{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33916015", "kind": "science-record", "revision": 8, "content_hash": "sha256:0cc8e80f10fc2e5782c5db948c667bcb007d76dd2c7af388ebca0e1337b798d7", "created_at": "2026-11-01T15:41:33Z", "updated_at": "2026-11-01T22:46:36Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Death Receptor 5 (TNFRSF10B) Is Upregulated and TRAIL Resistance Is Reversed in Hypoxia and Normoxia in Colorectal Cancer Cell Lines after Treatment with Skyrin, the Active Metabolite of Hypericum spp.", "doi": "10.3390/cancers13071646", "pmid": "33916015", "authors": ["Marián Babinčák", "Rastislav Jendželovský", "Ján Košuth", "Martin Majerník", "Jana Vargová", "Kamil Mikulášek", "Zbyněk Zdráhal", "Peter Fedoročko"], "journal": "Cancers", "year": 2021, "abstract": "Skyrin (SKR) is a plant bisanthraquinone secondary metabolite from the Hypericum genus with potential use in anticancer therapy. However, its effect and mechanism of action are still unknown. The negative effect of SKR on HCT 116 and HT-29 cancer cell lines in hypoxic and normoxic conditions was observed. HCT 116 cells were more responsive to SKR treatment as demonstrated by decreased metabolic activity, cellularity and accumulation of cells in the G1 phase. Moreover, an increasing number of apoptotic cells was observed after treatment with SKR. Based on the LC-MS comparative proteomic data from hypoxia and normoxia (data are available via ProteomeXchange with the identifier PXD019995), SKR significantly upregulated Death receptor 5 (DR5), which was confirmed by real-time qualitative PCR (RT-qPCR). Furthermore, multiple changes in the Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-activated cascade were observed. Moreover, the reversion of TRAIL resistance was observed in HCT 116, HT-29 and SW620 cell lines, even in hypoxia, which was linked to the upregulation of DR5. In conclusion, our results propose the use of SKR as a prospective anticancer drug, particularly as an adjuvant to TRAIL-targeting treatment to reverse TRAIL resistance in hypoxia.", "claims": [{"id": "claim-method", "statement": "Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33916015", "locator": "sections[22] \"4.11. Statistical Analysis\" paragraph 2", "quote": "Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33916015", "locator": "sections[31] \"Data Availability Statement\" paragraph 2", "quote": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33916015"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD019995"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD019995"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33916015", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3390/cancers13071646", "sha256": "sha256:16e1c096fc5de9895c9c65963c534c9107ecae88ea5a7cc094a4901d4fb80a07", "bytes": 94078, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3390/cancers13071646", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8036732", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:PXD019995", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PXD019995", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PXD019995", "version": null, "note": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Mass spectrometry data are available via ProteomeXchange with identifier PXD019995.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": "The effect of skyrin in normoxia and hypoxia on HCT 116 cell line", "resolution_checked_at": "2026-10-31T18:35:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33916015:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ce8fc9e53d0d902f69d8b6b71a7151b7f1d857e7e65a3c034bf47158ff7456a5", "bytes": 607, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#cancers-13-01646-t001", "version": null, "note": "SKR concentration resulting in a 25% decrease of metabolic activity based on MTT assay for cancer cell lines. Values are presented as concentrations in μM with standard deviation (SD) values for all used times and conditions.", "structure": {"pmcid": "PMC8036732", "section_index": 3, "section_title": "2.1. SKR Selectively Decreases the Metabolic Activity of Cancer Cells and Their Clonogenic Ability in Hypoxia", "row_count": 3, "column_count": 5}, "table": {"label": "Table 1", "caption": "SKR concentration resulting in a 25% decrease of metabolic activity based on MTT assay for cancer cell lines. Values are presented as concentrations in μM with standard deviation (SD) values for all used times and conditions.", "rows": [["", "24 h Normoxia", "24 h Hypoxia", "48 h Normoxia", "48 h Hypoxia"], ["HCT 116", "17.88 ± 1.56", "21.96 ± 2.19", "9.50 ± 0.80", "6.70 ± 0.34"], ["HT-29", "25.67 ± 2.80", "16.45 ± 1.17", "15.83 ± 1.15", "11.36 ± 0.65"]], "row_count": 3, "column_count": 5, "numeric_cells": 14, "header_rows": 1, "locator": "section[3]/table-wrap[1]#cancers-13-01646-t001"}}, {"id": "asset:table:pmid:33916015:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ac261e50928ebaece6b2530a3d2a3dafa019eff7e2e6db45cb858c04e7baf034", "bytes": 6002, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#cancers-13-01646-t002", "version": null, "note": "List of significantly changed protein groups after SKR treatment in hypoxia (H) and normoxia (N). Log2FC is calculated between SKR-treated samples and control. Upregulation and downregulation labels: ↑ Log2FC ≥ +1.5 (upregulated); ↓ Log2FC ≤−1.5 (downregulated).", "structure": {"pmcid": "PMC8036732", "section_index": 5, "section_title": "2.3. SKR Upregulates Pathways Associated with Mitophagy and TRAIL Signalization", "row_count": 57, "column_count": 8}, "table": {"label": "Table 2", "caption": "List of significantly changed protein groups after SKR treatment in hypoxia (H) and normoxia (N). Log2FC is calculated between SKR-treated samples and control. Upregulation and downregulation labels: ↑ Log2FC ≥ +1.5 (upregulated); ↓ Log2FC ≤−1.5 (downregulated).", "rows": [["Accession", "Description of Protein Group (Gene Name)", "Log2FC (H)", "adj.p Value (H)", "Log2FC (N)", "adj.p Value (N)", "Hypoxia", "Normoxia"], ["O14763", "Tumor necrosis factor receptor superfamily member 10B (GN = TNFRSF10B)", "3.66", "0", "2.48", "0.01", "↑", "↑"], ["Q6IQ22", "Ras-related protein Rab-12 (GN = RAB12)", "2.39", "0.05", "2.33", "0.01", "↑", "↑"], ["Q9Y2H2", "Phosphatidylinositide phosphatase SAC2 (GN = INPP5F)", "3.65", "0.01", "1.05", "0.03", "↑", ""], ["P15407", "Fos-related antigen 1 (GN = FOSL1)", "1.52", "0", "2.91", "0", "↑", "↑"], ["Q9GZQ8", "Microtubule-associated proteins 1A/1B light chain 3B (GN = MAP1LC3B)", "2.54", "0", "1.78", "0", "↑", "↑"], ["Q9HBI6", "Phylloquinone omega-hydroxylase CYP4F11 (GN = CYP4F11)", "1.36", "0.04", "2.89", "0.01", "", "↑"], ["Q03405", "Urokinase plasminogen activator surface receptor (GN = PLAUR)", "1.95", "0", "2.22", "0", "↑", "↑"], ["Q7Z4Q2", "HEAT repeat-containing protein 3 (GN = HEATR3)", "2.09", "0", "1.82", "0", "↑", "↑"], ["Q53EU6", "Glycerol-3-phosphate acyltransferase 3 (GN = GPAT3)", "1.83", "0.05", "1.77", "0", "↑", "↑"], ["Q9BSH5", "Haloacid dehalogenase-like hydrolase domain-containing protein 3 (GN = HDHD3)", "3.01", "0.01", "0.44", "0.02", "↑", ""], ["P08243", "Asparagine synthetase [glutamine-hydrolyzing] (GN = ASNS)", "2.06", "0", "1.37", "0", "↑", ""], ["Q16850", "Lanosterol 14-alpha demethylase (GN = CYP51A1)", "1.84", "0", "1.33", "0", "↑", ""], ["Q9NUM4", "Transmembrane protein 106B (GN = TMEM106B)", "1.34", "0.01", "1.66", "0.01", "", "↑"], ["H3BU86", "STX16-NPEPL1 readthrough (NMD candidate) (GN = STX16-NPEPL1)", "1.8", "0.02", "1.18", "0.05", "↑", ""], ["Q8ND82", "Zinc finger protein 280C (GN = ZNF280C)", "1.86", "0", "1.06", "0.01", "↑", ""], ["Q9H6H4", "Receptor expression-enhancing protein 4 (GN = REEP4)", "1.84", "0.01", "0.98", "0.04", "↑", ""], ["Q6WCQ1", "Myosin phosphatase Rho-interacting protein (GN = MPRIP)", "0.92", "0.04", "1.78", "0", "", "↑"], ["O95352", "Ubiquitin-like modifier-activating enzyme ATG7 (GN = ATG7)", "1.56", "0.01", "1.11", "0.02", "↑", ""], ["Q8IVF2", "Protein AHNAK2 (GN = AHNAK2)", "1.93", "0.02", "0.7", "0.05", "↑", ""], ["O15231", "Zinc finger protein 185 (GN = ZNF185)", "1.51", "0", "1.09", "0.05", "↑", ""], ["Q9NQW6", "Anillin (GN = ANLN)", "0.52", "0.04", "1.84", "0", "", "↑"], ["Q9Y617", "Phosphoserine aminotransferase (GN = PSAT1)", "1.5", "0", "0.83", "0", "↑", ""], ["Q9NR12", "PDZ and LIM domain protein 7 (GN = PDLIM7)", "1.51", "0", "0.72", "0.01", "↑", ""], ["Q9NP97", "Dynein light chain roadblock-type 1 (GN = DYNLRB1)", "−1.22", "0.04", "2.37", "0", "", "↑"], ["Q8N5M9", "Protein jagunal homolog 1 (GN = JAGN1)", "−2.59", "0.01", "3.24", "0", "↓", "↑"], ["Q9NUQ3", "Gamma-taxilin (GN = TXLNG)", "−0.91", "0.02", "1.52", "0.01", "", "↑"], ["P15153", "Ras-related C3 botulinum toxin substrate 2 (GN = RAC2)", "1.57", "0.02", "−1.14", "0.01", "↑", ""], ["P14635", "G2/mitotic-specific cyclin-B1 (GN = CCNB1)", "1.86", "0", "−1.45", "0.04", "↑", ""], ["Q9H2C0", "Gigaxonin (GN = GAN)", "−2.48", "0.02", "2.43", "0.04", "↓", "↑"], ["Q9UL03", "Integrator complex subunit 6 (GN = INTS6)", "−1.77", "0", "1.5", "0", "↓", ""], ["Q14BN4", "Sarcolemmal membrane-associated protein (GN = SLMAP)", "4.26", "0.04", "−4.77", "0", "↑", "↓"], ["Q9HCS7", "Pre-mRNA-splicing factor SYF1 (GN = XAB2)", "−1.79", "0.02", "0.65", "0.04", "↓", ""], ["P31483", "Nucleolysin TIA-1 isoform p40 (GN = TIA1)", "0.65", "0.03", "−1.83", "0.02", "", "↓"], ["Q16555", "Dihydropyrimidinase-related protein 2 (GN = DPYSL2)", "−0.46", "0.03", "−1.53", "0", "", "↓"], ["P82664", "28S ribosomal protein S10, mitochondrial (GN = MRPS10)", "−1.65", "0", "−0.45", "0.03", "↓", ""], ["P55011", "Solute carrier family 12 member 2 (GN = SLC12A2)", "−1.72", "0.01", "−0.45", "0.04", "↓", ""], ["Q9H8V3", "Protein ECT2 (GN = ECT2)", "−1.83", "0.01", "−0.42", "0.04", "↓", ""], ["Q9P2R3", "Rabankyrin-5 (GN = ANKFY1)", "−1.67", "0.01", "−0.88", "0.01", "↓", ""], ["P00395", "Cytochrome c oxidase subunit 1 (GN = MT-CO1)", "−0.91", "0.03", "−1.66", "0", "", "↓"], ["Q92466", "DNA damage-binding protein 2 (GN = DDB2)", "−1.64", "0.04", "−1.15", "0.03", "↓", ""], ["Q9UHL4", "Dipeptidyl peptidase 2 (GN = DPP7)", "−1.68", "0.03", "−1.12", "0.03", "↓", ""], ["Q9BRK5", "45 kDa calcium-binding protein (GN = SDF4)", "−2.02", "0.01", "−0.81", "0", "↓", ""], ["Q6SPF0", "Atherin (GN = SAMD1)", "−1.49", "0.03", "−1.59", "0.01", "", "↓"], ["Q9NRX4", "14 kDa phosphohistidine phosphatase (GN = PHPT1)", "−1.76", "0", "−1.32", "0.01", "↓", ""], ["P14406", "Cytochrome c oxidase subunit 7A2, mitochondrial (GN = COX7A2)", "−2.14", "0", "−1.01", "0", "↓", ""], ["P35611", "Alpha-adducin (GN=ADD1)", "−1.61", "0.01", "−1.56", "0", "↓", "↓"], ["Q52LW3", "Rho GTPase-activating protein 29 (GN = ARHGAP29)", "−2.1", "0", "−1.09", "0", "↓", ""], ["Q6UX53", "Methyltransferase-like protein 7B (GN = METTL7B)", "−1.73", "0", "−1.69", "0", "↓", "↓"], ["P22830", "Ferrochelatase, mitochondrial (GN = FECH)", "−1.81", "0.01", "−1.91", "0.01", "↓", "↓"], ["O94832", "Unconventional myosin-Id (GN = MYO1D)", "−2.52", "0.01", "−1.23", "0.01", "↓", ""], ["P33552", "Cyclin-dependent kinases regulatory subunit 2 (GN = CKS2)", "−1.77", "0.01", "−2.01", "0", "↓", "↓"], ["Q92817", "Envoplakin (GN = EVPL)", "−2.76", "0.01", "−1.54", "0.01", "↓", "↓"], ["A6NJ78", "Probable methyltransferase-like protein 15 (GN = METTL15)", "−2.16", "0.02", "−3.27", "0", "↓", "↓"], ["P50748", "Kinetochore-associated protein 1 (GN = KNTC1)", "−3.94", "0", "−2.16", "0.02", "↓", "↓"], ["Q14517", "Protocadherin Fat 1 (GN = FAT1)", "−5.73", "0", "−0.49", "0.05", "↓", ""], ["P46934", "E3 ubiquitin-protein ligase NEDD4 (GN = NEDD4)", "−3.7", "0.01", "−3.94", "0", "↓", "↓"]], "row_count": 57, "column_count": 8, "numeric_cells": 296, "header_rows": 1, "locator": "section[5]/table-wrap[1]#cancers-13-01646-t002"}}, {"id": "asset:table:pmid:33916015:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:01561ca392d4647cacf4a3f3e39c2ef0b199edfadeea0d4f28b2b33ac8c8f64f", "bytes": 1822, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[2]#cancers-13-01646-t003", "version": null, "note": "List of pathways significantly connected to upregulated proteins. As the input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between control and sample in both conditions and upregulated (Log2FC > 1). Listed are 20 pathways with a higher p-value; each entity’s p-value and FDR was calculated by the Reactome engine.", "structure": {"pmcid": "PMC8036732", "section_index": 5, "section_title": "2.3. SKR Upregulates Pathways Associated with Mitophagy and TRAIL Signalization", "row_count": 20, "column_count": 5}, "table": {"label": "Table 3", "caption": "List of pathways significantly connected to upregulated proteins. As the input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between control and sample in both conditions and upregulated (Log2FC > 1). Listed are 20 pathways with a higher p-value; each entity’s p-value and FDR was calculated by the Reactome engine.", "rows": [["Pathway Name", "Entities Found", "Entities Total", "Entities’ p-Value", "Entities’ FDR"], ["Rab regulation of trafficking", "2", "123", "0.00236", "0.0398"], ["Attachment of GPI anchor to uPAR", "1", "7", "0.00429", "0.0398"], ["TRAIL signaling", "1", "8", "0.0049", "0.0398"], ["Regulation by c-FLIP", "1", "11", "0.00674", "0.0398"], ["Dimerization of procaspase-8", "1", "11", "0.00674", "0.0398"], ["Receptor-mediated mitophagy", "1", "11", "0.00674", "0.0398"], ["Pexophagy", "1", "11", "0.00674", "0.0398"], ["TP53 regulates transcription of death receptors and ligands", "1", "12", "0.00735", "0.0398"], ["Dissolution of Fibrin Clot", "1", "13", "0.00796", "0.0398"], ["CASP8 activity is inhibited", "1", "14", "0.00857", "0.0421"], ["Caspase activation via death receptors in the presence of ligand", "1", "19", "0.0116", "0.0421"], ["Regulation of necroptotic cell death", "1", "21", "0.0128", "0.0421"], ["Pink/Parkin mediated mitophagy", "1", "22", "0.0134", "0.0421"], ["RIPK1-mediated regulated necrosis", "1", "23", "0.014", "0.0421"], ["Regulated necrosis", "1", "23", "0.014", "0.0421"], ["Mitophagy", "1", "29", "0.0177", "0.0474"], ["Caspase activation via extrinsic apoptotic signaling pathway", "1", "29", "0.0177", "0.0474"], ["Synthesis of PA", "1", "39", "0.0237", "0.0474"], ["NGF-stimulated transcription", "1", "39", "0.0237", "0.0474"]], "row_count": 20, "column_count": 5, "numeric_cells": 78, "header_rows": 1, "locator": "section[5]/table-wrap[2]#cancers-13-01646-t003"}}, {"id": "asset:table:pmid:33916015:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:026b9ef19d7b669434abb4ec52047e1d9464206840ec2623d9898e191851adec", "bytes": 1387, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[3]#cancers-13-01646-t004", "version": null, "note": "List of pathways significantly connected to downregulated proteins. As an input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between the control and sample in both conditions and downregulated (Log2FC < −1). All pathways are listed; each entity’s p-value and FDR was calculated by the Reactome engine.", "structure": {"pmcid": "PMC8036732", "section_index": 5, "section_title": "2.3. SKR Upregulates Pathways Associated with Mitophagy and TRAIL Signalization", "row_count": 13, "column_count": 5}, "table": {"label": "Table 4", "caption": "List of pathways significantly connected to downregulated proteins. As an input for Reactome analysis, we used a list of all protein groups that were significantly changed (adj. p value < 0.05) between the control and sample in both conditions and downregulated (Log2FC < −1). All pathways are listed; each entity’s p-value and FDR was calculated by the Reactome engine.", "rows": [["Pathway Name", "Entities Found", "Entities Total", "Entities’ p-Value", "Entities’ FDR"], ["Regulation of PTEN localization", "1", "9", "0.0063", "0.126"], ["Downregulation of ERBB4 signaling", "1", "11", "0.0077", "0.126"], ["Caspase-mediated cleavage of cytoskeletal proteins", "1", "12", "0.00839", "0.126"], ["Heme biosynthesis", "1", "15", "0.0105", "0.126"], ["Miscellaneous transport and binding events", "1", "26", "0.0181", "0.126"], ["Metabolism of porphyrins", "1", "28", "0.0195", "0.126"], ["Apoptotic cleavage of cellular proteins", "1", "38", "0.0264", "0.126"], ["XBP1(S) activates chaperone genes", "1", "48", "0.0332", "0.126"], ["IRE1alpha activates chaperones", "1", "50", "0.0346", "0.126"], ["Apoptotic execution phase", "1", "52", "0.0359", "0.126"], ["Signaling by ERBB4", "1", "62", "0.0427", "0.126"], ["Regulation of PTEN stability and activity", "1", "69", "0.0474", "0.126"]], "row_count": 13, "column_count": 5, "numeric_cells": 48, "header_rows": 1, "locator": "section[5]/table-wrap[3]#cancers-13-01646-t004"}}, {"id": "asset:table:pmid:33916015:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:625a3e40de65945fa847fd2decf80e0886218750897d1201de061ca0bda837fc", "bytes": 1511, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#cancers-13-01646-t005", "version": null, "note": "Sequences of used RT-qPCR primers. Annealing Temperatures (Ta) and Product Lenghts are in table.", "structure": {"pmcid": "PMC8036732", "section_index": 21, "section_title": "4.10. RT-qPCR Analysis", "row_count": 19, "column_count": 5}, "table": {"label": "Table 5", "caption": "Sequences of used RT-qPCR primers. Annealing Temperatures (Ta) and Product Lenghts are in table.", "rows": [["Gene (NCBI Gene ID)", "GenBank Ref.seq", "Primer Name", "Sequence", "Ta and Product Length"], ["TNFRSF10B", "NM_003842", "DR5_for", "GTGATTCAGGTGAAGTGGAGC", "60 ∘C"], ["(8795)", "NM_147187", "DR5_rev", "CGACCTTGACCATCCCTCTG", "147 bp"], ["TNFRSF10B", "NM_003842", "DR5.v1_for", "ACTCCTGCCTCTCCCTGTTC", "60 ∘C"], ["(8795)", "DR5.v1_rev", "AGGTCGTTGTGAGCTTCTGTC", "186 bp"], ["TNFRSF10B", "NM_147187", "DR5.v2_for", "CTAAGTCCCTGCACCACGAC", "60 ∘C"], ["(8795)", "DR5.v2_rev", "TGACTCCTATGATGATGCCTGATT", "193 bp"], ["TNFRSF10A", "NM_003844", "DR4_for", "GTTGGTGGCTGTGCTGATTG", "60 ∘C"], ["(8797)", "DR4_rev", "TGCGTTGCTCAGAATCTCGT", "151 bp"], ["TNF (TNF alpha)", "NM_000594", "TNFa_for", "TGTCCACACGATCCCAACAC", "60 ∘C"], ["(7124)", "TNFa_rev", "GGCTGTCACACCCACAATCA", "152 bp"], ["TNFRSF1A", "NM_001065", "TNFRSF1A_for", "CGTGATCTCTATGCCCGAGT", "60 ∘C"], ["(7132)", "TNFRSF1A_rev", "GACCAGTCCAATAACCCCTGA", "244 bp"], ["TNFRSF1B", "NM_001066", "TNFRSF1B_for", "TGTCCACACGATCCCAACAC", "60 ∘C"], ["(7133)", "TNFRSF1B_rev", "GGCTGTCACACCCACAATCA", "152 bp"], ["TNFRSF6B", "NM_003823", "DcR3_for", "CTCTTCCTCCCATGACACCCT", "60 ∘C"], ["(8771)", "DcR3_rev", "ATGGAGATGTCCTGGAAAGCC", "123 bp"], ["PMM1", "NM_002676", "PMM1_for", "GCTCGCCAGAAAATTGACCCT", "61 ∘C"], ["(5372)", "PMM1_rev", "ATACTGCACCGTCCCGTTCT", "177 bp"]], "row_count": 19, "column_count": 5, "numeric_cells": 41, "header_rows": 1, "locator": "section[21]/table-wrap[1]#cancers-13-01646-t005"}}, {"id": "asset:table:pmid:33916015:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9d46f733857ba9f320929ffb337137379f2609940081484ce35d5dac884ddfda", "bytes": 911, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[25]/table-wrap[1]#array1", "version": null, "note": null, "structure": {"pmcid": "PMC8036732", "section_index": 25, "section_title": "Abbreviations", "row_count": 17, "column_count": 2}, "table": {"label": null, "caption": null, "rows": [["ABCG2", "ATP-binding cassette super-family G member 2"], ["DMSO", "Dimethylsulfoxid"], ["DR5", "Death receptor 5; known as TNFRSF10B (Tumor necrosis factor receptor superfamily 10B)"], ["DTT", "Dithiothreitol"], ["FACS", "Fluorescence-activated cell sorting"], ["FDR", "False discovery rate"], ["GN", "gene name"], ["IC50", "Half maximal inhibitory concentration"], ["LC-MS", "Liquid chromatography–mass spectrometry"], ["MTT", "3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide"], ["PBS", "Phosphate-buffered saline"], ["PTEN", "Phosphatase and tensin homolog"], ["RT-qPCR", "Reverse transcription quantitative polymerase chain reaction"], ["SDS", "Sodium dodecyl sulfate"], ["SKR", "Skyrin"], ["TNF", "Tumor necrosis factor"], ["TRAIL", "TNF-related apoptosis-inducing ligand"]], "row_count": 17, "column_count": 2, "numeric_cells": 4, "header_rows": 0, "locator": "section[25]/table-wrap[1]#array1"}}], "gaps": ["asset:data:geo:PXD019995 not downloaded", "asset:data:geo:PXD019995 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test."}}, {"id": "method-2", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "LIMMA"}}, {"id": "method-3", "family": "flow_cytometry_analysis", "specific": "gating", "label": "Flow cytometry analysis", "dsl_operations": ["gate_population", "quantify_mfi", "compensation_matrix"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["event_table"], "evidence": {"score": 0.8, "band": "high", "quote": "gating strategies"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["PXD019995"], "resolved_accessions": ["PXD019995"], "statements": ["Mass spectrometry data are available via ProteomeXchange with identifier PXD019995."], "basis": "The paper names PXD019995 in ProteomeXchange Consortium via the PRIDE partner repository and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33916015", "data:geo:PXD019995", "asset:table:pmid:33916015:1", "asset:table:pmid:33916015:2", "asset:table:pmid:33916015:3", "asset:table:pmid:33916015:4", "asset:table:pmid:33916015:5", "asset:table:pmid:33916015:6"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:PXD019995"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:29:30Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 78025, "completion_tokens": 1238, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33916015", "type": "paper", "label": "pmid:33916015"}, {"id": "source:pmid:33916015", "type": "manuscript", "label": "PMID 33916015 full text"}, {"id": "data:geo:PXD019995", "type": "dataset", "label": "GEO PXD019995"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33916015", "type": "paper", "label": "pmid:33916015"}, {"id": "source:pmid:33916015", "type": "manuscript", "label": "PMID 33916015 full text"}, {"id": "data:geo:PXD019995", "type": "dataset", "label": "GEO PXD019995"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33916015", "type": "extraction", "used": ["source:pmid:33916015"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-PXD019995", "type": "accession_resolution", "used": ["data:geo:PXD019995"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33916015", "parent_hash": "sha256:dcaa72518ff56df76b2145ea1aa26debf35b0b9726e5755a0af9771b7a8ec5a2", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:PXD019995 licence not read", "asset:data:geo:PXD019995 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "mass_spectrometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ent with SKR. Based on the LC-MS comparative proteomic data from hypoxia and normoxia (data are ava", "** p < 0.01, *** p < 0.001. For comparative proteomics, the LIMMA test and the Benjamini Hochberg m", "equent analysis. All experiments (except the mass spectrometry analysis, RT-qPCR analysis and phosphatidyls"], "order_basis": "paper_text_order:740", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["was confirmed by real-time qualitative PCR (RT-qPCR). Furthermore, multiple changes in the Tumor", "s confirmed by real-time qualitative PCR (RT-qPCR). Furthermore, multiple changes in the Tumor", "ents (except the mass spectrometry analysis, RT-qPCR analysis and phosphatidylserine externalizat", "R5—both isoforms) gene fragment amplified in RT-qPCR by oligonucleotide primers DR5_for and DR5_r"], "order_basis": "paper_text_order:958", "id": "assay:2"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["changes in the Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-activated cascade we", "The effect of SKR on proportions of cells in apoptosis, secondary necrosis, necrosis and live cells"], "order_basis": "paper_text_order:1034", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["kville, MD, USA). HT-29 and SW620 cells were cultured in complete RPMI-1640 medium (Sigma-Aldrich, St"], "order_basis": "paper_text_order:1654", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Significance between samples was assessed by a one-way ANOVA with Tukey’s post-test."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T01:28:19+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}