193", "Down", "KDEL endoplasmic reticulum protein retention receptor 1"], ["ATP6V0A1", "−0.3471", "1.64E-05", "0.00127", "−4.5643", "Down", "ATPase H+ transporting V0 subunit a1"], ["NDST1", "−0.51316", "1.68E-05", "0.001284", "−4.55772", "Down", "N-deacetylase and N-sulfotransferase 1"], ["SF3A1", "−0.36624", "1.79E-05", "0.001319", "−4.54121", "Down", "splicing factor 3a subunit 1"], ["TPCN2", "−0.41036", "1.93E-05", "0.001352", "−4.52153", "Down", "two pore segment channel 2"], ["TAPBP", "−0.35224", "1.89E-05", "0.001335", "−4.52755", "Down", "TAP binding protein"], ["TRPC4AP", "−0.27784", "1.95E-05", "0.001354", "−4.51955", "Down", "transient receptor potential cation channel subfamily C member 4 associated protein"], ["NDE1", "−0.3477", "1.98E-05", "0.001369", "−4.51459", "Down", "nudE neurodevelopment protein 1"], ["PIGS", "−0.26132", "2.15E-05", "0.001407", "−4.49392", "Down", "phosphatidylinositol glycan anchor biosynthesis class S"], ["TIFAB", "−0.67622", "2.29E-05", "0.001441", "−4.47698", "Down", "TIFA inhibitor"], ["DGKG", "−0.35931", "2.61E-05", "0.001504", "−4.44284", "Down", "diacylglycerol kinase gamma"], ["CYTH2", "−0.27", "2.65E-05", "0.001515", "−4.43896", "Down", "cytohesin 2"], ["PDZD3", "−1.1876", "2.23E-05", "0.001411", "−4.48422", "Down", "PDZ domain containing 3"], ["PXN", "−0.40274", "2.8E-05", "0.00157", "−4.42421", "Down", "paxillin", ""], ["MOB3A", "−0.38776", "2.99E-05", "0.001621", "−4.40616", "Down", "MOB kinase activator 3A"], ["CHKB", "−0.69168", "3.78E-05", "0.001757", "−4.34418", "Down", "choline kinase beta"], ["TMEM121B", "−0.58616", "3.6E-05", "0.001757", "−4.35738", "Down", "transmembrane protein 121B"], ["PEAK3", "−0.64308", "3.86E-05", "0.001766", "−4.33852", "Down", "PEAK family member 3"], ["APOL1", "−0.43281", "3.39E-05", "0.001712", "−4.3734", "Down", "apolipoprotein L1"], ["IRF1", "−0.27784", "3.51E-05", "0.001738", "−4.36395", "Down", "interferon regulatory factor 1"], ["MINDY1", "−0.37272", "3.76E-05", "0.001757", "−4.34574", "Down", "MINDY lysine 48 deubiquitinase 1"], ["RNF24", "−0.38862", "3.8E-05", "0.001759", "−4.34233", "Down", "ring finger protein 24"], ["PRCC", "−0.26648", "4.35E-05", "0.001845", "−4.30641", "Down", "proline rich mitotic checkpoint control factor"], ["BORCS8", "−0.36271", "4.62E-05", "0.001879", "−4.28997", "Down", "BLOC-1 related complex subunit 8"], ["ITGA5", "−0.35353", "4.34E-05", "0.001845", "−4.30671", "Down", "integrin subunit alpha 5"], ["SMPD2", "−0.28647", "5.33E-05", "0.001995", "−4.25178", "Down", "sphingomyelinphosphodiesterase 2"], ["SMARCD1", "−0.33626", "5.11E-05", "0.001972", "−4.26291", "Down", "SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1"], ["SIK3", "−0.26974", "5.36E-05", "0.002002", "−4.25023", "Down", "SIK family kinase 3"], ["C9orf129", "−1.18267", "5.01E-05", "0.001962", "−4.26853", "Down", "chromosome 9 open reading frame 129"], ["SCAMP5", "−0.60055", "7.19E-05", "0.00225", "−4.17021", "Down", "secretory carrier membrane protein 5"], ["IP6K1", "−0.32228", "5.67E-05", "0.002052", "−4.23471", "Down", "inositol hexakisphosphate kinase 1"], ["TRANK1", "−0.42013", "5.8E-05", "0.002073", "−4.22853", "Down", "tetratricopeptide repeat and ankyrin repeat containing 1"], ["PRR14L", "−0.29747", "6.19E-05", "0.002108", "−4.21102", "Down", "proline rich 14 like"], ["SETDB1", "−0.28227", "6.25E-05", "0.002114", "−4.20826", "Down", "SET domain bifurcated histone lysine methyltransferase 1"], ["ZNFX1", "−0.32602", "6.25E-05", "0.002114", "−4.20844", "Down", "zinc finger NFX1-type containing 1"], ["GSK3A", "−0.35215", "6.47E-05", "0.002126", "−4.19898", "Down", "glycogen synthase kinase 3 alpha"], ["GPSM3", "−0.38027", "6.28E-05", "0.002114", "−4.20685", "Down", "G protein signaling modulator 3"], ["CLN3", "−0.31966", "7.41E-05", "0.002275", "−4.16164", "Down", "CLN3 lysosomal/endosomaltransmembrane protein, battenin"], ["CYB561D1", "−0.30277", "7.06E-05", "0.002224", "−4.17511", "Down", "cytochrome b561 family member D1"], ["GBA2", "−0.26836", "7.06E-05", "0.002224", "−4.17523", "Down", "glucosylceramidase beta 2"], ["SEC14L1", "−0.31028", "7.06E-05", "0.002224", "−4.17493", "Down", "SEC14 like lipid binding 1"], ["KCTD2", "−0.28549", "7.52E-05", "0.002293", "−4.15781", "Down", "potassium channel tetramerization domain containing 2"], ["RGL3", "−0.75662", "8.74E-05", "0.002495", "−4.11629", "Down", "ral guanine nucleotide dissociation stimulator like 3"], ["DTX4", "−0.40937", "9.03E-05", "0.002513", "−4.1075", "Down", "deltex E3 ubiquitin ligase 4"], ["CLEC4C", "−0.88455", "0.000102", "0.002653", "−4.07383", "Down", "C-type lectin domain family 4 member C"], ["GTPBP1", "−0.41546", "8.09E-05", "0.002396", "−4.13758", "Down", "GTP binding protein 1"], ["RNF135", "−0.27712", "8.49E-05", "0.002457", "−4.12445", "Down", "ring finger protein 135"], ["ASF1B", "−0.45437", "9.24E-05", "0.002521", "−4.10114", "Down", "anti-silencing function 1B histone chaperone"], ["ARAP3", "−0.52053", "8.66E-05", "0.002477", "−4.11882", "Down", "ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3"], ["ST6GALNAC2", "−0.38956", "9.6E-05", "0.002588", "−4.09059", "Down", "ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 2"], ["VPS37C", "−0.3927", "0.000106", "0.002705", "−4.0635", "Down", "VPS37C subunit of ESCRT-I"], ["TNFRSF1B", "−0.32737", "9.6E-05", "0.002588", "−4.09033", "Down", "TNF receptor superfamily member 1B"], ["LY6G5B", "−0.41293", "0.000115", "0.002866", "−4.03965", "Down", "lymphocyte antigen 6 family member G5B"], ["PTAFR", "−0.29634", "9.8E-05", "0.002614", "−4.08471", "Down", "platelet activating factor receptor"], ["MYADM", "−0.41938", "0.000102", "0.00266", "−4.07268", "Down", "myeloid associated differentiation marker"], ["MBD6", "−0.55341", "0.000105", "0.002693", "−4.06584", "Down", "methyl-CpG binding domain protein 6"], ["RETREG2", "−0.2614", "0.000107", "0.002723", "−4.06108", "Down", "reticulophagy regulator family member 2"], ["LMBR1L", "−0.27058", "0.000114", "0.002843", "−4.04291", "Down", "limb development membrane protein 1 like"], ["BET1L", "−0.32294", "0.000118", "0.002909", "−4.03319", "Down", "Bet1 golgi vesicular membrane trafficking protein like"], ["SORT1", "−0.34943", "0.000117", "0.002904", "−4.03473", "Down", "sortilin 1", ""], ["MTF1", "−0.29397", "0.000123", "0.002957", "−4.02199", "Down", "metal regulatory transcription factor 1"], ["C19orf54", "−0.34173", "0.000147", "0.003138", "−3.97225", "Down", "chromosome 19 open reading frame 54"], ["CXCL16", "−0.35275", "0.000124", "0.002964", "−4.01814", "Down", "C-X-C motif chemokine ligand 16"], ["RUBCN", "−0.3292", "0.000126", "0.002975", "−4.01499", "Down", "rubicon autophagy regulator"], ["SNX27", "−0.26986", "0.000124", "0.002964", "−4.01952", "Down", "sorting nexin 27"], ["RAB11FIP1", "−0.29163", "0.000123", "0.002964", "−4.02057", "Down", "RAB11 family interacting protein 1"], ["LGALS9", "−0.3923", "0.000126", "0.002975", "−4.01527", "Down", "galectin 9", ""], ["PTPN18", "−0.27467", "0.000129", "0.003", "−4.00738", "Down", "protein tyrosine phosphatase non-receptor type 18"], ["SIRPA", "−0.2873", "0.00013", "0.003", "−4.00656", "Down", "signal regulatory protein alpha"], ["CHST15", "−0.27829", "0.000133", "0.003031", "−3.99914", "Down", "carbohydrate sulfotransferase 15"], ["UBN1", "−0.38058", "0.000134", "0.003031", "−3.99765", "Down", "ubinuclein 1"], ["NCOA6", "−0.32966", "0.000148", "0.003154", "−3.9687", "Down", "nuclear receptor coactivator 6"], ["ARSG", "−0.27821", "0.00017", "0.003316", "−3.92992", "Down", "arylsulfatase G"], ["EIF3CL", "−1.35741", "0.0002", "0.003608", "−3.88399", "Down", "eukaryotic translation initiation factor 3 subunit C like"], ["POLR2A", "−0.61547", "0.000153", "0.003182", "−3.96085", "Down", "RNA polymerase II subunit A"], ["AOC2", "−0.45479", "0.000182", "0.003432", "−3.91142", "Down", "amine oxidase copper containing 2"], ["NLRP12", "−0.34542", "0.00016", "0.003242", "−3.94814", "Down", "NLR family pyrin domain containing 12"], ["SEC24C", "−0.30954", "0.000158", "0.003221", "−3.95154", "Down", "SEC24 homolog C, COPII coat complex component"], ["KCNMB1", "−0.40521", "0.000212", "0.003705", "−3.86745", "Down", "potassium calcium-activated channel subfamily M regulatory beta subunit 1"], ["SLC48A1", "−0.36957", "0.000185", "0.003451", "−3.90712", "Down", "solute carrier family 48 member 1"], ["ZNF592", "−0.30397", "0.00016", "0.003247", "−3.94689", "Down", "zinc finger protein 592"], ["MEF2D", "−0.35897", "0.000165", "0.003278", "−3.93885", "Down", "myocyte enhancer factor 2D"], ["SLC25A44", "−0.26274", "0.000166", "0.003282", "−3.93716", "Down", "solute carrier family 25 member 44"], ["PPCDC", "−0.31808", "0.000179", "0.003395", "−3.91543", "Down", "phosphopantothenoylcysteine decarboxylase"], ["PLEKHO2", "−0.35445", "0.000175", "0.003346", "−3.92211", "Down", "pleckstrin homology domain containing O2"], ["PIGO", "−0.35859", "0.000198", "0.003586", "−3.88709", "Down", "phosphatidylinositol glycan anchor biosynthesis class O"], ["ZBTB22", "−0.28471", "0.000214", "0.00371", "−3.86516", "Down", "zinc finger and BTB domain containing 22"], ["ZSWIM1", "−0.29063", "0.000229", "0.003835", "−3.84574", "Down", "zinc finger SWIM-type containing 1"], ["DUSP18", "−0.46032", "0.000234", "0.003882", "−3.83938", "Down", "dual specificity phosphatase 18"], ["BAZ2A", "−0.41201", "0.000191", "0.003523", "−3.89726", "Down", "bromodomain adjacent to zinc finger domain 2A"], ["ARRB1", "−0.2686", "0.000196", "0.003567", "−3.89016", "Down", "arrestin beta 1"], ["SMG5", "−0.37995", "0.0002", "0.003608", "−3.88407", "Down", "SMG5 nonsense mediated mRNA decay factor"], ["DAP", "−0.26058", "0.000204", "0.003634", "−3.87917", "Down", "death associated protein"], ["RIMS3", "−0.50216", "0.000274", "0.004209", "−3.79409", "Down", "regulating synaptic membrane exocytosis 3"], ["WIPF2", "−0.31686", "0.000214", "0.00371", "−3.86514", "Down", "WAS/WASL interacting protein family member 2"], ["NSD1", "−0.3405", "0.000219", "0.003768", "−3.85773", "Down", "nuclear receptor binding SET domain protein 1"], ["VPS53", "−0.37707", "0.00024", "0.003926", "−3.83213", "Down", "VPS53 subunit of GARP complex"], ["RASGRP4", "−0.33615", "0.000225", "0.00382", "−3.85013", "Down", "RAS guanyl releasing protein 4"], ["FAM168A", "−0.26973", "0.000246", "0.003969", "−3.82519", "Down", "family with sequence similarity 168 member A"], ["ZBTB3", "−0.43164", "0.000328", "0.004639", "−3.74095", "Down", "zinc finger and BTB domain containing 3"], ["PHC2", "−0.37839", "0.000246", "0.003969", "−3.82531", "Down", "polyhomeotic homolog 2"], ["RGL2", "−0.40321", "0.000252", "0.004016", "−3.81807", "Down", "ral guanine nucleotide dissociation stimulator like 2"], ["SPINT1", "−0.42854", "0.00029", "0.004307", "−3.77766", "Down", "serine peptidase inhibitor, Kunitz type 1"], ["CBX7", "−0.28076", "0.000267", "0.004169", "−3.80078", "Down", "chromobox 7"], ["ADAM19", "−0.30366", "0.000284", "0.004279", "−3.78351", "Down", "ADAM metallopeptidase domain 19"], ["PRR16", "−0.99695", "0.000343", "0.004771", "−3.72824", "Down", "proline rich 16"], ["SP110", "−0.27632", "0.00029", "0.004307", "−3.77759", "Down", "SP110 nuclear body protein"], ["SIGLEC14", "−0.5177", "0.000302", "0.004436", "−3.76517", "Down", "sialic acid binding Ig like lectin 14"], ["RNPEP", "−0.35393", "0.000304", "0.004441", "−3.76372", "Down", "arginylaminopeptidase"], ["ABAT", "−0.30955", "0.000326", "0.004625", "−3.74264", "Down", "4-aminobutyrate aminotransferase"], ["ITGAX", "−0.51435", "0.000313", "0.004529", "−3.75521", "Down", "integrin subunit alpha X"], ["ARHGEF11", "−0.37753", "0.000329", "0.00464", "−3.73998", "Down", "Rho guanine nucleotide exchange factor 11"], ["SLC35F6", "−0.29772", "0.000368", "0.004997", "−3.70727", "Down", "solute carrier family 35 member F6"], ["ACP2", "−0.30411", "0.00039", "0.005185", "−3.69061", "Down", "acid phosphatase 2, lysosomal"], ["SYVN1", "−0.3935", "0.000362", "0.004927", "−3.71249", "Down", "synoviolin 1"], ["TMEM229B", "−0.33641", "0.000404", "0.005292", "−3.68022", "Down", "transmembrane protein 229B"], ["C7orf26", "−0.29812", "0.000413", "0.005347", "−3.67329", "Down", "chromosome 7 open reading frame 26"], ["ALKBH6", "−0.40327", "0.000526", "0.006123", "−3.6017", "Down", "alkB homolog 6"], ["MAST3", "−0.42877", "0.000386", "0.005167", "−3.69332", "Down", "microtubule associated serine/threonine kinase 3"], ["ADAR", "−0.28407", "0.000388", "0.005173", "−3.69224", "Down", "adenosine deaminase RNA specific"], ["MAP3K3", "−0.26552", "0.000395", "0.005231", "−3.68687", "Down", "mitogen-activated protein kinase kinasekinase 3"], ["MFSD14C", "−0.51982", "0.000578", "0.006457", "−3.57334", "Down", "major facilitator superfamily domain containing 14C"], ["PVR", "−0.35231", "0.000528", "0.006129", "−3.6006", "Down", "PVR cell adhesion molecule"], ["STIM1", "−0.32389", "0.000409", "0.005319", "−3.67666", "Down", "stromal interaction molecule 1"], ["STK35", "−0.26227", "0.000425", "0.005423", "−3.66486", "Down", "serine/threonine kinase 35"], ["PILRA", "−0.29576", "0.000415", "0.005359", "−3.67194", "Down", "paired immunoglobin like type 2 receptor alpha"], ["PRKCD", "−0.27159", "0.000419", "0.005389", "−3.66952", "Down", "protein kinase C delta"], ["PFKFB4", "−0.29916", "0.00043", "0.005461", "−3.6616", "Down", "6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4"], ["RAB3D", "−0.28769", "0.000427", "0.005423", "−3.6641", "Down", "RAB3D, member RAS oncogene family"], ["NAGK", "−0.26431", "0.000445", "0.005535", "−3.65121", "Down", "N-acetylglucosamine kinase"], ["RELL1", "−0.38387", "0.000562", "0.006383", "−3.58164", "Down", "RELT like 1"], ["LCNL1", "−1.04762", "0.000615", "0.006715", "−3.55463", "Down", "lipocalin like 1"], ["ASPRV1", "−0.51579", "0.000567", "0.006394", "−3.57928", "Down", "aspartic peptidase retroviral like 1"], ["TBC1D13", "−0.31201", "0.000496", "0.005933", "−3.61904", "Down", "TBC1 domain family member 13"], ["CANT1", "−0.26414", "0.000469", "0.005723", "−3.63568", "Down", "calcium activated nucleotidase 1"], ["GPR107", "−0.30509", "0.000479", "0.005804", "−3.62991", "Down", "G protein-coupled receptor 107"], ["ATXN1L", "−0.28945", "0.000492", "0.0059", "−3.62183", "Down", "ataxin 1 like"], ["CHST14", "−0.31667", "0.000614", "0.00671", "−3.55538", "Down", "carbohydrate sulfotransferase 14"], ["SIGLEC9", "−0.26149", "0.0005", "0.005946", "−3.61695", "Down", "sialic acid binding Ig like lectin 9"], ["FLCN", "−0.3041", "0.000527", "0.006129", "−3.60096", "Down", "folliculin", ""], ["WRAP53", "−0.28624", "0.000632", "0.006817", "−3.54662", "Down", "WD repeat containing antisense to TP53"], ["RIPK3", "−0.28326", "0.000527", "0.006129", "−3.60102", "Down", "receptor interacting serine/threonine kinase 3"], ["FAM53C", "−0.26774", "0.000505", "0.005976", "−3.61408", "Down", "family with sequence similarity 53 member C"], ["WDFY4", "−0.42866", "0.000513", "0.006018", "−3.60918", "Down", "WDFY family member 4"], ["GALNT6", "−0.30319", "0.000593", "0.006558", "−3.56589", "Down", "polypeptide N-acetylgalactosaminyltransferase 6"], ["IQCN", "−0.59607", "0.000676", "0.00706", "−3.52611", "Down", "IQ motif containing N"], ["KCNIP2", "−0.4831", "0.00077", "0.007639", "−3.48639", "Down", "potassium voltage-gated channel interacting protein 2"], ["USP22", "−0.28086", "0.000539", "0.006218", "−3.59461", "Down", "ubiquitin specific peptidase 22"], ["APOM", "−0.36363", "0.0008", "0.007857", "−3.47507", "Down", "apolipoprotein M"], ["MAFF", "−0.33734", "0.000758", "0.007573", "−3.49137", "Down", "MAF bZIP transcription factor F"], ["TNFAIP2", "−0.43598", "0.000547", "0.006267", "−3.58999", "Down", "TNF alpha induced protein 2"], ["CRISPLD2", "−0.44839", "0.000554", "0.006323", "−3.58616", "Down", "cysteine rich secretory protein LCCL domain containing 2"], ["SMURF1", "−0.28252", "0.000613", "0.006707", "−3.55597", "Down", "SMAD specific E3 ubiquitin protein ligase 1"], ["SLC35E2A", "−0.65437", "0.000832", "0.008038", "−3.46296", "Down", "solute carrier family 35 member E2A"], ["ADAMTSL4-AS1", "−0.62083", "0.00084", "0.008094", "−3.4601", "Down", "ADAMTSL4 antisense RNA 1"], ["C17orf49", "−0.35504", "0.000843", "0.008114", "−3.45892", "Down", "chromosome 17 open reading frame 49"], ["MAPK13", "−0.34929", "0.00064", "0.006828", "−3.54262", "Down", "mitogen-activated protein kinase 13"], ["MAPRE3", "−0.41136", "0.000774", "0.007663", "−3.48489", "Down", "microtubule associated protein RP/EB family member 3"], ["RIPOR1", "−0.45424", "0.000623", "0.00676", "−3.55065", "Down", "RHO family interacting cell polarization regulator 1"], ["EPS15L1", "−0.26529", "0.000638", "0.006823", "−3.54359", "Down", "epidermal growth factor receptor pathway substrate 15 like 1"], ["RERE", "−0.31584", "0.000638", "0.006823", "−3.5437", "Down", "arginine-glutamic acid dipeptide repeats"], ["DGLUCY", "−0.2802", "0.000649", "0.006868", "−3.53869", "Down", "D-glutamate cyclase"], ["CSF3R", "−0.37028", "0.000656", "0.006907", "−3.53531", "Down", "colony stimulating factor 3 receptor"], ["HCG27", "−0.41468", "0.000665", "0.006981", "−3.53133", "Down", "HLA complex group 27"], ["GNAI2", "−0.31016", "0.000678", "0.00706", "−3.52531", "Down", "G protein subunit alpha i2"], ["HSH2D", "−0.28176", "0.000684", "0.00711", "−3.52276", "Down", "hematopoietic SH2 domain containing"], ["KIAA0513", "−0.37074", "0.000709", "0.007246", "−3.5118", "Down", "KIAA0513", ""], ["SEMA4A", "−0.32944", "0.000725", "0.007356", "−3.50486", "Down", "semaphorin 4A"], ["PLBD2", "−0.42359", "0.000941", "0.008696", "−3.42516", "Down", "phospholipase B domain containing 2"], ["LRP10", "−0.35142", "0.000757", "0.007571", "−3.49174", "Down", "LDL receptor related protein 10"], ["GATAD2B", "−0.29403", "0.000784", "0.007727", "−3.48124", "Down", "GATA zinc finger domain containing 2B"], ["NICN1", "−0.31258", "0.000918", "0.008552", "−3.43258", "Down", "nicolin 1", ""], ["DIAPH1", "−0.31756", "0.000808", "0.007898", "−3.47192", "Down", "diaphanous related formin 1"], ["ITGAL", "−0.35006", "0.000857", "0.008169", "−3.45376", "Down", "integrin subunit alpha L"], ["ZNF784", "−0.32453", "0.001326", "0.010881", "−3.31793", "Down", "zinc finger protein 784"], ["ARHGAP9", "−0.32141", "0.000888", "0.00836", "−3.44285", "Down", "Rho GTPase activating protein 9"], ["WWP2", "−0.3584", "0.000901", "0.008438", "−3.43845", "Down", "WW domain containing E3 ubiquitin protein ligase 2"], ["MICALL1", "−0.44326", "0.001108", "0.009644", "−3.37439", "Down", "MICAL like 1"], ["TP53", "−0.28135", "0.000961", "0.008834", "−3.4185", "Down", "tumor protein p53"], ["WDTC1", "−0.41259", "0.000934", "0.008664", "−3.4274", "Down", "WD and tetratricopeptide repeats 1"], ["UBE2C", "−0.37342", "0.001447", "0.011521", "−3.29045", "Down", "ubiquitin conjugating enzyme E2 C"], ["ORAI2", "−0.26578", "0.000971", "0.008867", "−3.41533", "Down", "ORAI calcium release-activated calcium modulator 2"], ["TMEM63C", "−0.66345", "0.001471", "0.011659", "−3.28516", "Down", "transmembrane protein 63C"], ["NAPA", "−0.30533", "0.00099", "0.008953", "−3.40941", "Down", "NSF attachment protein alpha"], ["SCAMP2", "−0.27934", "0.000995", "0.008979", "−3.40775", "Down", "secretory carrier membrane protein 2"], ["PSAP", "−0.26071", "0.001008", "0.009037", "−3.40361", "Down", "prosaposin"], ["ZNF385A", "−0.44893", "0.001055", "0.009343", "−3.38947", "Down", "zinc finger protein 385A"], ["XPO6", "−0.28059", "0.001023", "0.009125", "−3.3991", "Down", "exportin 6"], ["TREML2", "−0.29456", "0.001038", "0.009222", "−3.39466", "Down", "triggering receptor expressed on myeloid cells like 2"], ["TMEM106A", "−0.35251", "0.001317", "0.010844", "−3.32008", "Down", "transmembrane protein 106A"], ["CNNM4", "−0.30466", "0.001368", "0.011101", "−3.30823", "Down", "cyclin and CBS domain divalent metal cation transport mediator 4"], ["ADA2", "−0.32201", "0.001086", "0.009543", "−3.38059", "Down", "adenosine deaminase 2"], ["MPEG1", "−0.26839", "0.001092", "0.009571", "−3.37885", "Down", "macrophage expressed 1"], ["SLC9A1", "−0.40045", "0.001164", "0.009954", "−3.3589", "Down", "solute carrier family 9 member A1"], ["INTS3", "−0.34455", "0.001156", "0.00991", "−3.36104", "Down", "integrator complex subunit 3"], ["APOBEC3D", "−0.30439", "0.001328", "0.010888", "−3.31758", "Down", "apolipoprotein B mRNA editing enzyme catalytic subunit 3D"], ["ZNF324", "−0.29262", "0.001606", "0.012416", "−3.2573", "Down", "zinc finger protein 324"], ["SIDT2", "−0.35226", "0.001217", "0.010314", "−3.34508", "Down", "SID1 transmembrane family member 2"], ["TMEM214", "−0.29447", "0.001256", "0.010538", "−3.33517", "Down", "transmembrane protein 214"], ["ZNF687", "−0.33153", "0.001277", "0.010659", "−3.32985", "Down", "zinc finger protein 687"], ["MFN2", "−0.28625", "0.001236", "0.01042", "−3.34017", "Down", "mitofusin 2"], ["RAB36", "−0.43526", "0.001925", "0.014054", "−3.19916", "Down", "RAB36, member RAS oncogene family"], ["PLPPR2", "−0.40458", "0.001273", "0.010644", "−3.33082", "Down", "phospholipid phosphatase related 2"], ["DYSF", "−0.45611", "0.00128", "0.010665", "−3.32913", "Down", "dysferlin", ""], ["FIZ1", "−0.28749", "0.001808", "0.013394", "−3.21933", "Down", "FLT3 interacting zinc finger 1"], ["STK10", "−0.26283", "0.001306", "0.010781", "−3.3227", "Down", "serine/threonine kinase 10"], ["MAML3", "−0.28886", "0.001556", "0.012181", "−3.26737", "Down", "mastermind like transcriptional coactivator 3"], ["KSR1", "−0.37381", "0.001394", "0.011257", "−3.30217", "Down", "kinase suppressor of ras 1"], ["TRIM62", "−0.30433", "0.001646", "0.012623", "−3.2494", "Down", "tripartite motif containing 62"], ["SESN2", "−0.3122", "0.00169", "0.012795", "−3.24092", "Down", "sestrin 2"], ["MARK2", "−0.31865", "0.00141", "0.011332", "−3.29873", "Down", "microtubule affinity regulating kinase 2"], ["CDIP1", "−0.31975", "0.00157", "0.012243", "−3.26456", "Down", "cell death inducing p53 target 1"], ["PAQR6", "−0.61509", "0.002215", "0.015442", "−3.15361", "Down", "progestin and adipoQ receptor family member 6"], ["PISD", "−0.27421", "0.001455", "0.011557", "−3.28858", "Down", "phosphatidylserine decarboxylase"], ["TNFSF12", "−0.28316", "0.001722", "0.012942", "−3.2349", "Down", "TNF superfamily member 12"], ["MAP11", "−0.31678", "0.001495", "0.011825", "−3.2801", "Down", "microtubule associated protein 11"], ["IQCE", "−0.31488", "0.001787", "0.013302", "−3.22309", "Down", "IQ motif containing E"], ["ADGRE5", "−0.39217", "0.001542", "0.012114", "−3.27021", "Down", "adhesion G protein-coupled receptor E5"], ["SCAP", "−0.32181", "0.001592", "0.012352", "−3.26013", "Down", "SREBF chaperone"], ["NECTIN1", "−0.4398", "0.002047", "0.014673", "−3.17924", "Down", "nectin cell adhesion molecule 1"], ["CDK5RAP3", "−0.34828", "0.001582", "0.01231", "−3.26209", "Down", "CDK5 regulatory subunit associated protein 3"], ["DAPK2", "−0.30512", "0.001699", "0.012832", "−3.23936", "Down", "death associated protein kinase 2"], ["PLAGL2", "−0.27659", "0.001719", "0.012929", "−3.23551", "Down", "PLAG1 like zinc finger 2"], ["ZDHHC18", "−0.29438", "0.001667", "0.012699", "−3.24539", "Down", "zinc finger DHHC-type containing 18"], ["CD4", "−0.29252", "0.001675", "0.012725", "−3.24392", "Down", "CD4 molecule"], ["ATG16L2", "−0.47049", "0.001688", "0.012792", "−3.24146", "Down", "autophagy related 16 like 2"], ["GBGT1", "−0.30319", "0.002212", "0.015431", "−3.15412", "Down", "globoside alpha-1,3-N-acetylgalactosaminyltransferase 1 (FORS blood group)"], ["SKIV2L", "−0.32579", "0.001807", "0.013394", "−3.2196", "Down", "Ski2 like RNA helicase"], ["TTC4", "−0.34101", "0.003031", "0.019228", "−3.05037", "Down", "tetratricopeptide repeat domain 4"], ["RAD54L2", "−0.37561", "0.002087", "0.014855", "−3.17303", "Down", "RAD54 like 2"], ["PI4K2A", "−0.26735", "0.00229", "0.015792", "−3.14278", "Down", "phosphatidylinositol 4-kinase type 2 alpha"], ["JAK3", "−0.30717", "0.001914", "0.013982", "−3.20098", "Down", "Janus kinase 3"], ["FLT3", "−0.35297", "0.002633", "0.017514", "−3.09708", "Down", "fms related tyrosine kinase 3"], ["RNF31", "−0.33297", "0.002109", "0.014969", "−3.16959", "Down", "ring finger protein 31"], ["POMZP3", "−0.4664", "0.002875", "0.018477", "−3.06791", "Down", "POM121 and ZP3 fusion"], ["LMTK2", "−0.26618", "0.002202", "0.015375", "−3.15558", "Down", "lemur tyrosine kinase 2"], ["AOC3", "−0.44883", "0.002455", "0.016657", "−3.12003", "Down", "amine oxidase copper containing 3"], ["FANCA", "−0.35504", "0.002422", "0.016499", "−3.12447", "Down", "FA complementation group A"], ["WBP2", "−0.31533", "0.002039", "0.014631", "−3.1806", "Down", "WW domain binding protein 2"], ["OGFOD2", "−0.38737", "0.003433", "0.020952", "−3.00876", "Down", "2-oxoglutarate and iron dependent oxygenase domain containing 2"], ["ITIH4", "−0.7173", "0.003584", "0.021602", "−2.99422", "Down", "inter-alpha-trypsin inhibitor heavy chain 4"], ["ITGAM", "−0.28014", "0.002099", "0.01493", "−3.17112", "Down", "integrin subunit alpha M"], ["CHD8", "−0.28304", "0.002143", "0.015097", "−3.16436", "Down", "chromodomain helicase DNA binding protein 8"], ["DENND1A", "−0.31755", "0.002347", "0.016118", "−3.13479", "Down", "DENN domain containing 1A"], ["TRIM41", "−0.26057", "0.00236", "0.016189", "−3.13294", "Down", "tripartite motif containing 41"], ["NLRP1", "−0.3423", "0.002242", "0.01557", "−3.14971", "Down", "NLR family pyrin domain containing 1"], ["MMP25", "−0.48039", "0.002249", "0.01561", "−3.1487", "Down", "matrix metallopeptidase 25"], ["POPDC2", "−0.32941", "0.003559", "0.021496", "−2.99664", "Down", "popeye domain containing 2"], ["CPNE9", "−0.66459", "0.003856", "0.022604", "−2.96956", "Down", "copine family member 9"], ["LAG3", "−0.46043", "0.003252", "0.020199", "−3.02693", "Down", "lymphocyte activating 3"], ["NDRG2", "−0.27747", "0.003018", "0.019177", "−3.05186", "Down", "NDRG family member 2"], ["INPP5B", "−0.31274", "0.002511", "0.016952", "−3.11262", "Down", "inositol polyphosphate-5-phosphatase B"], ["BMF", "−0.26451", "0.002523", "0.017008", "−3.11107", "Down", "Bcl2 modifying factor"], ["INPP5D", "−0.26393", "0.002376", "0.016265", "−3.13076", "Down", "inositol polyphosphate-5-phosphatase D"], ["PAPLN", "−0.52955", "0.004162", "0.023765", "−2.94356", "Down", "papilin, proteoglycan like sulfated glycoprotein"], ["SLC27A3", "−0.31556", "0.002609", "0.017417", "−3.10008", "Down", "solute carrier family 27 member 3"], ["XKR8", "−0.26542", "0.002565", "0.017192", "−3.10567", "Down", "XK related 8"], ["DOP1B", "−0.26995", "0.002714", "0.017839", "−3.08698", "Down", "DOP1 leucine zipper like protein B"], ["GMIP", "−0.3929", "0.002527", "0.017026", "−3.11057", "Down", "GEM interacting protein"], ["PNKD", "−0.29826", "0.002802", "0.018154", "−3.07643", "Down", "PNKD metallo-beta-lactamase domain containing"], ["ZNF264", "−0.26952", "0.003525", "0.021391", "−2.99983", "Down", "zinc finger protein 264"], ["PLXNA2", "−0.4063", "0.003836", "0.022539", "−2.97125", "Down", "plexin A2"], ["TAF8", "−0.30568", "0.00284", "0.018306", "−3.07201", "Down", "TATA-box binding protein associated factor 8"], ["GYS1", "−0.30134", "0.002951", "0.018854", "−3.05932", "Down", "glycogen synthase 1"], ["SLC1A4", "−0.36474", "0.003534", "0.021412", "−2.99901", "Down", "solute carrier family 1 member 4"], ["SLC15A3", "−0.28569", "0.002848", "0.01835", "−3.07109", "Down", "solute carrier family 15 member 3"], ["TLE3", "−0.32824", "0.002748", "0.017961", "−3.08292", "Down", "TLE family member 3, transcriptional corepressor"], ["SLC16A5", "−0.31497", "0.003097", "0.01951", "−3.04325", "Down", "solute carrier family 16 member 5"], ["OGDH", "−0.32269", "0.002818", "0.018207", "−3.07457", "Down", "oxoglutarate dehydrogenase"], ["RTN1", "−0.33417", "0.003191", "0.019886", "−3.03327", "Down", "reticulon 1"], ["THBS3", "−0.34867", "0.003237", "0.020126", "−3.0284", "Down", "thrombospondin 3"], ["BCL3", "−0.36376", "0.003035", "0.019247", "−3.04991", "Down", "BCL3 transcription coactivator"], ["ADCY4", "−0.36448", "0.003609", "0.021672", "−2.99194", "Down", "adenylatecyclase 4"], ["ZNF530", "−0.32785", "0.004519", "0.025209", "−2.91541", "Down", "zinc finger protein 530"], ["ZMYND15", "−0.48374", "0.004583", "0.02545", "−2.9106", "Down", "zinc finger MYND-type containing 15"], ["AMY1B", "−0.72088", "0.005292", "0.028186", "−2.86091", "Down", "amylase alpha 1B"], ["ZNF417", "−0.30434", "0.003838", "0.022543", "−2.97107", "Down", "zinc finger protein 417"], ["GTF2IRD2", "−0.3548", "0.004795", "0.02631", "−2.89503", "Down", "GTF2I repeat domain containing 2"], ["PRSS21", "−0.78843", "0.005521", "0.02903", "−2.84617", "Down", "serine protease 21"], ["CADM4", "−0.3036", "0.005273", "0.028121", "−2.86213", "Down", "cell adhesion molecule 4"], ["HIP1", "−0.45352", "0.003301", "0.020406", "−3.02192", "Down", "huntingtin interacting protein 1"], ["STIMATE-MUSTN1", "−0.54123", "0.005515", "0.029012", "−2.8465", "Down", "STIMATE-MUSTN1 readthrough"], ["KCTD11", "−0.2781", "0.004312", "0.024369", "−2.93148", "Down", "potassium channel tetramerization domain containing 11"], ["ZNF70", "−0.57012", "0.005544", "0.029142", "−2.84472", "Down", "zinc finger protein 70"], ["HIVEP3", "−0.39006", "0.004369", "0.024627", "−2.92696", "Down", "HIVEP zinc finger 3"], ["LOC100129697", "−0.60899", "0.005981", "0.030664", "−2.81815", "Down", "uncharacterized LOC100129697"], ["CIITA", "−0.43886", "0.003378", "0.020711", "−3.01412", "Down", "class II major histocompatibility complex transactivator"], ["EPOR", "−0.27146", "0.004472", "0.025006", "−2.91898", "Down", "erythropoietin receptor"], ["SHISA4", "−0.64173", "0.005489", "0.028917", "−2.84818", "Down", "shisa family member 4"], ["STIMATE", "−0.30689", "0.006148", "0.031273", "−2.80846", "Down", "STIM activating enhancer"], ["ADAT1", "−0.27445", "0.004127", "0.023668", "−2.94646", "Down", "adenosine deaminasetRNA specific 1"], ["TTLL11", "−0.30463", "0.006288", "0.031761", "−2.80055", "Down", "tubulin tyrosine ligase like 11"], ["H6PD", "−0.40411", "0.00368", "0.021976", "−2.9853", "Down", "hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase"], ["RAPGEFL1", "−0.46135", "0.004927", "0.02685", "−2.88567", "Down", "Rap guanine nucleotide exchange factor like 1"], ["TMEM63B", "−0.31929", "0.004159", "0.023761", "−2.94384", "Down", "transmembrane protein 63B"], ["PSPN", "−0.32479", "0.006167", "0.031326", "−2.80738", "Down", "persephin"], ["HLA-DQA1", "−1.05471", "0.004016", "0.023213", "−2.95571", "Down", "major histocompatibility complex, class II, DQ alpha 1"], ["TRAPPC9", "−0.31907", "0.004124", "0.023668", "−2.94672", "Down", "trafficking protein particle complex 9"], ["CCNJL", "−0.30896", "0.00384", "0.022544", "−2.97093", "Down", "cyclin J like"], ["MAP1A", "−0.48755", "0.005854", "0.030316", "−2.8257", "Down", "microtubule associated protein 1A"], ["PPP1R12B", "−0.32586", "0.003774", "0.022328", "−2.9768", "Down", "protein phosphatase 1 regulatory subunit 12B"], ["DNMBP", "−0.36414", "0.004698", "0.025936", "−2.9021", "Down", "dynamin binding protein"], ["CLEC17A", "−0.48511", "0.005274", "0.028121", "−2.86207", "Down", "C-type lectin domain containing 17A"], ["PACS1", "−0.35178", "0.003745", "0.022242", "−2.97938", "Down", "phosphofurin acidic cluster sorting protein 1"], ["TRIM25", "−0.26502", "0.00377", "0.022316", "−2.97712", "Down", "tripartite motif containing 25"], ["DSP", "−1.74666", "0.007097", "0.034701", "−2.75765", "Down", "desmoplakin"], ["PHF7", "−0.33686", "0.006229", "0.031548", "−2.80388", "Down", "PHD finger protein 7"], ["ADGRG3", "−0.36957", "0.003871", "0.022639", "−2.96821", "Down", "adhesion G protein-coupled receptor G3"], ["SULT1A2", "−0.76588", "0.007036", "0.034482", "−2.76074", "Down", "sulfotransferase family 1A member 2"], ["SPIB", "−0.38425", "0.004951", "0.026919", "−2.884", "Down", "Spi-B transcription factor"], ["DRICH1", "−0.66714", "0.007466", "0.036148", "−2.73956", "Down", "aspartate rich 1"], ["ZNF445", "−0.34371", "0.004446", "0.024908", "−2.921", "Down", "zinc finger protein 445"], ["USP19", "−0.27666", "0.004041", "0.023332", "−2.95362", "Down", "ubiquitin specific peptidase 19"], ["STK36", "−0.29142", "0.005018", "0.027206", "−2.87931", "Down", "serine/threonine kinase 36"], ["CDKN2A", "−0.69258", "0.007729", "0.037039", "−2.72716", "Down", "cyclin dependent kinase inhibitor 2A"], ["METTL7A", "−0.27873", "0.004291", "0.024292", "−2.93314", "Down", "methyltransferase like 7A"], ["TTLL3", "−0.40446", "0.004358", "0.024578", "−2.92787", "Down", "tubulin tyrosine ligase like 3"], ["C19orf84", "−0.73685", "0.007933", "0.037785", "−2.71782", "Down", "chromosome 19 open reading frame 84"], ["ARHGAP31", "−0.30623", "0.005156", "0.02773", "−2.86992", "Down", "Rho GTPase activating protein 31"], ["C2CD2L", "−0.26804", "0.004428", "0.024824", "−2.9224", "Down", "C2CD2 like"], ["PLEKHG3", "−0.35043", "0.00427", "0.024204", "−2.93484", "Down", "pleckstrin homology and RhoGEF domain containing G3"], ["GBF1", "−0.35336", "0.004328", "0.02444", "−2.93017", "Down", "golgibrefeldin A resistant guanine nucleotide exchange factor 1"], ["SLC6A16", "−0.36797", "0.006412", "0.032156", "−2.79366", "Down", "solute carrier family 6 member 16"], ["VARS2", "−0.38504", "0.005076", "0.027413", "−2.87536", "Down", "valyl-tRNAsynthetase 2, mitochondrial"], ["PLEKHM1", "−0.31734", "0.004414", "0.024784", "−2.92345", "Down", "pleckstrin homology and RUN domain containing M1"], ["SMIM34A", "−0.72037", "0.008217", "0.038787", "−2.70514", "Down", "small integral membrane protein 34A"], ["MARK4", "−0.3283", "0.005433", "0.028678", "−2.85174", "Down", "microtubule affinity regulating kinase 4"], ["SLC38A7", "−0.28303", "0.005751", "0.029924", "−2.83191", "Down", "solute carrier family 38 member 7"], ["SLC25A35", "−0.2993", "0.006192", "0.031428", "−2.80596", "Down", "solute carrier family 25 member 35"], ["VAT1", "−0.27067", "0.004901", "0.026728", "−2.88746", "Down", "vesicle amine transport 1"], ["C15orf39", "−0.40438", "0.004391", "0.024697", "−2.92529", "Down", "chromosome 15 open reading frame 39"], ["NF2", "−0.28694", "0.005349", "0.028401", "−2.8572", "Down", "neurofibromin 2"], ["BSCL2", "−0.26614", "0.007512", "0.036312", "−2.73739", "Down", "BSCL2 lipid droplet biogenesis associated, seipin"], ["VDR", "−0.2684", "0.005304", "0.028225", "−2.86013", "Down", "vitamin D receptor"], ["PADI4", "−0.44486", "0.004656", "0.025758", "−2.90517", "Down", "peptidyl arginine deiminase 4"], ["ABCG1", "−0.29576", "0.005169", "0.027735", "−2.86904", "Down", "ATP binding cassette subfamily G member 1"], ["ABTB2", "−0.44053", "0.008044", "0.038142", "−2.71281", "Down", "ankyrin repeat and BTB domain containing 2"], ["SLC16A13", "−0.28493", "0.007676", "0.036885", "−2.72966", "Down", "solute carrier family 16 member 13"], ["FHOD1", "−0.31983", "0.00504", "0.027298", "−2.87781", "Down", "formin homology 2 domain containing 1"], ["ARID1A", "−0.31182", "0.004979", "0.027052", "−2.88206", "Down", "AT-rich interaction domain 1A"], ["GPR157", "−0.33012", "0.007318", "0.03555", "−2.74675", "Down", "G protein-coupled receptor 157"], ["DAAM2", "−1.17025", "0.008639", "0.040251", "−2.68706", "Down", "dishevelled associated activator of morphogenesis 2"], ["INCA1", "−0.60309", "0.009868", "0.04423", "−2.63853", "Down", "inhibitor of CDK, cyclin A1 interacting protein 1"], ["TIGD3", "−0.368", "0.006217", "0.031506", "−2.80456", "Down", "tigger transposable element derived 3"], ["ENTPD2", "−0.85818", "0.009711", "0.043759", "−2.64442", "Down", "ectonucleoside triphosphate diphosphohydrolase 2"], ["ARHGEF5", "−0.39012", "0.009339", "0.042517", "−2.6587", "Down", "Rho guanine nucleotide exchange factor 5"], ["PLD2", "−0.28888", "0.005989", "0.030695", "−2.81768", "Down", "phospholipase D2"], ["POLR1A", "−0.3791", "0.006226", "0.031544", "−2.80404", "Down", "RNA polymerase I subunit A"], ["KIAA0556", "−0.31343", "0.005811", "0.030142", "−2.82826", "Down", "KIAA0556", ""], ["RAP1GAP2", "−0.32685", "0.005276", "0.028122", "−2.86195", "Down", "RAP1 GTPase activating protein 2"], ["ADD1", "−0.26923", "0.005269", "0.02812", "−2.86242", "Down", "adducin 1"], ["EHBP1L1", "−0.35615", "0.005468", "0.028814", "−2.84954", "Down", "EH domain binding protein 1 like 1"], ["FAM160A1", "−0.7446", "0.010863", "0.047396", "−2.60316", "Down", "family with sequence similarity 160 member A1"], ["SOGA1", "−0.42952", "0.007824", "0.037374", "−2.72278", "Down", "suppressor of glucose, autophagy associated 1"], ["TNFRSF21", "−0.61534", "0.01054", "0.046315", "−2.61431", "Down", "TNF receptor superfamily member 21"], ["NFAM1", "−0.29308", "0.005706", "0.029771", "−2.83465", "Down", "NFAT activating protein with ITAM motif 1"], ["CNOT3", "−0.30586", "0.005959", "0.030608", "−2.81943", "Down", "CCR4-NOT transcription complex subunit 3"], ["RSKR", "−0.56514", "0.010578", "0.046421", "−2.61296", "Down", "ribosomal protein S6 kinase related"], ["PLXNA4", "−0.50001", "0.010531", "0.04631", "−2.61461", "Down", "plexin A4"], ["CNTROB", "−0.29089", "0.006896", "0.033945", "−2.76788", "Down", "centrobin, centriole duplication and spindle assembly protein"], ["TBC1D10B", "−0.26939", "0.006094", "0.031079", "−2.81158", "Down", "TBC1 domain family member 10B"], ["NOXRED1", "−0.34558", "0.011102", "0.048163", "−2.59509", "Down", "NADP dependent oxidoreductase domain containing 1"], ["HYOU1", "−0.30667", "0.006028", "0.030859", "−2.81539", "Down", "hypoxia up-regulated 1"], ["SUPT5H", "−0.27837", "0.005938", "0.030542", "−2.82067", "Down", "SPT5 homolog, DSIF elongation factor subunit"], ["CLPB", "−0.26559", "0.008773", "0.040714", "−2.68144", "Down", "ClpB homolog, mitochondrial AAA ATPase chaperonin"], ["SIGLEC5", "−0.30815", "0.006387", "0.032082", "−2.79502", "Down", "sialic acid binding Ig like lectin 5"], ["NCR1", "−0.46793", "0.008972", "0.041383", "−2.67332", "Down", "natural cytotoxicity triggering receptor 1"], ["LRRC20", "−0.28981", "0.010509", "0.046236", "−2.6154", "Down", "leucine rich repeat containing 20"], ["MAP7D1", "−0.30089", "0.006066", "0.030993", "−2.81322", "Down", "MAP7 domain containing 1"], ["GHRL", "−0.28653", "0.008139", "0.038516", "−2.70858", "Down", "ghrelin and obestatinprepropeptide"], ["KDM6B", "−0.4334", "0.006275", "0.031734", "−2.80128", "Down", "lysine demethylase 6B"], ["CCDC17", "−0.32392", "0.009183", "0.041985", "−2.66487", "Down", "coiled-coil domain containing 17"], ["U2AF1L4", "−0.26211", "0.008081", "0.038264", "−2.71116", "Down", "U2 small nuclear RNA auxiliary factor 1 like 4"], ["CEACAM4", "−0.30283", "0.006663", "0.033138", "−2.78007", "Down", "CEA cell adhesion molecule 4"], ["TNS3", "−0.28418", "0.007707", "0.036969", "−2.72819", "Down", "tensin 3"], ["ADAP2", "−0.27485", "0.00825", "0.038875", "−2.70371", "Down", "ArfGAP with dual PH domains 2"], ["NLRX1", "−0.2759", "0.007971", "0.037933", "−2.71612", "Down", "NLR family member X1"], ["RABL2A", "−0.30042", "0.009208", "0.042068", "−2.66386", "Down", "RAB, member of RAS oncogene family like 2A"], ["PROSER3", "−0.47732", "0.009247", "0.042198", "−2.66234", "Down", "proline and serine rich 3"], ["MIDN", "−0.29956", "0.006943", "0.034146", "−2.76547", "Down", "midnolin"], ["DENND4B", "−0.31441", "0.006859", "0.033811", "−2.76981", "Down", "DENN domain containing 4B"], ["SORBS3", "−0.40358", "0.00832", "0.039149", "−2.70067", "Down", "sorbin and SH3 domain containing 3"], ["PLB1", "−0.36701", "0.007831", "0.037384", "−2.72248", "Down", "phospholipase B1"], ["DPEP3", "−0.34095", "0.009581", "0.043304", "−2.64937", "Down", "dipeptidase 3"], ["SEMA4B", "−0.31138", "0.007518", "0.036312", "−2.73711", "Down", "semaphorin 4B"], ["WASF2", "−0.28093", "0.007388", "0.035832", "−2.74331", "Down", "WASP family member 2"], ["NUCB1", "−0.34217", "0.007574", "0.036492", "−2.73442", "Down", "nucleobindin 1"], ["SH3BP2", "−0.28179", "0.007608", "0.036623", "−2.73283", "Down", "SH3 domain binding protein 2"], ["P2RX5", "−0.37743", "0.008788", "0.040771", "−2.68084", "Down", "purinergic receptor P2X 5"], ["SPN", "−0.3575", "0.007702", "0.036969", "−2.72842", "Down", "sialophorin"], ["KRTCAP2", "−0.27178", "0.010587", "0.046448", "−2.61265", "Down", "keratinocyte associated protein 2"], ["MRTFA", "−0.32285", "0.007914", "0.037715", "−2.7187", "Down", "myocardin related transcription factor A"], ["MBOAT7", "−0.29593", "0.007972", "0.037933", "−2.71605", "Down", "membrane bound O-acyltransferase domain containing 7"], ["PREX1", "−0.30088", "0.008158", "0.038573", "−2.70775", "Down", "phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 1"], ["YLPM1", "−0.28757", "0.008714", "0.040515", "−2.68392", "Down", "YLP motif containing 1"], ["STK40", "−0.26465", "0.008277", "0.038982", "−2.70252", "Down", "serine/threonine kinase 40"], ["ARHGAP17", "−0.33169", "0.009266", "0.04223", "−2.66157", "Down", "Rho GTPase activating protein 17"], ["VNN3", "−0.30084", "0.008574", "0.040052", "−2.68977", "Down", "vanin 3"], ["SLC9A8", "−0.26299", "0.008652", "0.040285", "−2.68649", "Down", "solute carrier family 9 member A8"], ["RPGRIP1", "−0.27294", "0.010455", "0.046081", "−2.6173", "Down", "RPGR interacting protein 1"], ["LRRC4", "−0.27126", "0.009351", "0.042557", "−2.65825", "Down", "leucine rich repeat containing 4"], ["MAVS", "−0.37027", "0.009896", "0.04429", "−2.63751", "Down", "mitochondrial antiviral signaling protein"], ["DENND3", "−0.29167", "0.008663", "0.040323", "−2.68605", "Down", "DENN domain containing 3"], ["BAG6", "−0.29939", "0.008921", "0.041228", "−2.67539", "Down", "BCL2 associated athanogene 6"], ["STAT2", "−0.3148", "0.008975", "0.041387", "−2.67319", "Down", "signal transducer and activator of transcription 2"], ["TAGLN", "−0.47191", "0.01024", "0.045397", "−2.62496", "Down", "transgelin"], ["ARHGEF40", "−0.30666", "0.009153", "0.041943", "−2.66604", "Down", "Rho guanine nucleotide exchange factor 40"], ["HEATR6", "−0.28169", "0.011601", "0.049803", "−2.57873", "Down", "HEAT repeat containing 6"], ["DGAT2", "−0.26818", "0.009139", "0.041901", "−2.6666", "Down", "diacylglycerol O-acyltransferase 2"], ["PRKD2", "−0.30467", "0.009203", "0.042065", "−2.66408", "Down", "protein kinase D2"], ["AGER", "−0.3384", "0.009421", "0.042727", "−2.65554", "Down", "advanced glycosylation end-product specific receptor"], ["UBA7", "−0.26693", "0.009299", "0.042344", "−2.66029", "Down", "ubiquitin like modifier activating enzyme 7"], ["CAMKK1", "−0.29228", "0.011032", "0.047934", "−2.59743", "Down", "calcium/calmodulin dependent protein kinase kinase 1"], ["DLGAP4", "−0.29263", "0.009963", "0.044477", "−2.63502", "Down", "DLG associated protein 4"], ["REC8", "−0.3437", "0.010365", "0.04582", "−2.62047", "Down", "REC8 meiotic recombination protein"], ["TLN1", "−0.4416", "0.009401", "0.042661", "−2.65628", "Down", "talin 1"], ["QSOX1", "−0.28813", "0.009808", "0.044044", "−2.64077", "Down", "quiescin sulfhydryl oxidase 1"], ["ZNF692", "−0.27196", "0.010424", "0.045995", "−2.6184", "Down", "zinc finger protein 692"], ["CSF1R", "−0.29204", "0.00998", "0.044538", "−2.63442", "Down", "colony stimulating factor 1 receptor"], ["ABCC10", "−0.3171", "0.01149", "0.04946", "−2.58231", "Down", "ATP binding cassette subfamily C member 10"], ["ABTB1", "−0.33918", "0.010031", "0.044708", "−2.63253", "Down", "ankyrin repeat and BTB domain containing 1"], ["GALNS", "−0.2628", "0.011209", "0.048514", "−2.59152", "Down", "galactosamine (N-acetyl)-6-sulfatase"], ["PRRC2A", "−0.42124", "0.010301", "0.045643", "−2.62278", "Down", "proline rich coiled-coil 2A"], ["SLC11A1", "−0.32785", "0.010591", "0.046449", "−2.61254", "Down", "solute carrier family 11 member 1"], ["TEP1", "−0.27091", "0.011336", "0.048899", "−2.58735", "Down", "telomerase associated protein 1"], ["P2RX1", "−0.33856", "0.011621", "0.049837", "−2.57809", "Down", "purinergic receptor P2X 1"]], "row_count": 992, "column_count": 8, "numeric_cells": 5003, "header_rows": 1, "locator": "section[12]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:33827531:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a92929b7f7bafd039a28f6652847a8f5d0b83558dfd3c5ec0f435e43943fb67c", "bytes": 1941, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#Tab3", "version": null, "note": "The enriched pathway terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8028841", "section_index": 13, "section_title": "Gene Ontology (GO) and pathway enrichment analyses of DEGs", "row_count": 15, "column_count": 8}, "table": {"label": "Table 3", "caption": "The enriched pathway terms of the up and down regulated differentially expressed genes", "rows": [["Pathway ID", "Pathway Name", "P-value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["1,269,543", "Signaling by GPCR", "3.16E-03", "1.94E-01", "1.00E+00", "7.89E-01", "16", "OR2T29,NPBWR1,TRHR,AVP,GPR37,OR10J3,GRIN2B, RGS4,PTHLH,CRHR2,OR51E2,OR51E1,EGFR,OR6C70, CCL13,CCL19"], ["1,269,868", "Muscle contraction", "5.98E-03", "1.94E-01", "1.00E+00", "1.00E+00", "5", "MYH6,NPPC,KCNK4,ATP1A4,PLN"], ["1,269,958", "Digestion of dietary carbohydrate", "5.00E-02", "2.98E-01", "1.00E+00", "1.00E+00", "1", "AMY1A"], ["1,457,790", "Keratinization", "1.22E-01", "1.00E+00", "3.53E-01", "1.00E+00", "3", "KRT39,KRT20,KRT38"], ["1,270,189", "Biological oxidations", "1.41E-01", "3.67E-01", "1.00E+00", "1.00E+00", "3", "CYP2F1,AS3MT,UGT2A3"], ["1,269,907", "SLC-mediated transmembrane transport", "4.87E-01", "6.38E-01", "1.00E+00", "1.00E+00", "2", "AVP,G6PC"], ["Down regulated genes"], ["1,269,203", "Innate Immune System", "1.03E-02", "3.35E-01", "1.00E+00", "1.00E+00", "16", "CRISPLD2,DSP,OSCAR,C5AR2,SIGLEC14,ITGAX,MEFV,GAB2,MMP25,IGF2R,ATP6V0D1,DTX4,TLN1,PRKACA,ADGRE5,CLEC4C"], ["1,269,310", "Cytokine Signaling in Immune system", "1.26E-01", "5.91E-01", "1.00E+00", "1.00E+00", "8", "HLA-DQA1,ITGAX,GAB2,LGALS9,CIITA,TLN1,PRKACA,IL17RA"], ["1,269,957", "Metabolism of carbohydrates", "1.31E-01", "5.91E-01", "1.00E+00", "1.00E+00", "4", "NDST1,AMY1B,SLC9A1,PRKACA"], ["1,269,876", "Vesicle-mediated transport", "1.41E-01", "5.91E-01", "1.00E+00", "1.00E+00", "7", "VPS37C,HIP1,GABARAP,APOL1,ARF3,RAB36,IGF2R"], ["1,269,507", "Signaling by Rho GTPases", "3.11E-01", "6.03E-01", "1.00E+00", "1.00E+00", "4", "ARHGEF5,GMIP,ARHGAP1,ARAP3"], ["1,269,649", "Gene Expression", "9.87E-01", "9.89E-01", "1.00E+00", "1.00E+00", "6", "CDKN2A,POLR2A,ZNF385A,EIF3CL,BAZ2A,ZNF70"]], "row_count": 15, "column_count": 8, "numeric_cells": 78, "header_rows": 1, "locator": "section[13]/table-wrap[1]#Tab3"}}, {"id": "asset:table:pmid:33827531:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d562384dbb1fa5d7c550c4b2014445aa67929168dc0263d46e9effda35c511cc", "bytes": 2799, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[2]#Tab4", "version": null, "note": "The enriched GO terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8028841", "section_index": 13, "section_title": "Gene Ontology (GO) and pathway enrichment analyses of DEGs", "row_count": 15, "column_count": 9}, "table": {"label": "Table 4", "caption": "The enriched GO terms of the up and down regulated differentially expressed genes", "rows": [["GO ID", "CATEGORY", "GO Name", "P Value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["GO:0007267", "BP", "cell-cell signaling", "6.48E-03", "1.84E-01", "1.00E+00", "1.00E+00", "22", "TRHDE,NPBWR1,MYH6,AVP,PPFIA2,IL17B,PCDHB10,PCDHB2,GRIA4,GRIN2B,DCC,RGS4,PTHLH,CRHR2,GJA1,CSNK1A1L,DKK1,EGFR,SNAP91,RIMS4,LRP2,CCL13"], ["GO:0022414", "BP", "reproductive process", "1.22E-02", "1.99E-01", "1.00E+00", "1.00E+00", "19", "NPPC,AVP,BTBD18,MEIOB,RAD21L1,TEX15,PTHLH,GJA1,EGFR,SPATA16,MIF,OSR1,LRP2,HFM1,ACSBG2,SPATA22,ATP1A4,PRL,UTF1"], ["GO:0005887", "CC", "integral component of plasma membrane", "1.14E-03", "1.17E-01", "7.35E-01", "3.43E-01", "22", "TRHDE,SEMA6B,RDH8,NPBWR1,TMC2,TRHR,GPR37,PCDHB10,PCDHB2,TM4SF5,GRIA4,GRIN2B,DCC,KCNK4,PTPRT,CRHR2,ADGRL4,GJA1,EGFR,LRFN5,UPK1B,ATP1A4"], ["GO:0099512", "CC", "supramolecularfiber", "1.65E-02", "1.84E-01", "1.00E+00", "1.00E+00", "17", "ABRA,DNAH3,MYH6,MYOT,NRAP,TMC2,MYH13,KIF1A,GRIN2B,GJA1,KRT39,MFAP2,TRIM55,LRP2,KRT20,KRT38,PTPN20"], ["GO:0038023", "MF", "signaling receptor activity", "1.59E-03", "1.30E-01", "8.79E-01", "7.75E-01", "22", "OR2T29,NPBWR1,MYOT,TRHR,GPR37,OR10J3,GRIA4,GRIN2B,DCC,PTPRT,CRHR2,ADGRL4,MTRNR2L1,OR51E2,MTRNR2L6,OR51E1,DKK1,EGFR,OR6C70,LRP2,ADGRF4,FCAMR"], ["GO:0005198", "MF", "structural molecule activity", "3.67E-02", "2.51E-01", "1.00E+00", "1.00E+00", "10", "MYOT,EPB41L4B,MRPL12,PPFIA2,EMILIN3,KRT39,MFAP2,UPK1B,KRT20,KRT38"], ["Down regulated genes"], ["GO:0006906", "BP", "vesicle fusion", "1.55E-04", "7.94E-02", "6.71E-01", "4.06E-01", "17", "CRISPLD2,DSP,RIMS3,OSCAR,SIGLEC14,DYSF,ITGAX,ITIH4,GAB2,LGALS9,MMP25,IGF2R,SCAMP5,TLN1,ADGRE5,TNFAIP2,CLEC4C"], ["GO:0022610", "BP", "biological adhesion", "2.52E-03", "2.18E-01", "1.00E+00", "1.00E+00", "19", "CDKN2A,MYADM,DSP,HLA-DQA1,LAG3,SIGLEC14,DYSF,ITGAX,TNFRSF21,LGALS9,SLC9A1,TLN1,NECTIN1,SORBS3,AOC3,PLXNA4,PXN,ADGRE5,PLXNA2"], ["GO:0098805", "CC", "whole membrane", "4.42E-03", "1.66E-01", "1.00E+00", "1.00E+00", "21", "VPS37C,MYADM,HIP1,TPCN2,DSP,HLA-DQA1,SIGLEC14,GABARAP,DYSF,ITGAX,MICALL1,MMP25,ARHGAP1,SLC9A1,IGF2R,ATP6V0D1,SCAMP5,PRKACA,ADGRE5,CLEC4C,ATG16L2"], ["GO:0030054", "CC", "cell junction", "2.83E-02", "3.05E-01", "1.00E+00", "1.00E+00", "15", "MYADM,DSP,ARHGEF5,RIMS3,LASP1,SLC9A1,IGF2R,SCAMP5,TLN1,NECTIN1,SORBS3,PXN,ADGRE5,ALKBH6,PDZD3"], ["GO:0008289", "MF", "lipid binding", "2.91E-03", "1.08E-01", "7.31E-01", "1.00E+00", "13", "HIP1,CPNE9,ARHGEF5,PAQR6,APOL1,DYSF,GAB2,MICALL1,SLC9A1,IGF2R,ARAP3,TLN1,APOL2"], ["GO:0051020", "MF", "GTPase binding", "5.51E-03", "1.08E-01", "7.31E-01", "1.00E+00", "10", "ARHGEF5,RGL3,RIMS3,MICALL1,ARHGAP1,PRKACA,DAAM2,RIPOR1,RGL2,RAPGEFL1"]], "row_count": 15, "column_count": 9, "numeric_cells": 81, "header_rows": 1, "locator": "section[13]/table-wrap[2]#Tab4"}}, {"id": "asset:table:pmid:33827531:9", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3bdd31668dbfacf02e690dbc34efbb3fbc31b4d530156b49012cfff60f552d39", "bytes": 12296, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab5", "version": null, "note": "Topology table for up and down regulated genes", "structure": {"pmcid": "PMC8028841", "section_index": 14, "section_title": "PPI network construction and module analysis", "row_count": 233, "column_count": 6}, "table": {"label": "Table 5", "caption": "Topology table for up and down regulated genes", "rows": [["Regulation", "Node", "Degree", "Betweenness", "Stress", "Closeness"], ["Up", "EGFR", "1343", "0.514227", "4.35E+08", "0.441893"], ["Up", "GRIN2B", "195", "0.008701", "14,535,992", "0.282164"], ["Up", "GJA1", "170", "0.03151", "64,939,702", "0.31364"], ["Up", "CAP2", "108", "0.004218", "888,128", "0.325945"], ["Up", "MIF", "99", "0.025028", "7,627,912", "0.362124"], ["Up", "DCC", "98", "0.009465", "15,166,420", "0.286956"], ["Up", "PRL", "89", "0.001208", "656,482", "0.239894"], ["Up", "EYA1", "72", "0.003864", "4,335,792", "0.271944"], ["Up", "RGS4", "63", "0.003414", "1,243,420", "0.31129"], ["Up", "GRIA4", "55", "0.001352", "431,502", "0.292547"], ["Up", "CCL19", "50", "0.001236", "1,457,894", "0.1951"], ["Up", "DKK1", "50", "0.003569", "4,044,234", "0.25252"], ["Up", "PLN", "43", "0.003324", "524,170", "0.286083"], ["Up", "GPR37", "41", "0.021208", "9,337,328", "0.303261"], ["Up", "LRP2", "39", "0.023544", "9,018,868", "0.307583"], ["Up", "PTHLH", "38", "0.001269", "1,103,574", "0.257729"], ["Up", "PPFIA2", "33", "0.002618", "3,942,042", "0.269956"], ["Up", "KIF1A", "31", "0.011317", "2,986,868", "0.345485"], ["Up", "HOXB7", "31", "0.002165", "2,106,446", "0.268893"], ["Up", "MYOT", "28", "0.003103", "475,758", "0.275841"], ["Up", "OTX2", "28", "0.003016", "868,076", "0.271263"], ["Up", "NPPC", "27", "0.003211", "986,326", "0.247419"], ["Up", "KRT20", "26", "0.005296", "5,544,830", "0.279444"], ["Up", "MRPL12", "25", "0.050618", "70,486,194", "0.310399"], ["Up", "NPBWR1", "23", "4.01E-04", "207,170", "0.174777"], ["Up", "TRHR", "22", "4.10E-04", "210,106", "0.238152"], ["Up", "CCL13", "20", "0.003552", "1,650,164", "0.263645"], ["Up", "MFAP2", "19", "0.002005", "451,990", "0.228053"], ["Up", "TRIM55", "18", "0.021705", "17,474,648", "0.300609"], ["Up", "NEUROG3", "18", "0.011467", "9,544,416", "0.269256"], ["Up", "NRAP", "18", "0.001974", "406,892", "0.285085"], ["Up", "PTPRT", "18", "0.00104", "208,946", "0.324523"], ["Up", "OSR1", "17", "4.56E-04", "195,068", "0.226447"], ["Up", "EFS", "17", "0.003557", "2,975,070", "0.285232"], ["Up", "HBZ", "17", "0.006623", "4,433,868", "0.287818"], ["Up", "KCNK4", "16", "4.01E-04", "117,736", "0.247125"], ["Up", "AVP", "16", "0.006488", "3,769,102", "0.26391"], ["Up", "SOX18", "16", "8.04E-04", "761,526", "0.244028"], ["Up", "NACA2", "15", "0.002639", "3,304,692", "0.274822"], ["Up", "SRXN1", "15", "0.005715", "9,265,020", "0.276852"], ["Up", "UTF1", "13", "1", "12", "1"], ["Up", "RNF180", "13", "4.01E-04", "186,722", "0.235697"], ["Up", "KRT38", "12", "0.011531", "15,515,646", "0.273676"], ["Up", "FAP", "12", "0.005985", "10,442,836", "0.259379"], ["Up", "GULP1", "12", "0.001542", "1,584,446", "0.281416"], ["Up", "IL17B", "12", "4.02E-04", "151,558", "0.24843"], ["Up", "CRHR2", "11", "0.002005", "1,044,220", "0.245978"], ["Up", "RFPL4A", "10", "9.09E-06", "2638", "0.1894"], ["Up", "SNAP91", "10", "0.001514", "2,227,728", "0.265994"], ["Up", "ADGRL4", "10", "0", "0", "0"], ["Up", "FBXO10", "10", "0.002727", "598,280", "0.287801"], ["Up", "CST6", "9", "0.009382", "6,670,420", "0.28234"], ["Up", "PADI3", "9", "0.003682", "1,684,994", "0.267321"], ["Up", "LIPF", "9", "0.002462", "1,222,458", "0.239008"], ["Up", "CA10", "8", "0.00882", "3,036,648", "0.251628"], ["Up", "EPB41L4B", "8", "0.00328", "3,044,266", "0.280229"], ["Up", "OR51E2", "8", "0.002481", "1,735,460", "0.249674"], ["Up", "RIMS4", "8", "4.46E-04", "187,102", "0.255497"], ["Up", "MYT1L", "8", "1.71E-04", "156,968", "0.255523"], ["Up", "C4orf48", "7", "4.02E-04", "410,864", "0.238654"], ["Up", "EMILIN3", "7", "0.002789", "890,368", "0.2335"], ["Up", "CSNK1A1L", "6", "0.002373", "3,707,900", "0.264526"], ["Up", "ATP1A4", "6", "0.001778", "1,343,858", "0.269795"], ["Up", "OR6C70", "6", "0", "0", "1"], ["Up", "MEIOB", "6", "1.19E-04", "55,294", "0.237857"], ["Up", "UPK1B", "5", "0.001266", "639,316", "0.238883"], ["Up", "TEX15", "5", "8.47E-04", "384,696", "0.261104"], ["Up", "CAMK1G", "5", "0.001061", "955,066", "0.263353"], ["Up", "FOXQ1", "5", "0.02441", "34,422,300", "0.29497"], ["Up", "MYH13", "4", "0.007248", "6,307,480", "0.276193"], ["Up", "MYH6", "4", "0.006387", "8,432,142", "0.276223"], ["Up", "SPATA22", "4", "0.001497", "616,922", "0.255628"], ["Up", "TRHDE", "4", "0.004478", "568,880", "0.325562"], ["Up", "CCDC144A", "4", "0.001246", "906,138", "0.212789"], ["Up", "PCDHB10", "4", "8.03E-04", "313,938", "0.212698"], ["Up", "CNMD", "4", "0.001108", "411,030", "0.251134"], ["Up", "ABRA", "4", "0.001639", "940,076", "0.263019"], ["Up", "MS4A5", "4", "0", "0", "0.246088"], ["Up", "DNAH3", "3", "5.51E-04", "333,004", "0.269839"], ["Up", "MTRNR2L1", "3", "9.66E-04", "646,606", "0.269168"], ["Up", "KPNA7", "3", "4.63E-04", "356,676", "0.259541"], ["Up", "CBLN2", "3", "0", "0", "1"], ["Up", "FSIP2", "3", "4.14E-04", "158,112", "0.250276"], ["Up", "SPATA16", "3", "0", "0", "0.237426"], ["Up", "ZNF214", "2", "0.004409", "2,022,086", "0.235753"], ["Up", "CCDC140", "2", "4.01E-04", "96,422", "0.215353"], ["Up", "UGT2A3", "2", "8.95E-04", "518,942", "0.239952"], ["Up", "FAM71D", "2", "4.04E-04", "236,600", "0.24016"], ["Up", "GOLGA6B", "2", "0", "0", "0.221585"], ["Up", "C2orf73", "2", "8.02E-04", "393,150", "0.236301"], ["Up", "GOLGA8G", "2", "0", "0", "1"], ["Up", "SMCO1", "1", "4.28E-04", "175,370", "0.225341"], ["Up", "ANKRD30B", "1", "0", "0", "1"], ["Up", "FCAMR", "1", "0", "0", "0.225719"], ["Up", "HFM1", "1", "8.96E-05", "46,366", "0.226673"], ["Up", "BTBD18", "1", "0", "0", "0.306486"], ["Up", "ACSBG2", "1", "4.02E-04", "116,692", "0.247358"], ["Up", "KRT39", "1", "0", "0", "0.251806"], ["Up", "G6PC", "1", "0.001203", "289,260", "0.215428"], ["Up", "RBM46", "1", "1.99E-06", "1374", "0.252879"], ["Up", "PCDHB2", "1", "0", "0", "1"], ["Up", "AS3MT", "1", "0", "0", "0.210364"], ["Up", "RAD21L1", "1", "0", "0", "1"], ["Up", "CAPN9", "1", "2.61E-06", "2714", "0.211893"], ["Up", "FABP6", "1", "0", "0", "1"], ["Down", "POLR2A", "512", "0.095104", "2E+08", "0.3738"], ["Down", "PRKACA", "350", "0.104658", "44,280,174", "0.378052"], ["Down", "GABARAP", "322", "0.144708", "36,234,824", "0.358401"], ["Down", "TLN1", "223", "0.027406", "67,578,124", "0.35998"], ["Down", "PXN", "173", "0.029203", "29,047,866", "0.360318"], ["Down", "HIP1", "146", "0.007469", "12,022,620", "0.347944"], ["Down", "GAB2", "118", "0.014217", "38,718,180", "0.340041"], ["Down", "SYVN1", "114", "0.025941", "12,050,404", "0.307887"], ["Down", "KCNIP2", "110", "0.002849", "14,186,360", "0.253084"], ["Down", "ARHGAP1", "106", "0.011263", "27,047,958", "0.348406"], ["Down", "NECTIN1", "102", "0.003189", "17,978,038", "0.252469"], ["Down", "RGL2", "88", "0.003069", "3,605,218", "0.263534"], ["Down", "ASF1B", "85", "0.00926", "21,237,598", "0.2861"], ["Down", "IGF2R", "78", "0.010589", "26,691,414", "0.303021"], ["Down", "SLC9A1", "75", "0.009561", "24,396,634", "0.292461"], ["Down", "VPS37C", "75", "0.006908", "5,646,832", "0.29327"], ["Down", "MEFV", "72", "0.001361", "31,003,730", "0.301081"], ["Down", "CDKN2A", "72", "0.051693", "14,128,370", "0.321613"], ["Down", "MAP1A", "63", "0.008662", "3,403,950", "0.291879"], ["Down", "ARF3", "60", "0.004127", "11,523,596", "0.287784"], ["Down", "CIITA", "59", "0.006319", "10,301,788", "0.302892"], ["Down", "WDTC1", "57", "0.005909", "19,161,622", "0.278569"], ["Down", "MICALL1", "53", "0.005986", "7,902,576", "0.285919"], ["Down", "ITGAX", "53", "0.001212", "13,088,030", "0.238757"], ["Down", "SORBS3", "51", "0.016308", "10,468,808", "0.314749"], ["Down", "DSP", "47", "0.039735", "2,314,856", "0.347581"], ["Down", "BAZ2A", "45", "0.004013", "13,101,300", "0.289472"], ["Down", "MAPRE3", "44", "0.006813", "4,554,084", "0.28533"], ["Down", "CRTC2", "44", "0.004812", "11,994,716", "0.296709"], ["Down", "PADI4", "43", "0.002174", "7,728,076", "0.275765"], ["Down", "SPINT1", "42", "0.001717", "6,257,478", "0.263492"], ["Down", "ARHGEF5", "40", "0.003561", "7,025,544", "0.336483"], ["Down", "LASP1", "40", "0.021943", "9,410,452", "0.31303"], ["Down", "PDZD3", "39", "0.005273", "6,150,510", "0.249549"], ["Down", "HIVEP3", "39", "0.001859", "4,355,942", "0.26672"], ["Down", "TNFRSF21", "36", "0.001781", "3,131,524", "0.274883"], ["Down", "SOGA1", "36", "0.005248", "10,217,032", "0.291623"], ["Down", "MBD6", "34", "0.002017", "1,737,436", "0.231979"], ["Down", "ATP6V0D1", "33", "0.026324", "1,957,202", "0.303649"], ["Down", "IQCN", "32", "0.015047", "5,650,026", "0.283239"], ["Down", "IL17RA", "30", "0.020601", "4,651,714", "0.286807"], ["Down", "ABTB2", "29", "0.001793", "4,772,698", "0.279695"], ["Down", "INCA1", "29", "0.011463", "2,924,018", "0.276668"], ["Down", "MAST3", "28", "0.019115", "4,567,048", "0.308592"], ["Down", "BEST1", "28", "4.42E-04", "3,684,990", "0.260082"], ["Down", "PRSS21", "28", "0.001117", "5,817,460", "0.25749"], ["Down", "TPCN2", "27", "0.014228", "4,144,602", "0.284792"], ["Down", "LAG3", "26", "4.41E-06", "6,746,636", "0.238038"], ["Down", "GMIP", "24", "8.12E-04", "3,636,310", "0.263896"], ["Down", "CLEC4C", "24", "4.01E-04", "725,910", "0.175956"], ["Down", "TAGLN", "23", "0.016019", "4,532,938", "0.283771"], ["Down", "FAM219A", "20", "0.008105", "916,962", "0.287867"], ["Down", "NCR1", "20", "0.002234", "349,872", "0.271381"], ["Down", "PRRC2A", "18", "0.015874", "2,767,592", "0.307261"], ["Down", "KCNMB1", "18", "8.42E-04", "2,984,594", "0.257118"], ["Down", "EIF3CL", "17", "0.003808", "1,129,844", "0.284272"], ["Down", "H6PD", "17", "5.55E-04", "3,133,402", "0.259123"], ["Down", "MMP25", "17", "4.01E-04", "2,598,252", "0.238837"], ["Down", "ENTPD2", "16", "1", "2,170,770", "1"], ["Down", "DYSF", "16", "0.009592", "704,606", "0.292839"], ["Down", "LGALS9", "16", "0.01981", "1,417,206", "0.288134"], ["Down", "DPEP2", "16", "0.007617", "1,500,838", "0.260885"], ["Down", "POMZP3", "14", "8.35E-05", "836,800", "0.254857"], ["Down", "EXTL3", "13", "0.004948", "611,924", "0.27899"], ["Down", "EPHX1", "13", "0.006221", "2,003,020", "0.279491"], ["Down", "C15orf39", "12", "0.00794", "610,110", "0.291793"], ["Down", "PLXNA2", "12", "0.009415", "1,162,970", "0.277268"], ["Down", "PLPPR2", "12", "0.006567", "1,448,934", "0.253961"], ["Down", "MYADM", "11", "0.007222", "952,256", "0.283771"], ["Down", "GTPBP1", "11", "0.005922", "1,877,862", "0.299976"], ["Down", "ADGRE5", "10", "0.014659", "888,184", "0.289203"], ["Down", "SULT1A2", "10", "0.00172", "1,783,464", "0.247973"], ["Down", "INKA2", "10", "0.00214", "1,184,052", "0.279616"], ["Down", "NDST1", "10", "0.001942", "1,716,840", "0.257383"], ["Down", "TTLL3", "9", "0.002348", "134,132", "0.261694"], ["Down", "DRICH1", "9", "0.002408", "1,799,342", "0.237302"], ["Down", "APOL2", "9", "0.007736", "489,254", "0.289489"], ["Down", "ZNF70", "9", "0.001286", "3,985,632", "0.223763"], ["Down", "ASPRV1", "9", "0.00395", "1,038,668", "0.290552"], ["Down", "PLXNA4", "8", "0.001243", "473,354", "0.262534"], ["Down", "FAM160A1", "8", "4.10E-04", "882,848", "0.241043"], ["Down", "PLBD2", "8", "0.002764", "1,265,098", "0.278057"], ["Down", "RNF122", "8", "0.001044", "1,049,362", "0.265329"], ["Down", "PAQR6", "8", "4.10E-04", "868,456", "0.23693"], ["Down", "CHKB", "7", "0", "602,254", "0.217363"], ["Down", "CRISPLD2", "7", "3.80E-06", "943,864", "0.256153"], ["Down", "DUSP18", "7", "0.002971", "325,170", "0.315506"], ["Down", "TRANK1", "7", "4.02E-04", "801,248", "0.245821"], ["Down", "TP53INP2", "6", "1.70E-07", "703,508", "0.247198"], ["Down", "ARAP3", "6", "4.92E-04", "286,916", "0.268169"], ["Down", "TNFAIP2", "6", "0.001439", "633,692", "0.254324"], ["Down", "APOL1", "5", "6.25E-04", "48,364", "0.233895"], ["Down", "PRR16", "5", "0.001298", "158,878", "0.26692"], ["Down", "ITIH4", "5", "4.46E-04", "356,728", "0.266806"], ["Down", "SIGLEC14", "5", "0", "273,222", "1"], ["Down", "C5AR2", "5", "0.019084", "54,700", "0.270983"], ["Down", "DTX4", "5", "8.06E-04", "445,430", "0.256483"], ["Down", "SCAMP5", "5", "0.002526", "469,900", "0.229016"], ["Down", "SH3D21", "5", "1.03E-04", "675,458", "0.314928"], ["Down", "LY6G5B", "4", "6.87E-04", "43,440", "0.259947"], ["Down", "TMEM121B", "4", "0", "217,638", "0.1804"], ["Down", "AOC3", "4", "0.002207", "251,106", "0.268748"], ["Down", "DAAM2", "3", "0.00264", "78,488", "0.259838"], ["Down", "ZBTB3", "3", "0.006264", "225,562", "0.267838"], ["Down", "LCNL1", "3", "9.23E-05", "198,214", "0.235286"], ["Down", "RIMS3", "2", "4.16E-04", "11,332", "0.223944"], ["Down", "ZNF385A", "2", "6.60E-04", "3498", "0.264948"], ["Down", "RIPOR1", "2", "6.43E-04", "1512", "0.277964"], ["Down", "KDM6B", "2", "0.003441", "321,702", "0.271411"], ["Down", "PAPLN", "2", "0.001857", "53,928", "0.244759"], ["Down", "RAB36", "2", "4.01E-04", "4276", "0.188797"], ["Down", "NOMO2", "2", "5.94E-04", "78", "0.280182"], ["Down", "AOC2", "2", "5.51E-04", "3886", "0.250113"], ["Down", "PROSER3", "2", "4.60E-05", "2", "0.23941"], ["Down", "WDFY4", "2", "2.38E-06", "184,474", "0.236975"], ["Down", "ATG16L2", "2", "0.001016", "322,434", "0.299651"], ["Down", "RAPGEFL1", "2", "7.68E-05", "9928", "0.260599"], ["Down", "CPNE9", "1", "9.19E-05", "0", "0.23639"], ["Down", "RSKR", "1", "4.69E-06", "0", "0.247739"], ["Down", "RGL3", "1", "0", "0", "0.234621"], ["Down", "SHISA4", "1", "0", "0", "1"], ["Down", "TMEM63C", "1", "0", "0", "0.24945"], ["Down", "NPIPB3", "1", "8.84E-06", "0", "0.229639"], ["Down", "CLEC17A", "1", "0", "0", "0.209331"], ["Down", "TIFAB", "1", "0", "0", "1"], ["Down", "OSCAR", "1", "0", "0", "1"], ["Down", "AGAP9", "1", "0", "0", "0.236256"]], "row_count": 233, "column_count": 6, "numeric_cells": 981, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab5"}}, {"id": "asset:table:pmid:33827531:10", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:851b41ab4768756577727535fc509a3eb1ce602d778e71d0e1fbc5cc34fd1d7b", "bytes": 49099, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#Tab6", "version": null, "note": "miRNA - target gene and TF - target gene interaction", "structure": {"pmcid": "PMC8028841", "section_index": 15, "section_title": "Prediction of key miRNAs", "row_count": 869, "column_count": 8}, "table": {"label": "Table 6", "caption": "miRNA - target gene and TF - target gene interaction", "rows": [["Regulation", "Target Genes", "Degree", "MicroRNA", "Regulation", "Target Genes", "Degree", "TF"], ["UP", "COL12A1", "110", "hsa-mir-526b-5p", "UP", "SUZ12", "164", "PAX3"], ["UP", "COL1A2", "81", "hsa-mir-1254", "UP", "AR", "162", "ANKRD18B"], ["UP", "SIX4", "73", "hsa-mir-1909-5p", "UP", "STAT3", "147", "WT1"], ["UP", "GNG12", "69", "hsa-mir-3194-3p", "UP", "TP53", "138", "ADCYAP1R1"], ["UP", "HAS2", "63", "hsa-mir-30e-5p", "UP", "EGR1", "137", "KIF1A"], ["UP", "COL3A1", "58", "hsa-mir-4691-3p", "UP", "SMAD4", "130", "WFDC1"], ["UP", "PRKAA2", "57", "hsa-mir-3619-5p", "UP", "NANOG", "129", "MAGI1"], ["UP", "DKK1", "56", "hsa-mir-579-3p", "UP", "REST", "123", "LHX2"], ["UP", "EGFR", "56", "hsa-mir-494-3p", "UP", "TP63", "121", "CYR61"], ["UP", "RGS4", "50", "hsa-mir-526a", "UP", "POU5F1", "121", "PDE10A"], ["UP", "CSRNP3", "50", "hsa-mir-338-3p", "UP", "MTF2", "120", "ESRP2"], ["UP", "SPRY4", "50", "hsa-mir-21-5p", "UP", "TCF4", "115", "EBF3"], ["UP", "GJA1", "50", "hsa-mir-185-5p", "UP", "MYC", "114", "DDC"], ["UP", "PRRX1", "49", "hsa-mir-888-3p", "UP", "HNF4A", "114", "EGFR"], ["UP", "GRIN2B", "48", "hsa-let-7a-5p", "UP", "RUNX2", "92", "CELF4"], ["UP", "GDA", "44", "hsa-mir-548d-5p", "UP", "RUNX1", "87", "BCAR1"], ["UP", "BDKRB2", "40", "hsa-let-7f-5p", "UP", "SETDB1", "87", "LMO1"], ["UP", "HOXB8", "38", "hsa-mir-30d-3p", "UP", "RNF2", "85", "SIX1"], ["UP", "EFEMP1", "37", "hsa-let-7a-2-3p", "UP", "SPI1", "84", "PTHLH"], ["UP", "PGR", "35", "hsa-mir-320b", "UP", "EZH2", "81", "BARX2"], ["UP", "KIF1A", "33", "hsa-mir-125a-5p", "UP", "PPARD", "79", "EXOC3L4"], ["UP", "CAP2", "33", "hsa-let-7c-5p", "UP", "SIN3B", "79", "SPRY4"], ["UP", "EYA1", "30", "hsa-mir-133a-3p", "UP", "SMARCA4", "78", "FOXQ1"], ["UP", "NPNT", "30", "hsa-mir-1304-3p", "UP", "MITF", "76", "GNG12"], ["UP", "MAGI1", "29", "hsa-let-7f-1-3p", "UP", "BMI1", "76", "LRFN5"], ["UP", "MICU3", "28", "hsa-mir-182-5p", "UP", "GATA2", "75", "ZSCAN10"], ["UP", "PDE10A", "28", "hsa-mir-1288-3p", "UP", "TCF3", "74", "IGSF21"], ["UP", "SYT4", "27", "hsa-mir-320a", "UP", "SALL4", "74", "SULF1"], ["UP", "GULP1", "26", "hsa-mir-532-5p", "UP", "PPARG", "73", "PRRX1"], ["UP", "HOXB7", "26", "hsa-mir-2277-3p", "UP", "JARID2", "72", "DMRTA2"], ["UP", "AMER2", "25", "hsa-mir-369-3p", "UP", "SOX9", "72", "PTPRT"], ["UP", "MTRNR2L1", "25", "hsa-mir-4793-3p", "UP", "TRIM28", "71", "RGS20"], ["UP", "SLC9A2", "25", "hsa-mir-15b-5p", "UP", "FLI1", "69", "MRO"], ["UP", "EEF1G", "25", "hsa-mir-106b-5p", "UP", "ESR1", "67", "RERG"], ["UP", "FBXO10", "24", "hsa-mir-23c", "UP", "KLF4", "67", "RFX4"], ["UP", "FAXC", "24", "hsa-mir-135a-5p", "UP", "SRY", "67", "SRXN1"], ["UP", "ADAMTS9", "24", "hsa-mir-181a-2-3p", "UP", "RCOR3", "64", "C8orf4"], ["UP", "FOXQ1", "24", "hsa-mir-503-5p", "UP", "GATA1", "64", "COL12A1"], ["UP", "EPB41L4B", "23", "hsa-mir-141-5p", "UP", "E2F1", "64", "GJA1"], ["UP", "SH3GL2", "23", "hsa-mir-548 am-5p", "UP", "YAP1", "63", "HAS2"], ["UP", "CLVS2", "23", "hsa-mir-32-3p", "UP", "POU3F2", "63", "HOXD8"], ["UP", "GPR158", "22", "hsa-mir-302d-3p", "UP", "CREM", "62", "OSR1"], ["UP", "SOX2", "22", "hsa-mir-361-5p", "UP", "PBX1", "62", "OTX2"], ["UP", "FSTL5", "21", "hsa-mir-5100", "UP", "RAD21", "62", "PKNOX2"], ["UP", "LRRTM2", "21", "hsa-mir-125b-5p", "UP", "FOXP1", "62", "TRAPPC5"], ["UP", "FAP", "21", "hsa-mir-30a-5p", "UP", "EP300", "61", "EN1"], ["UP", "MIF", "21", "hsa-mir-139-3p", "UP", "TET1", "58", "HES5"], ["UP", "GABRA4", "21", "hsa-mir-23a-3p", "UP", "SMAD3", "56", "OVOL1"], ["UP", "TMEM121", "21", "hsa-mir-3065-3p", "UP", "NR3C1", "55", "DKK1"], ["UP", "GPR37", "21", "hsa-mir-192-5p", "UP", "EED", "55", "TBX20"], ["UP", "SNAP91", "21", "hsa-mir-29a-3p", "UP", "OLIG2", "53", "DPP10"], ["UP", "BCAR1", "21", "hsa-mir-1296-5p", "UP", "ERG", "50", "MYRIP"], ["UP", "PPFIA2", "20", "hsa-mir-140-3p", "UP", "FOXA2", "48", "MNX1"], ["UP", "LAMA4", "20", "hsa-mir-30e-3p", "UP", "PHC1", "48", "ZFPM2"], ["UP", "AREG", "20", "hsa-mir-449b-5p", "UP", "KDM5B", "46", "EEF1G"], ["UP", "PAX3", "20", "hsa-mir-5690", "UP", "TFAP2A", "46", "NOS1"], ["UP", "PRSS12", "19", "hsa-mir-1260a", "UP", "TFAP2C", "44", "EYA1"], ["UP", "HHIP", "19", "hsa-mir-488-3p", "UP", "PRDM14", "43", "TAC4"], ["UP", "SULF1", "19", "hsa-mir-130a-3p", "UP", "JUN", "42", "PRSS12"], ["UP", "PTPRT", "19", "hsa-mir-518c-5p", "UP", "ZNF281", "41", "PDLIM4"], ["UP", "PTHLH", "18", "hsa-mir-376a-5p", "UP", "CREB1", "40", "ASCL1"], ["UP", "TEAD4", "18", "hsa-mir-520c-3p", "UP", "RBPJ", "39", "CAMK1G"], ["UP", "URGCP-MRPS24", "16", "hsa-mir-933", "UP", "CUX1", "39", "TRIM55"], ["UP", "CBLN2", "16", "hsa-mir-3065-3p", "UP", "NFE2L2", "38", "LRP2"], ["UP", "TRHDE", "16", "hsa-let-7i-5p", "UP", "ASH2L", "37", "RPE65"], ["UP", "SLC30A3", "16", "hsa-let-7 g-5p", "UP", "SCLY", "36", "KCNIP1"], ["UP", "NPPC", "16", "hsa-mir-497-5p", "UP", "BACH1", "35", "EFEMP1"], ["UP", "PPP2R2C", "16", "hsa-mir-219a-5p", "UP", "RCOR1", "34", "OR51E2"], ["UP", "ZFPM2", "16", "hsa-mir-4705", "UP", "CTNNB1", "33", "KRT39"], ["UP", "SIX1", "16", "hsa-mir-139-5p", "UP", "EWSR1", "32", "BDKRB2"], ["UP", "GABRB3", "16", "hsa-mir-582-3p", "UP", "SMAD2", "32", "CAP2"], ["UP", "SEMA6B", "15", "hsa-mir-221-5p", "UP", "ZNF217", "31", "THSD4"], ["UP", "EBF3", "15", "hsa-mir-629-5p", "UP", "SOX17", "31", "UTF1"], ["UP", "THSD4", "15", "hsa-mir-612", "UP", "DMRT1", "30", "DCC"], ["UP", "MFAP2", "15", "hsa-mir-503-5p", "UP", "DNAJC2", "30", "MEGF10"], ["UP", "ESRP2", "15", "hsa-mir-98-5p", "UP", "RELA", "30", "SIX4"], ["UP", "RASSF9", "15", "hsa-mir-588", "UP", "FOXP2", "28", "CBLN2"], ["UP", "TIMP4", "14", "hsa-mir-1343-3p", "UP", "ATF3", "28", "PDPN"], ["UP", "PDE1A", "14", "hsa-mir-369-3p", "UP", "NR0B1", "28", "SLC30A3"], ["UP", "RERG", "14", "hsa-mir-671-5p", "UP", "EOMES", "28", "WIF1"], ["UP", "MNX1", "14", "hsa-mir-548z", "UP", "TAL1", "27", "AS3MT"], ["UP", "MYT1L", "14", "hsa-mir-199a-3p", "UP", "TFCP2L1", "27", "CACNA1G"], ["UP", "RFX6", "14", "hsa-mir-33a-3p", "UP", "KLF1", "27", "CCL17"], ["UP", "TRAPPC5", "13", "hsa-mir-1269b", "UP", "TBX3", "27", "HHIP"], ["UP", "TMEM151A", "13", "hsa-let-7e-5p", "UP", "ARNT", "26", "PADI3"], ["UP", "LRP2", "13", "hsa-mir-1305", "UP", "ELF5", "24", "HFM1"], ["UP", "GRM5", "13", "hsa-mir-22-3p", "UP", "CEBPB", "24", "NPY"], ["UP", "ITGBL1", "13", "hsa-mir-16-2-3p", "UP", "MYCN", "21", "EPB41L4B"], ["UP", "LHX2", "13", "hsa-mir-3661", "UP", "YY1", "21", "RIMS4"], ["UP", "RGS20", "13", "hsa-mir-4659a-3p", "UP", "ESRRB", "21", "SMTNL2"], ["UP", "CDH18", "13", "hsa-mir-550a-3p", "UP", "ELF1", "20", "SPDEF"], ["UP", "C4orf48", "12", "hsa-mir-497-5p", "UP", "NR1I2", "19", "CBLC"], ["UP", "LARP6", "12", "hsa-mir-126-3p", "UP", "HSF1", "19", "HOXB7"], ["UP", "GRIA4", "12", "hsa-mir-377-3p", "UP", "ELK1", "19", "NEUROG3"], ["UP", "TEX15", "12", "hsa-mir-1304-5p", "UP", "NACC1", "19", "REN"], ["UP", "SCG3", "12", "hsa-mir-448", "UP", "MYBL2", "19", "SP9"], ["UP", "LRRC8E", "12", "hsa-mir-500a-5p", "UP", "ZFX", "19", "TMEM121"], ["UP", "SPDEF", "12", "hsa-mir-939-5p", "UP", "E2F4", "18", "AMER2"], ["UP", "KCNT2", "11", "hsa-mir-548o-3p", "UP", "AHR", "18", "CNTNAP4"], ["UP", "OTOGL", "11", "hsa-mir-548n", "UP", "CTCF", "18", "GRIN2B"], ["UP", "TMEM145", "11", "hsa-mir-1913", "UP", "FOXO3", "17", "BTC"], ["UP", "RIMS4", "11", "hsa-mir-326", "UP", "SIN3A", "17", "GPR158"], ["UP", "SRXN1", "11", "hsa-mir-195-5p", "UP", "CDX2", "17", "HOXB8"], ["UP", "TRPA1", "11", "hsa-mir-320d", "UP", "MEF2A", "17", "HSD11B2"], ["UP", "SELE", "11", "hsa-mir-17-5p", "UP", "CNOT3", "17", "SCN3B"], ["UP", "HES5", "11", "hsa-mir-4511", "UP", "SOX11", "16", "LRRC74A"], ["UP", "C3orf80", "10", "hsa-mir-369-3p", "UP", "CEBPD", "16", "PDE1A"], ["UP", "PKNOX2", "10", "hsa-mir-490-3p", "UP", "TCF7", "16", "PPP2R2C"], ["UP", "EPN3", "10", "hsa-mir-1825", "UP", "LYL1", "16", "SLC9A2"], ["UP", "HRCT1", "10", "hsa-mir-374a-5p", "UP", "STAT5A", "15", "CYP39A1"], ["UP", "SERPIND1", "10", "hsa-mir-452-5p", "UP", "HTT", "15", "PGR"], ["UP", "CRHR2", "10", "hsa-mir-31-5p", "UP", "LMO2", "15", "RNF180"], ["UP", "MIPOL1", "10", "hsa-mir-651-5p", "UP", "SREBF2", "15", "TMEM151A"], ["UP", "MYH6", "9", "hsa-mir-301a-3p", "UP", "PAX6", "14", "ACSBG2"], ["UP", "PMCH", "9", "hsa-mir-30a-5p", "UP", "DROSHA", "14", "ANO4"], ["UP", "C8orf34", "9", "hsa-mir-302c-3p", "UP", "GFI1B", "14", "FFAR1"], ["UP", "ANO4", "9", "hsa-mir-29b-3p", "UP", "TTF2", "14", "NR0B2"], ["UP", "SCEL", "9", "hsa-mir-671-5p", "UP", "STAT4", "14", "PRLHR"], ["UP", "RHOJ", "9", "hsa-mir-103a-3p", "UP", "GATA3", "13", "BCO1"], ["UP", "PDLIM4", "9", "hsa-mir-1270", "UP", "CCND1", "13", "COL1A2"], ["UP", "CYP39A1", "9", "hsa-mir-1179", "UP", "ZFP42", "13", "EFS"], ["UP", "SLC26A3", "9", "hsa-mir-494-3p", "UP", "GATA4", "13", "MMP27"], ["UP", "OVOL1", "9", "hsa-mir-15a-5p", "UP", "MEIS1", "11", "DNAI1"], ["UP", "BTC", "9", "hsa-mir-194-5p", "UP", "TCF7L2", "11", "ELAVL3"], ["UP", "CNTFR", "9", "hsa-mir-708-5p", "UP", "STAT1", "11", "FOLH1"], ["UP", "MRPL12", "9", "hsa-mir-98-5p", "UP", "IRF8", "11", "GDA"], ["UP", "SP9", "8", "hsa-mir-1343-3p", "UP", "SMAD1", "11", "LEMD1"], ["UP", "GPC6", "8", "hsa-mir-1306-5p", "UP", "ZIC3", "11", "TIMP4"], ["UP", "IRX5", "8", "hsa-mir-522-5p", "UP", "FOXO1", "10", "DAND5"], ["UP", "KRT20", "8", "hsa-mir-429", "UP", "IRF1", "10", "RHOJ"], ["UP", "LRFN5", "8", "hsa-mir-369-3p", "UP", "TBX5", "9", "FBXO10"], ["UP", "TM4SF5", "8", "hsa-mir-203a-3p", "UP", "DACH1", "9", "NKAIN4"], ["UP", "ANP32D", "8", "hsa-mir-375", "UP", "RCOR2", "9", "SOX18"], ["UP", "BCO1", "8", "hsa-mir-137", "UP", "MYB", "8", "CCDC158"], ["UP", "SPINK4", "8", "hsa-mir-374a-5p", "UP", "HOXC9", "8", "RGS4"], ["UP", "SCN3B", "8", "hsa-mir-10b-5p", "UP", "PDX1", "8", "SYT4"], ["UP", "SOX18", "8", "hsa-mir-373-3p", "UP", "SRF", "7", "ABRA"], ["UP", "MTRNR2L6", "8", "hsa-mir-30b-5p", "UP", "BCL3", "7", "ADAM7"], ["UP", "EMILIN3", "8", "hsa-mir-1301-3p", "UP", "HOXB4", "7", "BPIFC"], ["UP", "ECM2", "8", "hsa-mir-548e-3p", "UP", "SREBF1", "7", "C8ORF34"], ["UP", "DKK2", "8", "hsa-mir-1260b", "UP", "ZNF274", "7", "CWH43"], ["UP", "CAPN9", "8", "hsa-mir-20b-5p", "UP", "VDR", "7", "ELTD1"], ["UP", "CRYAA", "8", "hsa-mir-185-3p", "UP", "KLF5", "7", "GSX2"], ["UP", "OSR1", "8", "hsa-mir-185-3p", "UP", "PADI4", "7", "KCNT2"], ["UP", "SHISA8", "7", "hsa-mir-376a-5p", "UP", "GBX2", "7", "NELL1"], ["UP", "SPINK13", "7", "hsa-mir-16-5p", "UP", "KLF2", "7", "SOX2"], ["UP", "LEMD1", "7", "hsa-mir-147a", "UP", "NFIB", "6", "BTBD16"], ["UP", "NPBWR1", "7", "hsa-mir-373-3p", "UP", "NOTCH1", "6", "CAPSL"], ["UP", "OR51E2", "7", "hsa-mir-616-5p", "UP", "PRDM5", "6", "CYP2W1"], ["UP", "PDPN", "7", "hsa-mir-520c-3p", "UP", "IKZF1", "6", "EMILIN3"], ["UP", "GPR6", "7", "hsa-mir-93-5p", "UP", "MECOM", "6", "MICU3"], ["UP", "ASCL1", "7", "hsa-mir-302a-3p", "UP", "ESR2", "6", "NPNT"], ["UP", "BTBD16", "7", "hsa-mir-671-5p", "UP", "RARG", "6", "THRSP"], ["UP", "PCDHB2", "7", "hsa-mir-1343-3p", "UP", "XRN2", "5", "C2ORF73"], ["UP", "CELF4", "7", "hsa-mir-4511", "UP", "ASXL1", "5", "FNDC8"], ["UP", "BARX2", "7", "hsa-mir-638", "UP", "TBP", "5", "FSD2"], ["UP", "CA10", "7", "hsa-mir-219a-2-3p", "UP", "THRA", "5", "GNAT1"], ["UP", "PLA2G5", "7", "hsa-mir-122-5p", "UP", "CHD1", "5", "MIF"], ["UP", "HOXD8", "7", "hsa-mir-340-5p", "UP", "CEBPA", "5", "SERPIND1"], ["UP", "INHA", "7", "hsa-mir-346", "UP", "HIF1A", "5", "UPK1B"], ["UP", "ALPI", "7", "hsa-mir-148b-3p", "UP", "HOXD13", "4", "ANGPT4"], ["UP", "PLN", "6", "hsa-mir-205-5p", "UP", "NUCKS1", "4", "CRP"], ["UP", "SLC51B", "6", "hsa-mir-194-5p", "UP", "PHF8", "4", "TEAD4"], ["UP", "WT1", "6", "hsa-mir-766-5p", "UP", "ZNF652", "3", "CNTN2"], ["UP", "DAND5", "6", "hsa-mir-122-5p", "UP", "DCP1A", "3", "GULP1"], ["UP", "REG1B", "6", "hsa-mir-224-5p", "UP", "TAF7L", "3", "IRX5"], ["UP", "RNF180", "6", "hsa-mir-103a-2-5p", "UP", "KDM5A", "3", "MRPL12"], ["UP", "MEGF10", "6", "hsa-mir-369-3p", "UP", "TFEB", "3", "SPINK4"], ["UP", "DMRTA2", "6", "hsa-mir-588", "UP", "SALL1", "2", "GRIA4"], ["UP", "KCNH5", "6", "hsa-mir-4786-3p", "UP", "ETS1", "2", "IZUMO1"], ["UP", "ACSBG2", "6", "hsa-mir-940", "UP", "BP1", "2", "SELE"], ["UP", "IL17B", "6", "hsa-mir-23b-3p", "UP", "ZNF322", "2", "TRHDE"], ["UP", "AMBP", "6", "hsa-mir-224-3p", "UP", "GLI1", "2", "ZSWIM2"], ["UP", "HECW1", "6", "hsa-mir-4701-3p", "UP", "MYBL1", "1", "CSHL1"], ["UP", "AS3MT", "6", "hsa-mir-2277-3p", "UP", "KDM6A", "1", "DRD2"], ["UP", "EFS", "6", "hsa-mir-210-3p", "UP", "ETS2", "1", "GPC6"], ["UP", "COL6A5", "6", "hsa-mir-590-3p", "UP", "CHD7", "1", "INHA"], ["UP", "DNAH3", "6", "hsa-mir-605-5p", "UP", "AP1S2", "1", "IZUMO1"], ["UP", "ADCYAP1R1", "6", "hsa-mir-365b-3p", "UP", "NR1H3", "1", "MRPL12"], ["UP", "NACA2", "6", "hsa-mir-500a-3p", "UP", "NR4A2", "1", "MYT1L"], ["UP", "CCDC144A", "6", "hsa-mir-4789-5p", "UP", "STAT6", "1", "PLN"], ["UP", "SI", "6", "hsa-mir-203a-3p", "UP", "HCFC1", "1", "SCG3"], ["UP", "ELAVL3", "6", "hsa-mir-151a-5p", "UP", "PRDM16", "1", "TRHDE"], ["UP", "PDF", "6", "hsa-mir-20a-5p", "Down", "SPI1", "316", "STAT3"], ["UP", "ZNF728", "5", "hsa-mir-550a-3p", "Down", "RUNX1", "235", "SETDB1"], ["UP", "MYH4", "5", "hsa-mir-99b-5p", "Down", "MYC", "235", "TP53"], ["UP", "CCDC169", "5", "hsa-mir-125b-2-3p", "Down", "EGR1", "227", "TLE3"], ["UP", "SLCO6A1", "5", "hsa-mir-1180-3p", "Down", "FLI1", "222", "IRF1"], ["UP", "TUBA3C", "5", "hsa-mir-3619-5p", "Down", "SOX2", "216", "VDR"], ["UP", "SLC22A25", "5", "hsa-mir-200b-3p", "Down", "HNF4A", "210", "BCL3"], ["UP", "HSD11B2", "5", "hsa-mir-769-3p", "Down", "NANOG", "194", "KIAA0247"], ["UP", "MRGPRF", "5", "hsa-mir-2467-5p", "Down", "MITF", "180", "ABTB2"], ["UP", "HSPB2", "5", "hsa-mir-100-5p", "Down", "POU5F1", "179", "CNOT3"], ["UP", "MYRIP", "5", "hsa-mir-4708-3p", "Down", "TP63", "175", "MEF2D"], ["UP", "LMO1", "5", "hsa-mir-1224-3p", "Down", "CREM", "173", "SEC14L1"], ["UP", "GPR15", "5", "hsa-mir-138-5p", "Down", "E2F1", "167", "STAT6"], ["UP", "CAPSL", "5", "hsa-mir-155-5p", "Down", "GATA2", "161", "ARID1A"], ["UP", "HBZ", "5", "hsa-mir-146a-5p", "Down", "CREB1", "160", "EHBP1L1"], ["UP", "IGSF21", "5", "hsa-mir-182-5p", "Down", "GATA1", "156", "TNS3"], ["UP", "NT5C1A", "5", "hsa-mir-373-3p", "Down", "TAL1", "139", "TRAPPC9"], ["UP", "PLA2G10", "5", "hsa-mir-34a-5p", "Down", "KLF4", "138", "PRCC"], ["UP", "CST6", "5", "hsa-mir-522-5p", "Down", "AR", "138", "SLC9A8"], ["UP", "AVP", "5", "hsa-mir-302a-3p", "Down", "REST", "134", "PADI4"], ["UP", "CCL19", "5", "hsa-mir-148b-3p", "Down", "FOXP1", "132", "BMF"], ["UP", "PHF21B", "5", "hsa-mir-4482-5p", "Down", "TFAP2C", "124", "PLEKHG3"], ["UP", "RHBDL2", "5", "hsa-mir-210-3p", "Down", "TET1", "124", "STK40"], ["UP", "DCC", "5", "hsa-mir-542-3p", "Down", "PPARG", "124", "TRIM25"], ["UP", "CBLC", "5", "hsa-mir-195-5p", "Down", "SOX9", "120", "DLGAP4"], ["UP", "CDKL2", "5", "hsa-mir-135a-5p", "Down", "SIN3B", "119", "LASP1"], ["UP", "ISY1-RAB43", "4", "hsa-mir-378 g", "Down", "SRY", "107", "MIDN"], ["UP", "BTBD18", "4", "hsa-mir-941", "Down", "MECOM", "102", "CD97"], ["UP", "ANKRD18B", "4", "hsa-mir-374a-5p", "Down", "SUZ12", "102", "PLXNA2"], ["UP", "C17orf102", "4", "hsa-mir-376c-3p", "Down", "FOXA2", "101", "CLPB"], ["UP", "FSIP2", "4", "hsa-mir-22-5p", "Down", "E2F4", "101", "POLR2A"], ["UP", "PERM1", "4", "hsa-mir-345-5p", "Down", "TCF3", "101", "SLC1A4"], ["UP", "CYP4X1", "4", "hsa-mir-210-3p", "Down", "TCF4", "97", "STK10"], ["UP", "KPNA7", "4", "hsa-mir-191-5p", "Down", "ERG", "96", "ARRB1"], ["UP", "OR51E1", "4", "hsa-mir-145-5p", "Down", "PPARD", "96", "PVRL1"], ["UP", "ANKRD30B", "4", "hsa-mir-27b-3p", "Down", "TRIM28", "92", "ADAR"], ["UP", "LRRC3B", "4", "hsa-let-7 g-3p", "Down", "SMAD4", "91", "DAP"], ["UP", "C2orf73", "4", "hsa-mir-605-5p", "Down", "MYCN", "91", "ZNFX1"], ["UP", "MAP3K19", "4", "hsa-mir-520f-3p", "Down", "ZFX", "89", "TAF8"], ["UP", "GLYATL1", "4", "hsa-mir-1343-3p", "Down", "CCND1", "88", "KDM6B"], ["UP", "NELL1", "4", "hsa-mir-20a-5p", "Down", "KDM5B", "84", "WASF2"], ["UP", "SLCO1C1", "4", "hsa-mir-128-3p", "Down", "ASH2L", "82", "ATP6V0A1"], ["UP", "IL21", "4", "hsa-mir-372-3p", "Down", "YY1", "82", "HIVEP3"], ["UP", "ZSCAN10", "4", "hsa-mir-302a-3p", "Down", "EOMES", "81", "RERE"], ["UP", "NEUROG3", "4", "hsa-mir-373-3p", "Down", "ZNF281", "80", "TBC1D13"], ["UP", "ASPA", "4", "hsa-mir-1271-5p", "Down", "ATF3", "79", "WBP2"], ["UP", "WFDC1", "4", "hsa-mir-941", "Down", "TBX5", "79", "WRAP53"], ["UP", "SLC10A1", "4", "hsa-mir-449a", "Down", "DMRT1", "75", "F11R"], ["UP", "SLC16A8", "4", "hsa-mir-550a-3-5p", "Down", "SCLY", "74", "PISD"], ["UP", "PDE6C", "4", "hsa-mir-18a-3p", "Down", "FOXO3", "73", "ADAM19"], ["UP", "ABCC12", "4", "hsa-mir-3611", "Down", "LMO2", "73", "SEC24C"], ["UP", "G6PC", "4", "hsa-mir-33b-5p", "Down", "TFCP2L1", "72", "FAM168A"], ["UP", "FAM131C", "4", "hsa-mir-1343-3p", "Down", "HOXB4", "72", "GBF1"], ["UP", "SMTNL2", "4", "hsa-mir-373-3p", "Down", "MYBL2", "71", "SEMA4B"], ["UP", "NLRP14", "4", "hsa-mir-941", "Down", "SALL4", "70", "BAG6"], ["UP", "PCDHB10", "4", "hsa-mir-374a-5p", "Down", "TCF7", "69", "DOPEY2"], ["UP", "ANGPT4", "4", "hsa-mir-107", "Down", "TFAP2A", "69", "WWP2"], ["UP", "REN", "4", "hsa-mir-200c-3p", "Down", "RCOR3", "68", "KSR1"], ["UP", "APOH", "4", "hsa-mir-136-5p", "Down", "SMAD3", "67", "SIPA1L1"], ["UP", "EN1", "4", "hsa-mir-381-3p", "Down", "ESR1", "66", "PPCDC"], ["UP", "CCL17", "4", "hsa-mir-148b-3p", "Down", "RUNX2", "66", "PREX1"], ["UP", "C14orf39", "4", "hsa-mir-330-5p", "Down", "SMARCA4", "65", "GATAD2B"], ["UP", "HFM1", "4", "hsa-mir-490-5p", "Down", "RAD21", "64", "MKL1"], ["UP", "OTX2", "4", "hsa-mir-181a-5p", "Down", "GATA4", "63", "GABARAP"], ["UP", "PDE11A", "4", "hsa-mir-1343-3p", "Down", "GFI1B", "63", "NDE1"], ["UP", "B3GALT1", "4", "hsa-mir-4496", "Down", "EP300", "62", "MAP7D1"], ["UP", "NR0B2", "4", "hsa-mir-24-3p", "Down", "PRDM14", "62", "TNFRSF21"], ["UP", "CTAGE6", "3", "hsa-mir-99b-5p", "Down", "MEIS1", "61", "CSNK2B"], ["UP", "PMF1-BGLAP", "3", "hsa-let-7b-5p", "Down", "NR0B1", "61", "IP6K1"], ["UP", "C19orf81", "3", "hsa-mir-130b-5p", "Down", "PBX1", "61", "LY6G5B"], ["UP", "C1orf141", "3", "hsa-mir-3685", "Down", "CUX1", "60", "ATP6V0D1"], ["UP", "LHFPL3", "3", "hsa-mir-30d-5p", "Down", "YAP1", "59", "CBX7"], ["UP", "OR51B4", "3", "hsa-mir-214-3p", "Down", "KLF1", "58", "GAB2"], ["UP", "KCNIP1", "3", "hsa-mir-10b-5p", "Down", "TEAD4", "58", "STIM1"], ["UP", "DPP10", "3", "hsa-mir-1301-3p", "Down", "CEBPB", "57", "AGER"], ["UP", "FAM71D", "3", "hsa-mir-301a-5p", "Down", "KDM5A", "57", "SYVN1"], ["UP", "GYPA", "3", "hsa-mir-31-5p", "Down", "CTCF", "57", "YLPM1"], ["UP", "SERPINA9", "3", "hsa-mir-212-3p", "Down", "SRF", "56", "ADD1"], ["UP", "KLK4", "3", "hsa-mir-429", "Down", "WT1", "56", "PNKD"], ["UP", "SERPINB12", "3", "hsa-mir-598-3p", "Down", "STAT4", "55", "GNAI2"], ["UP", "TBX20", "3", "hsa-mir-34c-5p", "Down", "MTF2", "54", "MAPKAPK2"], ["UP", "TCHH", "3", "hsa-mir-147a", "Down", "XRN2", "52", "SLC9A1"], ["UP", "ZSCAN1", "3", "hsa-mir-155-5p", "Down", "HOXC9", "50", "TRIM41"], ["UP", "DUSP15", "3", "hsa-mir-146a-5p", "Down", "RBPJ", "49", "ARHGAP17"], ["UP", "ZNF214", "3", "hsa-mir-224-5p", "Down", "FOXP2", "49", "DGAT2"], ["UP", "TRIM55", "3", "hsa-mir-429", "Down", "EZH2", "49", "SIRPA"], ["UP", "PADI3", "3", "hsa-mir-129-2-3p", "Down", "IRF8", "49", "XPO6"], ["UP", "DDC", "3", "hsa-mir-517a-3p", "Down", "CTNNB1", "48", "TLN1"], ["UP", "MAS1", "3", "hsa-mir-182-5p", "Down", "TTF2", "45", "FAM53C"], ["UP", "KIF25", "3", "hsa-mir-101-3p", "Down", "SMAD2", "45", "MFN2"], ["UP", "CTCFL", "3", "hsa-mir-100-5p", "Down", "DACH1", "45", "POLR1A"], ["UP", "KCNJ13", "3", "hsa-mir-9-5p", "Down", "SOX17", "45", "SESN2"], ["UP", "REG1A", "3", "hsa-mir-1270", "Down", "FOXP3", "44", "ACP2"], ["UP", "UPK1B", "3", "hsa-mir-29c-3p", "Down", "RELA", "43", "DTX4"], ["UP", "RFX4", "3", "hsa-mir-532-3p", "Down", "ESRRB", "41", "BAZ2A"], ["UP", "NKAIN4", "3", "hsa-mir-1343-3p", "Down", "ZNF217", "41", "NF2"], ["UP", "CLUL1", "3", "hsa-mir-941", "Down", "MYB", "41", "RAB37"], ["UP", "ADAM7", "3", "hsa-mir-302a-3p", "Down", "ELK1", "41", "SNX11"], ["UP", "C8B", "3", "hsa-mir-373-3p", "Down", "TBP", "40", "AGPAT1"], ["UP", "CACNA1G", "3", "hsa-mir-1343-3p", "Down", "ELF1", "40", "ITGA5"], ["UP", "TSPYL6", "3", "hsa-mir-423-5p", "Down", "NR3C1", "39", "DYSF"], ["UP", "KCNK4", "3", "hsa-mir-27a-3p", "Down", "ETS1", "39", "KRTCAP2"], ["UP", "WIF1", "3", "hsa-mir-200b-3p", "Down", "THAP11", "38", "DENND1A"], ["UP", "RPE65", "3", "hsa-mir-103a-3p", "Down", "EWSR1", "37", "KIAA0556"], ["UP", "FABP6", "3", "hsa-mir-214-3p", "Down", "BMI1", "37", "MAML3"], ["UP", "ZPLD1", "3", "hsa-mir-148b-3p", "Down", "SIN3A", "37", "NDST1"], ["UP", "COX8C", "3", "hsa-mir-132-3p", "Down", "RNF2", "36", "RTN1"], ["UP", "ALDOB", "3", "hsa-mir-4690-5p", "Down", "SOX11", "35", "C14ORF159"], ["UP", "MAS1L", "3", "hsa-mir-7-5p", "Down", "ASXL1", "35", "PACS1"], ["UP", "FOLH1", "3", "hsa-mir-100-5p", "Down", "CRX", "34", "SCAP"], ["UP", "CYP2F1", "3", "hsa-mir-34b-5p", "Down", "JUN", "33", "CTDSP2"], ["UP", "RAD21L1", "2", "hsa-mir-103a-3p", "Down", "ZFP42", "33", "MARK2"], ["UP", "CFHR1", "2", "hsa-mir-671-5p", "Down", "MEF2A", "33", "TOP3A"], ["UP", "EXOC3L4", "2", "hsa-mir-133a-3p", "Down", "PHF8", "32", "GSK3A"], ["UP", "C10orf113", "2", "hsa-mir-941", "Down", "TFEB", "32", "OGDH"], ["UP", "DPPA5", "2", "hsa-mir-182-5p", "Down", "JARID2", "32", "RAP1GAP2"], ["UP", "LPA", "2", "hsa-mir-147a", "Down", "SREBF2", "31", "SIK3"], ["UP", "RD3", "2", "hsa-mir-744-5p", "Down", "STAT5A", "29", "MAFF"], ["UP", "NRAP", "2", "hsa-mir-129-2-3p", "Down", "DNAJC2", "28", "C15ORF39"], ["UP", "PRELP", "2", "hsa-mir-382-5p", "Down", "NFE2L2", "28", "CHST15"], ["UP", "C2orf80", "2", "hsa-mir-124-3p", "Down", "TBX3", "27", "CIITA"], ["UP", "TMEM72", "2", "hsa-mir-103a-3p", "Down", "PDX1", "27", "FAM214B"], ["UP", "NPAP1", "2", "hsa-mir-26a-5p", "Down", "CHD1", "27", "INTS3"], ["UP", "FREM3", "2", "hsa-mir-3928-3p", "Down", "NR1I2", "27", "SETDB1"], ["UP", "LIPF", "2", "hsa-mir-27a-3p", "Down", "HSF1", "26", "DNMBP"], ["UP", "HEPHL1", "2", "hsa-mir-15a-3p", "Down", "OLIG2", "26", "RNF24"], ["UP", "OR52N5", "2", "hsa-mir-34b-5p", "Down", "LYL1", "26", "ZNF592"], ["UP", "GSX2", "2", "hsa-mir-155-5p", "Down", "CDX2", "25", "CDK5RAP3"], ["UP", "WFDC5", "2", "hsa-mir-191-5p", "Down", "NR1H3", "25", "SMG5"], ["UP", "TRHR", "2", "hsa-mir-182-5p", "Down", "BACH1", "23", "JAK3"], ["UP", "OR1L3", "2", "hsa-mir-200a-3p", "Down", "GATA3", "23", "RNPEP"], ["UP", "OR2K2", "2", "hsa-mir-146a-5p", "Down", "PRDM5", "23", "SMURF1"], ["UP", "KRT78", "2", "hsa-mir-126-3p", "Down", "ELF5", "22", "CRTC2"], ["UP", "A2ML1", "2", "hsa-mir-449a", "Down", "TAF7L", "22", "PRKACA"], ["UP", "CCDC158", "2", "hsa-mir-375", "Down", "NACC1", "22", "SLC44A2"], ["UP", "CCDC140", "2", "hsa-mir-520f-3p", "Down", "NUCKS1", "22", "VAMP2"], ["UP", "CCDC27", "2", "hsa-mir-942-5p", "Down", "ESR2", "21", "EPS15L1"], ["UP", "LRRC71", "2", "hsa-mir-23b-3p", "Down", "DCP1A", "21", "MICALL1"], ["UP", "FUT6", "2", "hsa-mir-330-3p", "Down", "AP1S2", "21", "TRPC4AP"], ["UP", "CNTNAP4", "2", "hsa-mir-15a-5p", "Down", "TCF7L2", "20", "HIP1"], ["UP", "UGT2A3", "2", "hsa-mir-210-3p", "Down", "PAX3", "20", "SPN"], ["UP", "CRP", "2", "hsa-mir-378 g", "Down", "ARNT", "20", "TMEM229B"], ["UP", "CDH15", "2", "hsa-mir-1343-3p", "Down", "RCOR1", "20", "ZNF692"], ["UP", "CST8", "2", "hsa-mir-27a-3p", "Down", "NFIB", "19", "RELL1"], ["UP", "MYH7", "2", "hsa-mir-155-5p", "Down", "STAT1", "19", "TK2"], ["UP", "CYP2W1", "2", "hsa-mir-124-3p", "Down", "PAX6", "18", "CRISPLD2"], ["UP", "CAMK1G", "2", "hsa-mir-3661", "Down", "CEBPA", "18", "VPS37C"], ["UP", "TMPRSS12", "2", "hsa-mir-26a-5p", "Down", "DROSHA", "14", "ABCG1"], ["UP", "RBM46", "2", "hsa-mir-27a-3p", "Down", "EED", "14", "CAMKK1"], ["UP", "MYOT", "2", "hsa-mir-26a-5p", "Down", "CLOCK", "14", "FLCN"], ["UP", "LRAT", "2", "hsa-mir-375", "Down", "PHC1", "14", "KIAA0319L"], ["UP", "KRT38", "2", "hsa-mir-16-5p", "Down", "SREBF1", "14", "QSOX1"], ["UP", "FFAR1", "2", "hsa-mir-146a-5p", "Down", "AHR", "14", "SYK"], ["UP", "LHCGR", "2", "hsa-mir-7-5p", "Down", "SMAD1", "13", "PIK3R5"], ["UP", "CSNK1A1L", "2", "hsa-mir-374a-5p", "Down", "HCFC1", "13", "PPP1R12"], ["UP", "ZSCAN4", "2", "hsa-mir-122-5p", "Down", "THRA", "13", "RNF31"], ["UP", "ABCB5", "2", "hsa-mir-1-3p", "Down", "ZIC3", "13", "SMARCD1"], ["UP", "BOLA2B", "2", "hsa-mir-603", "Down", "IKZF1", "12", "PHC2"], ["UP", "S100A7A", "2", "hsa-mir-26b-5p", "Down", "FOXO1", "11", "TNFRSF1B"], ["UP", "IRGC", "2", "hsa-mir-205-5p", "Down", "NOTCH1", "10", "ZNF324"], ["UP", "P2RX2", "2", "hsa-mir-146a-5p", "Down", "HIF1A", "9", "DAPK2"], ["UP", "MYOG", "2", "hsa-mir-200b-3p", "Down", "RARG", "9", "MBD6"], ["UP", "GHSR", "2", "hsa-mir-212-3p", "Down", "RCOR2", "9", "NSD1"], ["UP", "CNTN2", "2", "hsa-mir-1908-5p", "Down", "KDM6A", "8", "GALNS"], ["UP", "RBAK-RBAKDN", "1", "hsa-mir-378a-5p", "Down", "FOXM1", "8", "PI4K2A"], ["UP", "HSPE1-MOB4", "1", "hsa-mir-1-3p", "Down", "ETS2", "8", "ZSWIM1"], ["UP", "KRTAP10–5", "1", "hsa-mir-20a-5p", "Down", "HTT", "7", "SCAMP5"], ["UP", "AMY1A", "1", "hsa-mir-335-5p", "Down", "POU3F2", "6", "GPSM3"], ["UP", "MKRN2OS", "1", "hsa-mir-766-3p", "Down", "TCF21", "5", "GYS1"], ["UP", "RFPL4A", "1", "hsa-mir-101-3p", "Down", "CEBPD", "5", "POPDC2"], ["UP", "TDRD15", "1", "hsa-mir-455-5p", "Down", "ZNF274", "5", "SUPT5H"], ["UP", "GCGR", "1", "hsa-mir-101-3p", "Down", "MYBL1", "4", "CNTROB"], ["UP", "CSHL1", "1", "hsa-mir-146a-5p", "Down", "CDKN2AIP", "4", "MAP3K3"], ["UP", "KRT39", "1", "hsa-mir-1-3p", "Down", "CHD7", "4", "SNX27"], ["UP", "FSD2", "1", "hsa-mir-5682", "Down", "SALL1", "3", "DIAPH1"], ["UP", "TMPRSS11B", "1", "hsa-mir-27a-3p", "Down", "PRDM16", "3", "GALNT6"], ["UP", "SPATA8", "1", "hsa-mir-182-5p", "Down", "ZNF322", "3", "KDELR1"], ["UP", "BPIFC", "1", "hsa-mir-27a-3p", "Down", "GBX2", "3", "PLXNA4"], ["UP", "MRGPRE", "1", "hsa-mir-31-5p", "Down", "NR4A2", "3", "PPP1R10"], ["UP", "TMIGD1", "1", "hsa-mir-124-3p", "Down", "HOXD13", "3", "RAF1"], ["UP", "IZUMO1", "1", "hsa-mir-146a-5p", "Down", "ZNF652", "3", "U2AF1L4"], ["UP", "CCL13", "1", "hsa-mir-27a-3p", "Down", "ZNF263", "1", "PRSS21"], ["UP", "GPR62", "1", "hsa-mir-520f-3p", "Down", "KLF2", "1", "PXN"], ["UP", "RPRML", "1", "hsa-mir-146a-5p", "Down", "KLF5", "1", "PXN"], ["UP", "ABRA", "1", "hsa-mir-520f-3p", "Down", "E2F7", "1", "ZNF687"], ["UP", "LIPM", "1", "hsa-mir-188-3p", "Down", "BCL11B", "1", "SP110"], ["UP", "EFCAB3", "1", "hsa-mir-135b-5p", "", "", "", ""], ["UP", "PRL", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "UTF1", "1", "hsa-mir-302a-3p", "", "", "", ""], ["UP", "LKAAEAR1", "1", "hsa-mir-146a-5p", "", "", "", ""], ["UP", "FRMPD2", "1", "hsa-mir-3929", "", "", "", ""], ["UP", "TM4SF20", "1", "hsa-mir-128-3p", "", "", "", ""], ["UP", "TBX10", "1", "hsa-mir-429", "", "", "", ""], ["UP", "MS4A5", "1", "hsa-mir-146a-5p", "", "", "", ""], ["UP", "MOGAT2", "1", "hsa-mir-210-3p", "", "", "", ""], ["UP", "ZSWIM2", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "MEIOB", "1", "hsa-mir-302a-3p", "", "", "", ""], ["UP", "TMPRSS15", "1", "hsa-mir-34b-5p", "", "", "", ""], ["UP", "THRSP", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "TMC2", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "DRD2", "1", "hsa-mir-101-3p", "", "", "", ""], ["UP", "SPATA16", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "THSD7B", "1", "hsa-mir-129-2-3p", "", "", "", ""], ["UP", "CELA2A", "1", "hsa-mir-450b-5p", "", "", "", ""], ["UP", "EGR4", "1", "hsa-mir-129-2-3p", "", "", "", ""], ["UP", "MRO", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "NPBWR2", "1", "hsa-mir-146a-5", "", "", "", ""], ["UP", "PRLHR", "1", "hsa-mir-26a-5p", "", "", "", ""], ["UP", "OPRM1", "1", "hsa-mir-590-3p", "", "", "", ""], ["UP", "CRX", "1", "hsa-mir-766-3p", "", "", "", ""], ["UP", "GGTLC2", "1", "hsa-mir-107", "", "", "", ""], ["UP", "PLA2G3", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "NXPE1", "1", "hsa-mir-34a-5p", "", "", "", ""], ["UP", "RDH8", "1", "hsa-mir-27a-3p", "", "", "", ""], ["UP", "NPFFR2", "1", "hsa-mir-26a-5p", "", "", "", ""], ["UP", "MYH13", "1", "hsa-mir-26a-5p", "", "", "", ""], ["UP", "RASA4B", "1", "hsa-mir-335-5p", "", "", "", ""], ["UP", "GOLGA6L9", "1", "hsa-mir-335-5p", "", "", "", ""], ["UP", "KRTAP10–6", "1", "hsa-mir-335-5p", "", "", "", ""], ["UP", "TAC4", "1", "hsa-mir-335-5p", "", "", "", ""], ["UP", "OR3A1", "1", "hsa-mir-335-5p", "", "", "", ""], ["UP", "NPY", "1", "hsa-mir-335-5p", "", "", "", ""], ["UP", "HSD3B2", "1", "hsa-mir-335-5p", "", "", "", ""], ["UP", "UGT2A1", "1", "hsa-mir-26b-5p", "", "", "", ""], ["Down", "MIDN", "182", "hsa-mir-4705", "", "", "", ""], ["Down", "NSD1", "163", "hsa-mir-1271-3p", "", "", "", ""], ["Down", "ZNF264", "153", "hsa-mir-4517", "", "", "", ""], ["Down", "BAZ2A", "153", "hsa-mir-137", "", "", "", ""], ["Down", "ZNFX1", "141", "hsa-mir-150-3p", "", "", "", ""], ["Down", "ARID1A", "138", "hsa-mir-3929", "", "", "", ""], ["Down", "GATAD2B", "126", "hsa-mir-4803", "", "", "", ""], ["Down", "SOGA1", "123", "hsa-mir-1304-3p", "", "", "", ""], ["Down", "PLAGL2", "116", "hsa-mir-196a-5p", "", "", "", ""], ["Down", "PRR14L", "113", "hsa-mir-3691-5p", "", "", "", ""], ["Down", "POLR2A", "111", "hsa-mir-3187-3p", "", "", "", ""], ["Down", "SESN2", "110", "hsa-mir-1825", "", "", "", ""], ["Down", "ARF3", "109", "hsa-mir-2278", "", "", "", ""], ["Down", "PSAP", "108", "hsa-mir-7-1-3p", "", "", "", ""], ["Down", "ATXN1L", "107", "hsa-mir-1915-5p", "", "", "", ""], ["Down", "PRRC2A", "105", "hsa-mir-760", "", "", "", ""], ["Down", "ADAR", "105", "hsa-mir-3157-3p", "", "", "", ""], ["Down", "MEF2D", "104", "hsa-mir-642b-3p", "", "", "", ""], ["Down", "TLN1", "102", "hsa-mir-148b-3p", "", "", "", ""], ["Down", "USP22", "100", "hsa-mir-4511", "", "", "", ""], ["Down", "WASF2", "94", "hsa-mir-34c-3p", "", "", "", ""], ["Down", "KDM6B", "90", "hsa-mir-519b-3p", "", "", "", ""], ["Down", "MTF1", "90", "hsa-mir-516b-5p", "", "", "", ""], ["Down", "STAT3", "85", "hsa-mir-544a", "", "", "", ""], ["Down", "DIAPH1", "85", "hsa-mir-518c-5p", "", "", "", ""], ["Down", "STK35", "82", "hsa-mir-3177-5p", "", "", "", ""], ["Down", "DENND4B", "81", "hsa-mir-1304-5p", "", "", "", ""], ["Down", "TMEM127", "80", "hsa-mir-1277-5p", "", "", "", ""], ["Down", "GLYR1", "80", "hsa-mir-188-5p", "", "", "", ""], ["Down", "PPP1R10", "80", "hsa-mir-296-5p", "", "", "", ""], ["Down", "MAVS", "79", "hsa-mir-490-3p", "", "", "", ""], ["Down", "RAB11FIP1", "79", "hsa-mir-199a-3p", "", "", "", ""], ["Down", "MBD6", "78", "hsa-mir-1913", "", "", "", ""], ["Down", "DSP", "77", "hsa-mir-217", "", "", "", ""], ["Down", "IGF2R", "77", "hsa-mir-519d-3p", "", "", "", ""], ["Down", "CHD8", "77", "hsa-mir-520a-3p", "", "", "", ""], ["Down", "ASF1B", "75", "hsa-mir-196b-3p", "", "", "", ""], ["Down", "HYOU1", "74", "hsa-mir-18b-3p", "", "", "", ""], ["Down", "SCAMP2", "74", "hsa-mir-1287-5p", "", "", "", ""], ["Down", "LASP1", "73", "hsa-mir-106b-3p", "", "", "", ""], ["Down", "RAD54L2", "73", "hsa-mir-141-5p", "", "", "", ""], ["Down", "IRF1", "73", "hsa-mir-1296-5p", "", "", "", ""], ["Down", "SEC24C", "73", "hsa-mir-181c-5p", "", "", "", ""], ["Down", "CPSF7", "69", "hsa-mir-3115", "", "", "", ""], ["Down", "TNFRSF21", "68", "hsa-mir-129-1-3p", "", "", "", ""], ["Down", "XPO6", "66", "hsa-mir-139-5p", "", "", "", ""], ["Down", "SMARCD1", "65", "hsa-mir-10a-5p", "", "", "", ""], ["Down", "TRIM25", "65", "hsa-mir-19a-5p", "", "", "", ""], ["Down", "GBF1", "63", "hsa-mir-148a-3p", "", "", "", ""], ["Down", "TBC1D13", "63", "hsa-mir-301b-3p", "", "", "", ""], ["Down", "MAP1A", "62", "hsa-let-7f-2-3p", "", "", "", ""], ["Down", "NCOA6", "61", "hsa-mir-23a-3p", "", "", "", ""], ["Down", "CTDSP2", "60", "hsa-mir-21-5p", "", "", "", ""], ["Down", "FAM168A", "59", "hsa-mir-331-3p", "", "", "", ""], ["Down", "LMBR1L", "59", "hsa-mir-30e-3p", "", "", "", ""], ["Down", "TP53", "58", "hsa-mir-1246", "", "", "", ""], ["Down", "GNAI2", "58", "hsa-mir-5009-5p", "", "", "", ""], ["Down", "TAPBP", "57", "hsa-mir-566", "", "", "", ""], ["Down", "SORT1", "57", "hsa-mir-1301-3p", "", "", "", ""], ["Down", "MYADM", "56", "hsa-mir-506-3p", "", "", "", ""], ["Down", "STK40", "55", "hsa-mir-4458", "", "", "", ""], ["Down", "NF2", "54", "hsa-mir-188-3p", "", "", "", ""], ["Down", "KDELR1", "54", "hsa-mir-196a-5p", "", "", "", ""], ["Down", "MAPKAPK2", "54", "hsa-mir-1976", "", "", "", ""], ["Down", "MFN2", "54", "hsa-mir-1288-3p", "", "", "", ""], ["Down", "RAF1", "53", "hsa-mir-744-3p", "", "", "", ""], ["Down", "WBP2", "53", "hsa-mir-7-1-3p", "", "", "", ""], ["Down", "RNF24", "53", "hsa-mir-512-3p", "", "", "", ""], ["Down", "TLE3", "53", "hsa-mir-744-5p", "", "", "", ""], ["Down", "TRIM41", "53", "hsa-mir-939-5p", "", "", "", ""], ["Down", "YLPM1", "52", "hsa-mir-99b-3p", "", "", "", ""], ["Down", "SMURF1", "52", "hsa-mir-548d-3p", "", "", "", ""], ["Down", "SLC25A44", "52", "hsa-mir-5582-3p", "", "", "", ""], ["Down", "F11R", "52", "hsa-mir-1299", "", "", "", ""], ["Down", "C15orf39", "51", "hsa-mir-649", "", "", "", ""], ["Down", "SIPA1L1", "51", "hsa-mir-922", "", "", "", ""], ["Down", "CRTC2", "51", "hsa-mir-4690-5p", "", "", "", ""], ["Down", "PI4KB", "50", "hsa-mir-4487", "", "", "", ""], ["Down", "ARHGAP1", "49", "hsa-mir-3188", "", "", "", ""], ["Down", "NDST1", "49", "hsa-mir-551a", "", "", "", ""], ["Down", "LMTK2", "49", "hsa-mir-548d-5p", "", "", "", ""], ["Down", "SNX27", "49", "hsa-mir-624-3p", "", "", "", ""], ["Down", "MAP7D1", "48", "hsa-mir-5094", "", "", "", ""], ["Down", "IP6K1", "48", "hsa-mir-107", "", "", "", ""], ["Down", "ZDHHC18", "48", "hsa-mir-708-5p", "", "", "", ""], ["Down", "VAT1", "48", "hsa-mir-573", "", "", "", ""], ["Down", "CANT1", "48", "hsa-mir-615-3p", "", "", "", ""], ["Down", "RERE", "48", "hsa-mir-1914-3p", "", "", "", ""], ["Down", "MTMR3", "47", "hsa-mir-378d", "", "", "", ""], ["Down", "PIGS", "47", "hsa-mir-628-5p", "", "", "", ""], ["Down", "PHC2", "47", "hsa-mir-765", "", "", "", ""], ["Down", "SEC14L1", "47", "hsa-mir-769-5p", "", "", "", ""], ["Down", "POLR1A", "46", "hsa-mir-1281", "", "", "", ""], ["Down", "MAPRE3", "46", "hsa-mir-3180-3p", "", "", "", ""], ["Down", "ITGA5", "46", "hsa-mir-876-3p", "", "", "", ""], ["Down", "PACS1", "46", "hsa-mir-30c-1-3p", "", "", "", ""], ["Down", "ZNF445", "46", "hsa-mir-548j-5p", "", "", "", ""], ["Down", "GPR107", "45", "hsa-mir-708-5p", "", "", "", ""], ["Down", "PREX1", "45", "hsa-mir-608", "", "", "", ""], ["Down", "ZNF592", "45", "hsa-mir-760", "", "", "", ""], ["Down", "PBX2", "44", "hsa-mir-548ar-3p", "", "", "", ""], ["Down", "SYVN1", "44", "hsa-let-7f-1-3p", "", "", "", ""], ["Down", "SCAMP5", "43", "hsa-mir-618", "", "", "", ""], ["Down", "H6PD", "43", "hsa-mir-1285-5p", "", "", "", ""], ["Down", "TP53INP2", "43", "hsa-mir-365a-3p", "", "", "", ""], ["Down", "PISD", "42", "hsa-mir-664a-5p", "", "", "", ""], ["Down", "BAG6", "42", "hsa-mir-450a-1-3p", "", "", "", ""], ["Down", "ADD1", "42", "hsa-mir-18b-5p", "", "", "", ""], ["Down", "MAP3K3", "42", "hsa-mir-4802-3p", "", "", "", ""], ["Down", "TBC1D10B", "41", "hsa-mir-301a-3p", "", "", "", ""], ["Down", "RNF122", "40", "hsa-mir-455-5p", "", "", "", ""], ["Down", "SLC9A1", "39", "hsa-let-7 g-3p", "", "", "", ""], ["Down", "UBE2C", "39", "hsa-mir-4664-5p", "", "", "", ""], ["Down", "BMF", "39", "hsa-mir-1910–5p", "", "", "", ""], ["Down", "PLEKHG3", "39", "hsa-mir-3689f", "", "", "", ""], ["Down", "TMEM214", "39", "hsa-mir-1468-5p", "", "", "", ""], ["Down", "PLBD2", "39", "hsa-mir-377-3p", "", "", "", ""], ["Down", "FAM160A1", "39", "hsa-mir-616-5p", "", "", "", ""], ["Down", "EGLN2", "38", "hsa-mir-3687", "", "", "", ""], ["Down", "ZNF385A", "38", "hsa-mir-2114-5p", "", "", "", ""], ["Down", "WIPF2", "38", "hsa-mir-181d-5p", "", "", "", ""], ["Down", "EXTL3", "38", "hsa-mir-30d-3p", "", "", "", ""], ["Down", "VAMP2", "38", "hsa-mir-135a-5p", "", "", "", ""], ["Down", "PVR", "37", "hsa-mir-200c-3p", "", "", "", ""], ["Down", "SLC1A4", "37", "hsa-mir-3065-3p", "", "", "", ""], ["Down", "GPR157", "37", "hsa-mir-520a-3p", "", "", "", ""], ["Down", "TNS3", "37", "hsa-mir-543", "", "", "", ""], ["Down", "AGPAT1", "37", "hsa-mir-873-5p", "", "", "", ""], ["Down", "ARHGAP17", "36", "hsa-mir-199b-5p", "", "", "", ""], ["Down", "SLC48A1", "36", "hsa-mir-320d", "", "", "", ""], ["Down", "CPT2", "36", "hsa-mir-634", "", "", "", ""], ["Down", "FLCN", "36", "hsa-mir-33b-5p", "", "", "", ""], ["Down", "PXN", "36", "hsa-mir-421", "", "", "", ""], ["Down", "SLC44A2", "36", "hsa-mir-320a", "", "", "", ""], ["Down", "SMG5", "36", "hsa-mir-501-3p", "", "", "", ""], ["Down", "SLC35F6", "35", "hsa-mir-29a-3p", "", "", "", ""], ["Down", "NDE1", "35", "hsa-mir-629-5p", "", "", "", ""], ["Down", "CYTH2", "35", "hsa-mir-342-5p", "", "", "", ""], ["Down", "KCTD2", "35", "hsa-mir-204-3p", "", "", "", ""], ["Down", "MBOAT7", "34", "hsa-mir-522-5p", "", "", "", ""], ["Down", "DLGAP4", "34", "hsa-mir-379-5p", "", "", "", ""], ["Down", "TMBIM1", "34", "hsa-mir-3689e", "", "", "", ""], ["Down", "MARK2", "34", "hsa-mir-548q", "", "", "", ""], ["Down", "STAT2", "33", "hsa-mir-509-3-5p", "", "", "", ""], ["Down", "SEMA4B", "33", "hsa-mir-766-5p", "", "", "", ""], ["Down", "OGDH", "33", "hsa-mir-494-3p", "", "", "", ""], ["Down", "CNNM4", "33", "hsa-mir-520c-3p", "", "", "", ""], ["Down", "UBN1", "33", "hsa-mir-30b-3p", "", "", "", ""], ["Down", "KIAA0319L", "33", "hsa-mir-4999-5p", "", "", "", ""], ["Down", "HIP1", "33", "hsa-mir-302d-3p", "", "", "", ""], ["Down", "TRPC4AP", "33", "hsa-mir-4487", "", "", "", ""], ["Down", "PPP1R12B", "32", "hsa-mir-3127-5p", "", "", "", ""], ["Down", "PNKD", "32", "hsa-mir-638", "", "", "", ""], ["Down", "ABAT", "32", "hsa-mir-378a-3p", "", "", "", ""], ["Down", "CNOT3", "32", "hsa-mir-548n", "", "", "", ""], ["Down", "MOB3A", "31", "hsa-mir-4443", "", "", "", ""], ["Down", "LRP10", "31", "hsa-mir-922", "", "", "", ""], ["Down", "C6orf89", "31", "hsa-mir-181c-5p", "", "", "", ""], ["Down", "CYB561D1", "31", "hsa-mir-2114-5p", "", "", "", ""], ["Down", "CBX7", "30", "hsa-mir-519a-3p", "", "", "", ""], ["Down", "GBA2", "30", "hsa-mir-4518", "", "", "", ""], ["Down", "PLXNA2", "30", "hsa-mir-3619-5p", "", "", "", ""], ["Down", "TAGLN", "30", "hsa-mir-3200-3p", "", "", "", ""], ["Down", "RGL2", "30", "hsa-mir-3943", "", "", "", ""], ["Down", "METTL7A", "30", "hsa-mir-3613-3p", "", "", "", ""], ["Down", "PIGO", "30", "hsa-mir-29c-3p", "", "", "", ""], ["Down", "PROSER3", "30", "hsa-mir-328-3p", "", "", "", ""], ["Down", "C6orf136", "30", "hsa-mir-532-3p", "", "", "", ""], ["Down", "TRANK1", "29", "hsa-mir-671-5p", "", "", "", ""], ["Down", "PRKACA", "29", "hsa-mir-3179", "", "", "", ""], ["Down", "INTS3", "29", "hsa-mir-5699-3p", "", "", "", ""], ["Down", "ARHGEF40", "29", "hsa-mir-548ax", "", "", "", ""], ["Down", "GYS1", "28", "hsa-mir-4437", "", "", "", ""], ["Down", "ACP2", "28", "hsa-mir-4521", "", "", "", ""], ["Down", "QSOX1", "28", "hsa-mir-3180-3p", "", "", "", ""], ["Down", "VPS37C", "28", "hsa-mir-15b-3p", "", "", "", ""], ["Down", "SIK3", "28", "hsa-mir-137", "", "", "", ""], ["Down", "MAFF", "28", "hsa-mir-423-5p", "", "", "", ""], ["Down", "PRCC", "28", "hsa-mir-590-5p", "", "", "", ""], ["Down", "GSK3A", "27", "hsa-mir-378d", "", "", "", ""], ["Down", "DNMBP", "27", "hsa-mir-4733-5p", "", "", "", ""], ["Down", "BCL3", "27", "hsa-mir-548y", "", "", "", ""], ["Down", "LY6G5B", "27", "hsa-mir-497-5p", "", "", "", ""], ["Down", "SLC38A7", "26", "hsa-mir-522-5p", "", "", "", ""], ["Down", "FANCA", "26", "hsa-mir-2355-3p", "", "", "", ""], ["Down", "ATP6V0D1", "26", "hsa-mir-582-3p", "", "", "", ""], ["Down", "GABARAP", "26", "hsa-mir-888-3p", "", "", "", ""], ["Down", "FAM53C", "26", "hsa-mir-548b-3p", "", "", "", ""], ["Down", "PFKFB4", "26", "hsa-mir-550a-3-5p", "", "", "", ""], ["Down", "SCAP", "26", "hsa-mir-365b-3p", "", "", "", ""], ["Down", "ZNF692", "26", "hsa-mir-3127-3p", "", "", "", ""], ["Down", "SIRPA", "25", "hsa-mir-3685", "", "", "", ""], ["Down", "WDTC1", "25", "hsa-mir-361-3p", "", "", "", ""], ["Down", "RAB3D", "25", "hsa-mir-744-3p", "", "", "", ""], ["Down", "STIM1", "24", "hsa-mir-939-5p", "", "", "", ""], ["Down", "PRKCD", "24", "hsa-mir-383-5p", "", "", "", ""], ["Down", "STAT6", "24", "hsa-mir-520c-3p", "", "", "", ""], ["Down", "SUPT5H", "24", "hsa-mir-188-3p", "", "", "", ""], ["Down", "ZNF687", "24", "hsa-mir-579-3p", "", "", "", ""], ["Down", "SH3BP2", "24", "hsa-mir-5008-5p", "", "", "", ""], ["Down", "CASC3", "24", "hsa-mir-3934-5p", "", "", "", ""], ["Down", "SF3A1", "24", "hsa-mir-583", "", "", "", ""], ["Down", "RAPGEFL1", "24", "hsa-mir-320c", "", "", "", ""], ["Down", "ABCC10", "24", "hsa-mir-31-5p", "", "", "", ""], ["Down", "ADAM19", "24", "hsa-mir-29c-3p", "", "", "", ""], ["Down", "EPHX1", "23", "hsa-mir-376a-5p", "", "", "", ""], ["Down", "PAQR6", "23", "hsa-mir-424-5p", "", "", "", ""], ["Down", "RAP1GAP2", "23", "hsa-mir-362-5p", "", "", "", ""], ["Down", "KSR1", "23", "hsa-mir-150-3p", "", "", "", ""], ["Down", "VPS53", "23", "hsa-mir-3662", "", "", "", ""], ["Down", "HEATR6", "23", "hsa-mir-4803", "", "", "", ""], ["Down", "BET1L", "23", "hsa-mir-500a-5p", "", "", "", ""], ["Down", "PLEKHO2", "22", "hsa-mir-484", "", "", "", ""], ["Down", "NUCB1", "22", "hsa-mir-335-5p", "", "", "", ""], ["Down", "RIMS3", "22", "hsa-mir-455-3p", "", "", "", ""], ["Down", "SNX11", "22", "hsa-mir-624-5p", "", "", "", ""], ["Down", "SORBS3", "22", "hsa-mir-3619-5p", "", "", "", ""], ["Down", "ZNF324", "22", "hsa-mir-361-3p", "", "", "", ""], ["Down", "PRKD2", "22", "hsa-mir-22-3p", "", "", "", ""], ["Down", "FAM219A", "22", "hsa-mir-4726-3p", "", "", "", ""], ["Down", "CHST15", "21", "hsa-mir-29b-1-5p", "", "", "", ""], ["Down", "MAML3", "21", "hsa-mir-221-5p", "", "", "", ""], ["Down", "ARRB2", "21", "hsa-mir-181c-5p", "", "", "", ""], ["Down", "CD4", "21", "hsa-mir-140-3p", "", "", "", ""], ["Down", "HLA-DQA1", "21", "hsa-mir-330-3p", "", "", "", ""], ["Down", "FAM214B", "21", "hsa-mir-3176", "", "", "", ""], ["Down", "ADAT1", "21", "hsa-mir-191-5p", "", "", "", ""], ["Down", "ARHGEF11", "21", "hsa-mir-744-5p", "", "", "", ""], ["Down", "TTLL11", "21", "hsa-mir-302c-3p", "", "", "", ""], ["Down", "CDKN2A", "20", "hsa-mir-24-1-5p", "", "", "", ""], ["Down", "DUSP18", "20", "hsa-mir-106b-5p", "", "", "", ""], ["Down", "SP110", "20", "hsa-mir-148a-5p", "", "", "", ""], ["Down", "SPINT1", "20", "hsa-mir-452-5p", "", "", "", ""], ["Down", "ATP6V0A1", "19", "hsa-mir-377-3p", "", "", "", ""], ["Down", "SIDT2", "19", "hsa-mir-301a-5p", "", "", "", ""], ["Down", "RXRB", "19", "hsa-mir-32-5p", "", "", "", ""], ["Down", "APOL2", "19", "hsa-mir-103a-3p", "", "", "", ""], ["Down", "USP19", "19", "hsa-mir-3200-3p", "", "", "", ""], ["Down", "IQCE", "19", "hsa-mir-146b-5p", "", "", "", ""], ["Down", "CHST14", "19", "hsa-mir-671-5p", "", "", "", ""], ["Down", "TMEM179B", "19", "hsa-mir-631", "", "", "", ""], ["Down", "CXCL16", "19", "hsa-mir-200c-3p", "", "", "", ""], ["Down", "RNF19B", "19", "hsa-mir-99b-5p", "", "", "", ""], ["Down", "NAPA", "19", "hsa-mir-103a-3p", "", "", "", ""], ["Down", "ARRB1", "18", "hsa-mir-16-2-3p", "", "", "", ""], ["Down", "CASP9", "18", "hsa-mir-1291", "", "", "", ""], ["Down", "SMAP2", "18", "hsa-mir-629-3p", "", "", "", ""], ["Down", "DENND1A", "18", "hsa-mir-361-5p", "", "", "", ""], ["Down", "LRRC4", "18", "hsa-let-7c-5p", "", "", "", ""], ["Down", "NLRX1", "18", "hsa-mir-1255a", "", "", "", ""], ["Down", "TNFRSF1B", "18", "hsa-mir-125b-5p", "", "", "", ""], ["Down", "CDK5RAP3", "18", "hsa-mir-342-3p", "", "", "", ""], ["Down", "TK2", "18", "hsa-mir-302c-3p", "", "", "", ""], ["Down", "NLRP1", "18", "hsa-mir-15b-5p", "", "", "", ""], ["Down", "TAF8", "18", "hsa-mir-548 h-3p", "", "", "", ""], ["Down", "GALNT6", "18", "hsa-mir-331-5p", "", "", "", ""], ["Down", "RNPEP", "18", "hsa-mir-4664-5p", "", "", "", ""], ["Down", "ORAI2", "17", "hsa-mir-5699-3p", "", "", "", ""], ["Down", "PLEKHM1", "17", "hsa-mir-589-5p", "", "", "", ""], ["Down", "PLXNA4", "17", "hsa-mir-17-3p", "", "", "", ""], ["Down", "KIAA0513", "17", "hsa-mir-3065-3p", "", "", "", ""], ["Down", "P2RX5", "17", "hsa-let-7f-5p", "", "", "", ""], ["Down", "ZSWIM1", "17", "hsa-mir-196b-5p", "", "", "", ""], ["Down", "MICALL1", "17", "hsa-mir-650", "", "", "", ""], ["Down", "DENND3", "17", "hsa-mir-450b-5p", "", "", "", ""], ["Down", "WWP2", "17", "hsa-mir-1202", "", "", "", ""], ["Down", "LRRC20", "16", "hsa-let-7 g-5p", "", "", "", ""], ["Down", "TEP1", "16", "hsa-mir-1281", "", "", "", ""], ["Down", "TNFAIP2", "16", "hsa-mir-522-5p", "", "", "", ""], ["Down", "HIVEP3", "16", "hsa-mir-29b-3p", "", "", "", ""], ["Down", "DAP", "16", "hsa-mir-339-5p", "", "", "", ""], ["Down", "HSH2D", "16", "hsa-mir-449a", "", "", "", ""], ["Down", "CDIP1", "16", "hsa-let-7i-5p", "", "", "", ""], ["Down", "MAPK13", "16", "hsa-mir-520 h", "", "", "", ""], ["Down", "KCTD21", "15", "hsa-mir-1910–5p", "", "", "", ""], ["Down", "NAGK", "15", "hsa-mir-92a-1-5p", "", "", "", ""], ["Down", "DTX4", "15", "hsa-mir-561-5p", "", "", "", ""], ["Down", "GAB2", "15", "hsa-mir-378 g", "", "", "", ""], ["Down", "ABCG1", "15", "hsa-mir-588", "", "", "", ""], ["Down", "CCNJL", "15", "hsa-let-7a-5p", "", "", "", ""], ["Down", "DYSF", "15", "hsa-mir-520c-3p", "", "", "", ""], ["Down", "RTN1", "15", "hsa-mir-9-5p", "", "", "", ""], ["Down", "RELL1", "15", "hsa-mir-320b", "", "", "", ""], ["Down", "ARHGAP30", "15", "hsa-mir-30e-5p", "", "", "", ""], ["Down", "SETDB1", "14", "hsa-mir-3928-3p", "", "", "", ""], ["Down", "BSCL2", "14", "hsa-mir-106a-5p", "", "", "", ""], ["Down", "EPS15L1", "14", "hsa-mir-4448", "", "", "", ""], ["Down", "MAST3", "14", "hsa-mir-518a-3p", "", "", "", ""], ["Down", "APOL1", "14", "hsa-mir-133a-3p", "", "", "", ""], ["Down", "FHOD1", "14", "hsa-mir-199a-5p", "", "", "", ""], ["Down", "VARS2", "14", "hsa-mir-1260a", "", "", "", ""], ["Down", "SLC9A8", "14", "hsa-mir-1468-5p", "", "", "", ""], ["Down", "SKIV2L", "14", "hsa-mir-939-5p", "", "", "", ""], ["Down", "C17orf49", "13", "hsa-mir-4804-5p", "", "", "", ""], ["Down", "INPP5B", "13", "hsa-mir-301a-5p", "", "", "", ""], ["Down", "CLN3", "13", "hsa-mir-29b-2-5p", "", "", "", ""], ["Down", "TPCN2", "13", "hsa-mir-532-3p", "", "", "", ""], ["Down", "NDRG2", "13", "hsa-mir-2355-5p", "", "", "", ""], ["Down", "IL17RA", "13", "hsa-mir-769-3p", "", "", "", ""], ["Down", "ABTB2", "13", "hsa-mir-3685", "", "", "", ""], ["Down", "TMEM63B", "13", "hsa-mir-2110", "", "", "", ""], ["Down", "ARHGAP31", "13", "hsa-mir-5690", "", "", "", ""], ["Down", "STK10", "13", "hsa-mir-138-5p", "", "", "", ""], ["Down", "RNF31", "13", "hsa-mir-103a-2-5p", "", "", "", ""], ["Down", "GTPBP1", "13", "hsa-mir-548an", "", "", "", ""], ["Down", "SLC15A3", "13", "hsa-mir-373-3p", "", "", "", ""], ["Down", "VDR", "13", "hsa-mir-449c-5p", "", "", "", ""], ["Down", "DAAM2", "13", "hsa-mir-940", "", "", "", ""], ["Down", "FIZ1", "12", "hsa-mir-5100", "", "", "", ""], ["Down", "TMEM106A", "12", "hsa-mir-933", "", "", "", ""], ["Down", "POMZP3", "12", "hsa-mir-203a-3p", "", "", "", ""], ["Down", "CADM4", "12", "hsa-mir-4726-3p", "", "", "", ""], ["Down", "TRAPPC9", "12", "hsa-mir-330-3p", "", "", "", ""], ["Down", "ZNF530", "12", "hsa-mir-181b-5p", "", "", "", ""], ["Down", "RAB36", "11", "hsa-mir-374a-5p", "", "", "", ""], ["Down", "LGALS9", "11", "hsa-mir-133a-3p", "", "", "", ""], ["Down", "PI4K2A", "11", "hsa-mir-346", "", "", "", ""], ["Down", "ST6GALNAC2", "11", "hsa-mir-212-3p", "", "", "", ""], ["Down", "AOC2", "11", "hsa-mir-3199", "", "", "", ""], ["Down", "ARSG", "11", "hsa-mir-183-5p", "", "", "", ""], ["Down", "SLC27A3", "11", "hsa-mir-503-5p", "", "", "", ""], ["Down", "C7orf26", "11", "hsa-mir-320e", "", "", "", ""], ["Down", "SLC16A5", "11", "hsa-mir-885-5p", "", "", "", ""], ["Down", "RNF135", "11", "hsa-mir-217", "", "", "", ""], ["Down", "TMEM229B", "11", "hsa-mir-2467-5p", "", "", "", ""], ["Down", "XKR8", "10", "hsa-mir-125a-5p", "", "", "", ""], ["Down", "CRISPLD2", "10", "hsa-mir-365b-5p", "", "", "", ""], ["Down", "ARHGEF5", "10", "hsa-mir-302d-3p", "", "", "", ""], ["Down", "PRSS21", "10", "hsa-let-7d-5p", "", "", "", ""], ["Down", "JAK3", "10", "hsa-mir-221-3p", "", "", "", ""], ["Down", "MARK4", "10", "hsa-mir-2277-3p", "", "", "", ""], ["Down", "PRR16", "10", "hsa-let-7b-5p", "", "", "", ""], ["Down", "ZNF70", "10", "hsa-mir-589-3p", "", "", "", ""], ["Down", "TTLL3", "10", "hsa-mir-1179", "", "", "", ""], ["Down", "ZBTB3", "9", "hsa-mir-29c-3p", "", "", "", ""], ["Down", "EHBP1L1", "9", "hsa-mir-548a-3p", "", "", "", ""], ["Down", "ZBTB22", "9", "hsa-mir-642a-5p", "", "", "", ""], ["Down", "CHKB", "9", "hsa-mir-1229-3p", "", "", "", ""], ["Down", "STK36", "9", "hsa-mir-5581-3p", "", "", "", ""], ["Down", "ABTB1", "9", "hsa-mir-21-3p", "", "", "", ""], ["Down", "PTPN18", "9", "hsa-mir-647", "", "", "", ""], ["Down", "ARAP3", "9", "hsa-mir-616-5p", "", "", "", ""], ["Down", "PPCDC", "9", "hsa-mir-500a-5p", "", "", "", ""], ["Down", "PIK3R5", "9", "hsa-mir-3064-5p", "", "", "", ""], ["Down", "ZNF417", "9", "hsa-mir-1271-5p", "", "", "", ""], ["Down", "SLC16A13", "9", "hsa-mir-873-3p", "", "", "", ""], ["Down", "TOP3A", "9", "hsa-mir-181a-2-3p", "", "", "", ""], ["Down", "CSNK2B", "9", "hsa-mir-3619-5p", "", "", "", ""], ["Down", "INPP5D", "8", "hsa-mir-589-3p", "", "", "", ""], ["Down", "THBS3", "8", "hsa-mir-933", "", "", "", ""], ["Down", "ZNF784", "8", "hsa-mir-432-3p", "", "", "", ""], ["Down", "SYK", "8", "hsa-mir-3158-3p", "", "", "", ""], ["Down", "TRIM62", "8", "hsa-mir-522-5p", "", "", "", ""], ["Down", "CLPB", "8", "hsa-mir-1180-3p", "", "", "", ""], ["Down", "TMEM63C", "8", "hsa-mir-4999-5p", "", "", "", ""], ["Down", "SEMA4A", "8", "hsa-mir-628-5p", "", "", "", ""], ["Down", "GPSM3", "8", "hsa-mir-664b-5p", "", "", "", ""], ["Down", "ALKBH6", "8", "hsa-mir-766-3p", "", "", "", ""], ["Down", "SPN", "7", "hsa-let-7e-5p", "", "", "", ""], ["Down", "CSF1R", "7", "hsa-mir-3065-3p", "", "", "", ""], ["Down", "NICN1", "7", "hsa-mir-24-3p", "", "", "", ""], ["Down", "SLC6A16", "7", "hsa-mir-4254", "", "", "", ""], ["Down", "C2CD2L", "7", "hsa-mir-125a-5p", "", "", "", ""], ["Down", "EPOR", "7", "hsa-mir-3611", "", "", "", ""], ["Down", "CIITA", "7", "hsa-mir-142-3p", "", "", "", ""], ["Down", "DGKG", "7", "hsa-mir-574-5p", "", "", "", ""], ["Down", "PAPLN", "7", "hsa-mir-133a-3p", "", "", "", ""], ["Down", "KCNIP2", "7", "hsa-mir-548e-3p", "", "", "", ""], ["Down", "DPEP3", "7", "hsa-mir-30a-5p", "", "", "", ""], ["Down", "CCDC17", "7", "hsa-mir-1908-5p", "", "", "", ""], ["Down", "TTC4", "7", "hsa-mir-23b-3p", "", "", "", ""], ["Down", "ADAP2", "6", "hsa-mir-26b-5p", "", "", "", ""], ["Down", "RPGRIP1", "6", "hsa-mir-374a-5p", "", "", "", ""], ["Down", "DGAT2", "6", "hsa-mir-218-5p", "", "", "", ""], ["Down", "ASPRV1", "6", "hsa-mir-520c-3p", "", "", "", ""], ["Down", "FLT3", "6", "hsa-mir-212-3p", "", "", "", ""], ["Down", "SHISA4", "6", "hsa-mir-22-5p", "", "", "", ""], ["Down", "RAB37", "6", "hsa-mir-214-3p", "", "", "", ""], ["Down", "CAMKK1", "6", "hsa-mir-5008-5p", "", "", "", ""], ["Down", "GMIP", "6", "hsa-mir-1303", "", "", "", ""], ["Down", "REC8", "6", "hsa-mir-5680", "", "", "", ""], ["Down", "PLD2", "6", "hsa-mir-200b-3p", "", "", "", ""], ["Down", "GALNS", "6", "hsa-mir-874-3p", "", "", "", ""], ["Down", "CNTROB", "6", "hsa-mir-1254", "", "", "", ""], ["Down", "APOM", "6", "hsa-mir-10b-5p", "", "", "", ""], ["Down", "KCTD11", "6", "hsa-mir-140-3p", "", "", "", ""], ["Down", "ITGAX", "5", "hsa-mir-126-3p", "", "", "", ""], ["Down", "OSCAR", "5", "hsa-mir-7-5p", "", "", "", ""], ["Down", "PTAFR", "5", "hsa-mir-497-5p", "", "", "", ""], ["Down", "DAPK2", "5", "hsa-mir-520c-3p", "", "", "", ""], ["Down", "WDFY4", "5", "hsa-mir-338-3p", "", "", "", ""], ["Down", "ATG16L2", "5", "hsa-mir-362-3p", "", "", "", ""], ["Down", "C19orf54", "5", "hsa-mir-296-3p", "", "", "", ""], ["Down", "SIGLEC9", "5", "hsa-mir-147a", "", "", "", ""], ["Down", "AOC3", "5", "hsa-mir-103a-3p", "", "", "", ""], ["Down", "U2AF1L4", "5", "hsa-mir-660-5p", "", "", "", ""], ["Down", "RGL3", "5", "hsa-mir-676-3p", "", "", "", ""], ["Down", "PHF7", "4", "hsa-mir-147a", "", "", "", ""], ["Down", "WRAP53", "4", "hsa-mir-205-5p", "", "", "", ""], ["Down", "P2RX1", "4", "hsa-mir-191-5p", "", "", "", ""], ["Down", "PSPN", "4", "hsa-mir-335-5p", "", "", "", ""], ["Down", "SIGLEC5", "4", "hsa-mir-941", "", "", "", ""], ["Down", "POPDC2", "4", "hsa-mir-10b-5p", "", "", "", ""], ["Down", "SH3D21", "4", "hsa-mir-615-5p", "", "", "", ""], ["Down", "TIGD3", "4", "hsa-mir-548o-3p", "", "", "", ""], ["Down", "KIAA0556", "4", "hsa-mir-101-3p", "", "", "", ""], ["Down", "LAG3", "4", "hsa-mir-146a-5p", "", "", "", ""], ["Down", "ARHGAP9", "4", "hsa-mir-372-3p", "", "", "", ""], ["Down", "SMPD2", "4", "hsa-mir-27b-5p", "", "", "", ""], ["Down", "ZMYND15", "4", "hsa-mir-194-5p", "", "", "", ""], ["Down", "PLB1", "4", "hsa-mir-205-5p", "", "", "", ""], ["Down", "NOMO2", "4", "hsa-mir-15a-3p", "", "", "", ""], ["Down", "SULT1A2", "4", "hsa-mir-210-3p", "", "", "", ""], ["Down", "MPEG1", "4", "hsa-mir-28-5p", "", "", "", ""], ["Down", "SPIB", "4", "hsa-mir-200b-5p", "", "", "", ""], ["Down", "EIF3CL", "3", "hsa-mir-194-5p", "", "", "", ""], ["Down", "TNFSF12", "3", "hsa-mir-29c-3p", "", "", "", ""], ["Down", "GTF2IRD2", "3", "hsa-mir-522-5p", "", "", "", ""], ["Down", "OGFOD2", "3", "hsa-mir-3613-5p", "", "", "", ""], ["Down", "C16orf54", "3", "hsa-mir-27a-3p", "", "", "", ""], ["Down", "CLEC17A", "3", "hsa-mir-30c-1-3p", "", "", "", ""], ["Down", "ITGAL", "3", "hsa-mir-4651", "", "", "", ""], ["Down", "VNN3", "3", "hsa-mir-671-5p", "", "", "", ""], ["Down", "TREML2", "3", "hsa-mir-214-3p", "", "", "", ""], ["Down", "RIPK3", "3", "hsa-mir-212-3p", "", "", "", ""], ["Down", "ADCY4", "3", "hsa-mir-1290", "", "", "", ""], ["Down", "CPNE9", "3", "hsa-mir-301a-5p", "", "", "", ""], ["Down", "KRTCAP2", "3", "hsa-mir-603", "", "", "", ""], ["Down", "BEST1", "3", "hsa-mir-144-3p", "", "", "", ""], ["Down", "ITGAM", "3", "hsa-mir-372-3p", "", "", "", ""], ["Down", "RASGRP4", "3", "hsa-mir-34c-5p", "", "", "", ""], ["Down", "HCG27", "3", "hsa-mir-941", "", "", "", ""], ["Down", "APOBEC3D", "3", "hsa-mir-449b-5p", "", "", "", ""], ["Down", "RABL2A", "2", "hsa-mir-1-3p", "", "", "", ""], ["Down", "ITIH4", "2", "hsa-mir-101-3p", "", "", "", ""], ["Down", "MMP25", "2", "hsa-mir-212-3p", "", "", "", ""], ["Down", "PILRA", "2", "hsa-mir-16-5p", "", "", "", ""], ["Down", "CSF3R", "2", "hsa-mir-941", "", "", "", ""], ["Down", "SLC25A35", "2", "hsa-mir-1343-3p", "", "", "", ""], ["Down", "C5AR2", "2", "hsa-mir-34a-5p", "", "", "", ""], ["Down", "KCNMB1", "2", "hsa-mir-195-5p", "", "", "", ""], ["Down", "NOXRED1", "2", "hsa-mir-520f-3p", "", "", "", ""], ["Down", "NPIPB3", "2", "hsa-mir-154-5p", "", "", "", ""], ["Down", "PDZD3", "2", "hsa-mir-210-3p", "", "", "", ""], ["Down", "UBA7", "2", "hsa-mir-130a-3p", "", "", "", ""], ["Down", "BLOC1S3", "2", "hsa-mir-34c-5p", "", "", "", ""], ["Down", "NFAM1", "2", "hsa-mir-1293", "", "", "", ""], ["Down", "C19orf84", "2", "hsa-mir-182-5p", "", "", "", ""], ["Down", "AMY1B", "1", "hsa-mir-335-5p", "", "", "", ""], ["Down", "PADI4", "1", "hsa-mir-335-5p", "", "", "", ""], ["Down", "DRICH1", "1", "hsa-mir-335-5p", "", "", "", ""], ["Down", "LCNL1", "1", "hsa-mir-335-5p", "", "", "", ""], ["Down", "CEACAM4", "1", "hsa-mir-31-5p", "", "", "", ""], ["Down", "GBGT1", "1", "hsa-mir-429", "", "", "", ""], ["Down", "GHRL", "1", "hsa-mir-941", "", "", "", ""], ["Down", "TMEM234", "1", "hsa-mir-1-3p", "", "", "", ""], ["Down", "DPEP2", "1", "hsa-mir-129-2-3p", "", "", "", ""], ["Down", "SIRPB2", "1", "hsa-mir-302a-3p", "", "", "", ""], ["Down", "CLEC4C", "1", "hsa-mir-27a-3p", "", "", "", ""], ["Down", "AGER", "1", "hsa-mir-191-5p", "", "", "", ""], ["Down", "TIFAB", "1", "hsa-mir-146a-5p", "", "", "", ""]], "row_count": 869, "column_count": 8, "numeric_cells": 2437, "header_rows": 1, "locator": "section[15]/table-wrap[1]#Tab6"}}, {"id": "asset:table:pmid:33827531:11", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c9295058ff9955a5449c21ae6063c01dfcb3a804f400f578fa7adbc77b7ce028", "bytes": 919, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#Tab1", "version": null, "note": "The sequences of primers for quantitative RT-PCR", "structure": {"pmcid": "PMC8028841", "section_index": 17, "section_title": "Validation of hub genes", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of primers for quantitative RT-PCR", "rows": [["Genes", "Primers", "Length of target fragment, bp"], ["EGFR", "F: AGGCACGAGTAACAAGCTCACR: ATGAGGACATAACCAGCCACC", "2121"], ["GRIN2B", "F: TCTGACCGGAAGATCCAGGGR: TCCATGATGTTGAGCATTACGG", "2022"], ["GJA1", "F: GGTGACTGGAGCGCCTTAGR: GCGCACATGAGAGATTGGGA", "1920"], ["CAP2", "F: CCCTGCCCTTGGATGGATAGR: ACGCTGATACTGTGGATGCTA", "2021"], ["MIF", "F: CTCTCCGAGCTCACCCAGCAGR: CGCGTTCATGTCGTAATAGTT", "2121"], ["POLR2A", "F: GGGTGGCATCAAATACCCAGAR: AGACACAGCGCAAAACTTTCA", "2121"], ["PRKACA", "F: AGCCCACTTGGATCAGTTTGAR: GTTCCCGGTCTCCTTGTGT", "2119"], ["GABARAP", "F: AGAAGAGCATCCGTTCGAGAAR: CCAGGTCTCCTATCCGAGCTT", "2121"], ["TLN1", "F: GACGATGCAGTTTGAGCCGR: GGTCATCATCTGACAGAAAGAG", "1923"], ["PXN", "F: CTGCTGGAACTGAACGCTGTAR: GGGGCTGTTAGTCTCTGGGA", "2120"]], "row_count": 11, "column_count": 3, "numeric_cells": 10, "header_rows": 1, "locator": "section[9]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:33827531:12", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b05ae7ec2f01fa671cad7ed178ce30f108d6e984653281be82421597e246660c", "bytes": 8615, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#Tab7", "version": null, "note": "Docking results of Designed Molecules on Over Expressed Proteins", "structure": {"pmcid": "PMC8028841", "section_index": 19, "section_title": "Discussion", "row_count": 58, "column_count": 16}, "table": {"label": "Table 7", "caption": "Docking results of Designed Molecules on Over Expressed Proteins", "rows": [["Sl. No/Code", "Over expressed gene: EGFR", "Over expressed gene: CAP2", "Over expressed gene: GRIN2B", "Over expressed gene: GJA1", "Over expressed gene: MIF"], ["PDB: 2XYJ", "PDB:4 K41", "PDB:5EWL", "PDB: 2ZW3", "PDB: 4WR8"], ["Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar"], ["TSIO1", "5.708", "−1.859", "2.223", "9.497", "−0.989", "5.432", "5.265", "−1.280", "4.250", "5.286", "−1.003", "0.800", "4.725", "−1.368", "1.708"], ["TSIO2", "5.105", "−1.784", "2.893", "9.728", "−1.388", "5.353", "5.521", "−1.228", "3.688", "4.881", "−0.951", "2.131", "5.419", "−2.125", "0.841"], ["TSIO3", "5.729", "−1.113", "1.112", "9.456", "−2.449", "4.970", "5.195", "−2.525", "3.514", "4.584", "−1.042", "0.965", "5.331", "−4.193", "3.443"], ["TSIO4", "5.842", "−0.864", "0.598", "10.152", "−1.938", "6.319", "4.315", "−1.041", "3.793", "5.266", "−2.776", "1.233", "5.417", "−1.767", "1.069"], ["TSIO5", "5.500", "−1.562", "1.525", "9.432", "−1.132", "5.363", "5.577", "−1.238", "3.432", "4.921", "−0.988", "2.079", "5.590", "−1.579", "3.093"], ["TSIO6", "7.204", "−1.628", "3.166", "10.018", "−0.815", "5.325", "6.381", "−2.325", "2.695", "7.272", "−1.458", "0", "5.970", "−1.865", "1.184"], ["TSIO7", "5.602", "−2.721", "1.729", "9.631", "−1.052", "5.231", "5.244", "−2.231", "2.943", "5.489", "−1.284", "1.538", "5.760", "−3.956", "3.505"], ["TSIO8", "6.934", "−1.501", "2.102", "11.084", "−2.034", "7.653", "5.869", "−1.008", "3.605", "5.258", "−3.205", "1.973", "5.406", "−2.204", "0.608"], ["TSIO9", "6.729", "−0.869", "1.107", "9.449", "−1.024", "5.437", "6.182", "−1.013", "3.745", "6.191", "−2.129", "1.364", "4.990", "−1.732", "1.135"], ["TSPZ10", "5.806", "−1.608", "2.698", "9.531", "−1.000", "5.404", "5.049", "−1.424", "4.118", "5.824", "−0.884", "2.163", "5.158", "−0.943", "1.423"], ["TSPZ11", "5.062", "−1.899", "1.706", "9.691", "−1.139", "6.313", "5.810", "−1.269", "4.181", "6.165", "−1.190", "0.465", "4.706", "−1.751", "1.18"], ["TSPZ12", "6.254", "−1.409", "2.367", "9.527", "−2.615", "5.096", "4.213", "−1.174", "3.821", "5.348", "−1.272", "2.181", "4.378", "−2.139", "0.396"], ["TSPZ13", "6.562", "−1.307", "5.202", "9.499", "−1.016", "5.274", "5.150", "−0.841", "3.722", "5.735", "−0.931", "2.155", "4.606", "−2.490", "1.565"], ["TSPZ14", "5.129", "−1.943", "1.634", "9.654", "−0.964", "5.326", "5.671", "−1.154", "4.189", "5.812", "−1.097", "0.269", "4.928", "−2.712", "1.038"], ["TSPZ15", "7.059", "−2.752", "2.284", "10.263", "−1.023", "5.207", "5.431", "−1.739", "2.642", "6.811", "−1.633", "1.323", "6.368", "−2.305", "0.113"], ["TSPZ16", "6.160", "−2.286", "0.006", "8.689", "−2.540", "4.568", "5.913", "−0.710", "3.105", "6.013", "−1.135", "2.082", "6.021", "−2.462", "0.222"], ["TSPZ17", "6.407", "−1.750", "0.937", "9.812", "−2.408", "5.061", "5.800", "−1.002", "3.600", "6.514", "−1.207", "0.506", "5.130", "−2.065", "0.440"], ["TSPZ18", "6.568", "−1.612", "1.112", "8.767", "−2.126", "5.501", "5.188", "−1.351", "4.072", "5.871", "−1.577", "2.158", "4.798", "−1.301", "1.228"], ["TSPZP19", "4.784", "−2.116", "0.003", "8.602", "−1.654", "6.396", "5.398", "−1.745", "3.543", "5.147", "−1.504", "1.124", "4.275", "−2.790", "0"], ["TSPZP20", "5.781", "−2.549", "1.063", "8.219", "−3.381", "3.885", "5.780", "−1.815", "3.600", "4.684", "−1.714", "2.044", "4.805", "−1.447", "0.001"], ["TSPZP21", "5.031", "−5.142", "1.128", "9.111", "−3.271", "5.677", "5.659", "−1.312", "2.571", "5.204", "−1.613", "0.919", "5.660", "−1.490", "0.020"], ["TSPZP22", "7.624", "−1.675", "1.109", "8.814", "−2.974", "4.716", "5.367", "−1.149", "3.704", "5.641", "−0.878", "1.196", "5.631", "−1.579", "1.198"], ["TSPZP23", "7.198", "−1.682", "0.115", "8.854", "−1.658", "6.596", "5.582", "−1.513", "2.814", "4.523", "−0.907", "0.033", "4.134", "−3.073", "1.121"], ["TSPZP24", "6.026", "−2.349", "0.116", "10.430", "10.430", "4.262", "6.320", "−1.665", "2.335", "5.267", "−1.261", "1.159", "7.992", "−1.273", "1.256"], ["TSPZP25", "5.006", "−5.129", "1.127", "8.972", "−3.033", "3.770", "5.772", "−1.268", "3.687", "5.658", "−1.419", "1.289", "5.515", "−1.345", "0"], ["TSPZP26", "5.267", "−5.637", "0.954", "8.539", "−1.481", "6.14", "6.208", "−1.424", "2.718", "5.394", "−2.135", "0.914", "4.436", "−1.363", "0"], ["TSPZP27", "7.221", "−2.321", "0.498", "8.648", "−1.512", "6.329", "5.863", "−1.335", "2.652", "5.038", "−1.501", "0.936", "4.689", "−3.173", "1.167"], ["TBIO28", "5.387", "−2.438", "2.608", "8.796", "−1.210", "4.261", "5.251", "−0.834", "1.829", "5.187", "−0.854", "0.744", "4.877", "−1.324", "2.044"], ["TBIO29", "5.132", "−1.505", "1.865", "9.195", "−1.258", "4.255", "5.170", "−0.793", "1.803", "5.125", "−1.417", "1.155", "5.035", "−1.222", "1.403"], ["TBIO30", "7.079", "−1.923", "0.858", "10.531", "−1.372", "4.924", "5.586", "−1.159", "3.148", "5.276", "−1.395", "0.930", "4.453", "−0.929", "0"], ["TBIO31", "6.090", "−1.967", "1.929", "8.801", "−0.773", "4.174", "5.224", "−0.770", "1.840", "5.232", "−1.215", "1.152", "4.573", "−1.631", "1.900"], ["TBIO32", "5.157", "−2.015", "0.004", "8.867", "−0.924", "4.276", "4.924", "−1.049", "2.634", "4.916", "−1.432", "1.125", "4.759", "−1.525", "1.991"], ["TBIO33", "5.796", "−2.689", "0.709", "9.892", "−0.980", "4.358", "5.024", "−1.110", "1.764", "7.055", "−2.062", "0.020", "5.620", "−1.766", "1.242"], ["TBIO34", "7.079", "−1.923", "0.858", "9.161", "−0.875", "4.317", "5.143", "−0.657", "2.822", "5.051", "−0.845", "2.321", "5.584", "−1.952", "1.290"], ["TBIO35", "6.542", "−2.270", "1.959", "10.372", "−1.124", "5.275", "5.860", "−1.513", "2.938", "5.191", "−1.312", "0.875", "4.650", "−0.957", "0"], ["TBIO36", "6.164", "−1.506", "0.996", "8.912", "−1.847", "4.162", "5.036", "−0.853", "1.831", "5.431", "−1.234", "0.002", "4.195", "−1.850", "1.971"], ["TBPZ37", "7.202", "−1.109", "0.108", "9.602", "−3.041", "5.880", "5.126", "−0.951", "1.779", "5.859", "−1.115", "0.010", "4.667", "−1.195", "2.460"], ["TBPZ38", "4.596", "−1.574", "1.121", "8.762", "−0.815", "4.21", "5.222", "−0.698", "1.828", "5.400", "−0.971", "0.001", "5.375", "−2.176", "1.014"], ["TBPZ39", "6.070", "−1.439", "2.219", "9.392", "−2.213", "5.155", "5.769", "−0.800", "3.918", "5.772", "−0.874", "0", "4.639", "−1.87", "1.522"], ["TBPZ40", "6.090", "−1.967", "1.929", "8.590", "−2.055", "4.1", "5.214", "−0.842", "1.778", "5.514", "−2.298", "1.184", "4.822", "−1.851", "1.535"], ["TBPZ41", "4.679", "−1.469", "0.004", "8.557", "−1.073", "4.238", "4.997", "−0.743", "1.812", "5.448", "−1.147", "0.006", "4.676", "−1.163", "1.122"], ["TBPZ42", "6.848", "−1.124", "2.084", "9.516", "−1.040", "4.385", "5.476", "−1.344", "2.358", "6.764", "1.783", "1.317", "6.946", "−1.384", "1.490"], ["TBPZ43", "5.582", "−2.315", "1.677", "8.831", "−0.898", "4.325", "5.462", "−1.872", "3.436", "5.171", "−0.661", "3.177", "5.013", "−2.468", "1.121"], ["TBPZ44", "6.645", "−2.275", "1.936", "9.094", "−1.764", "3.939", "5.892", "−1.063", "2.964", "5.503", "−1.122", "0.004", "4.693", "−1.324", "0"], ["TBPZ45", "6.378", "−1.607", "1.110", "8.557", "−0.955", "4.336", "5.230", "−0.769", "1.783", "6.371", "−1.899", "1.195", "4.903", "−1.763", "1.523"], ["TBPZP46", "7.202", "−1.109", "0.108", "6.165", "−1.473", "1.634", "5.585", "−0.786", "3.893", "6.324", "−1.314", "3.361", "5.355", "−2.860", "2.421"], ["TBPZP47", "5.315", "−2.731", "0.963", "8.903", "−1.907", "5.544", "5.410", "−0.992", "1.830", "5.449", "−0.886", "1.176", "3.173", "−0.976", "0"], ["TBPZP48", "5.006", "−5.129", "1.127", "9.231", "−3.021", "5.149", "4.034", "−1.612", "3.442", "4.721", "−1.372", "0.002", "6.037", "−1.283", "0.845"], ["TBPZP49", "6.876", "−3.317", "0.951", "8.730", "−2.958", "4.111", "5.451", "−1.136", "1.818", "5.708", "−1.038", "0.021", "4.074", "−3.978", "0.251"], ["TBPZP50", "6.309", "−2.914", "0.007", "8.787", "−2.397", "3.629", "5.312", "−0.998", "1.802", "5.374", "−1.282", "0.002", "4.069", "−2.916", "0"], ["TBPZP51", "7.331", "−1.709", "1.128", "9.755", "−2.543", "3.496", "5.324", "−1.063", "1.831", "7.841", "−1.751", "1.304", "8.13", "−1.286", "1.322"], ["TBPZP52", "5.470", "−3.384", "0.063", "8.598", "−3.204", "3.198", "5.494", "−1.324", "3.039", "5.632", "−1.046", "4.503", "5.727", "−1.639", "0.743"], ["TBPZP53", "6.402", "−4.890", "1.693", "8.645", "−1.982", "4.767", "5.373", "−0.959", "1.826", "4.790", "−2.041", "1.079", "5.994", "−1.661", "1.073"], ["TBPZP54", "6.925", "−2.649", "6.032", "5.452", "−2.612", "3.535", "4.521", "−1.365", "3.442", "5.732", "−1.353", "1.328", "5.325", "−1.551", "0.113"], ["PIO (STD)", "8.396", "−0.983", "1.023", "6.683", "−1.814", "2.537", "6.261", "−0.828", "2.212", "6.232", "−2.171", "0", "7.648", "−1.772", "0.325"]], "row_count": 58, "column_count": 16, "numeric_cells": 875, "header_rows": 3, "locator": "section[19]/table-wrap[1]#Tab7"}}], "gaps": ["asset:data:geo:GSE123658 not downloaded", "asset:data:geo:GSE123658 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The identification of DEGs between 39 T1D patients’ samples and 43 healthy donors’ samples was performed using Limma package in R bioconductor."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-4", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.7, "band": "medium", "quote": "ROC curve"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE123658"], "resolved_accessions": ["GSE123658"], "statements": ["The datasets supporting the conclusions of this article are available in the GEO (Gene Expression Omnibus) (https://www.ncbi.nlm.nih.gov/geo/) repository. [(GSE123658) (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE123658)]"], "basis": "The paper names GSE123658 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33827531", "data:geo:GSE123658", "asset:table:pmid:33827531:1", "asset:table:pmid:33827531:2", "asset:table:pmid:33827531:3", "asset:table:pmid:33827531:4", "asset:table:pmid:33827531:5", "asset:table:pmid:33827531:6", "asset:table:pmid:33827531:7", "asset:table:pmid:33827531:8", "asset:table:pmid:33827531:9", "asset:table:pmid:33827531:10", "asset:table:pmid:33827531:11", "asset:table:pmid:33827531:12"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE123658"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:28:47Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 49740, "completion_tokens": 940, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33827531", "type": "paper", "label": "pmid:33827531"}, {"id": "source:pmid:33827531", "type": "manuscript", "label": "PMID 33827531 full text"}, {"id": "data:geo:GSE123658", "type": "dataset", "label": "GEO GSE123658"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33827531", "type": "paper", "label": "pmid:33827531"}, {"id": "source:pmid:33827531", "type": "manuscript", "label": "PMID 33827531 full text"}, {"id": "data:geo:GSE123658", "type": "dataset", "label": "GEO GSE123658"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33827531", "type": "extraction", "used": ["source:pmid:33827531"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE123658", "type": "accession_resolution", "used": ["data:geo:GSE123658"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33827531", "parent_hash": "sha256:d8d3592123f4dd22d92d019b2eeddd33f05f4011c687460f8574616846a082c7", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE123658 licence not read", "asset:data:geo:GSE123658 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The identification of DEGs between 39 T1D patients’ samples and 43 healthy donors’ samples was performed using Limma package in R bioconductor."], "order_basis": "analysis_only", "id": "assay:1"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-04T14:24:55+00:00","generated_at":"2026-11-05T05:10:16+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}