{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33936160", "kind": "science-record", "revision": 8, "content_hash": "sha256:ec392c0ac549142c0d7c7f3ae6538a735921f99a322403b20747daa22529422b", "created_at": "2026-11-01T15:41:34Z", "updated_at": "2026-11-01T22:03:40Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Analysis of mRNA Expression and DNA Methylation Datasets According to the Genomic Distribution of CpG Sites in Osteoarthritis.", "doi": "10.3389/fgene.2021.618803", "pmid": "33936160", "authors": ["Peng Yi", "Xiongfeng Xu", "Jiawei Yao", "Bo Qiu"], "journal": "Frontiers in genetics", "year": 2021, "abstract": "Objectives Transcriptional changes in cartilage can impact function by causing degradation such as that which occurs during the development of osteoarthritis (OA). Epigenetic regulation may be a key factor leading to transcriptional changes in OA. In this study, we performed a combined analysis of DNA methylation and gene expression microarray datasets and identified key transcription factors (TFs) central to the regulation of gene expression in OA. Methods A DNA methylation profile dataset (GSE63106) and a gene expression profiling dataset (GSE114007) were extracted from the Gene Expression Omnibus (GEO). We used ChAMP methylation analysis and the Limma package to identify differentially methylation genes (DMGs) and differentially expressed genes (DEGs) from normal and human knee cartilage samples in OA. Function enrichment analysis of DMGs was conducted using the DAVID database. A combined analysis of DEGs and DMGs was conducted to identify key TFs in OA. We then validated the mRNA expression of selected TFs in normal and OA cartilage by RT-qPCR. Primary chondrocytes were cultured and treated with the DNA methylation inhibitor 5-Aza-2-deoxycytidine (5-Aza) for functional validation. Results We identified 2,170 differential methylation sites (DMS) containing 1005 genes and 1986 DEGs between normal human and OA cartilage. Functional analysis of DMGs revealed that focal adhesion, extracellular matrix (ECM)-receptor interactions, the PI3K-Akt signaling pathway, and the FoxO signaling pathway were involved in OA. Integrated analysis showed a subset of 17 TFs. Four TFs (ELF3, SOX11, RARA, and FOXD2) were validated. RT-qPCR results showed the mRNA expression of SOX11, RARA, and FOXD2 were consistent with the results from the mRNA expression data. However, the expression of ELF3 could not be validated. Upon 5-Aza-2'-deoxycytidine (5-Aza) treatment, the mRNA levels of ELF3 and SOX11 were down-regulated, whilst RARA was up-regulated, and FOXD2 showed no significant change in expression level. Conclusions the effect of DNA methylation on the transcriptional regulation is related to the distribution of methylated sites across the genome. Epigenetic studies on the positions of DMS in transcriptional units can inform a better understanding of the function of DNA methylation and its transcription regulation.", "claims": [{"id": "claim-method", "statement": "Data between the two groups were compared using an unpaired Student’s t-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33936160", "locator": "sections[10] \"Statistical Analysis\" paragraph 2", "quote": "Data between the two groups were compared using an unpaired Student’s t-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33936160", "locator": "sections[4] \"DNA Methylation Profiling and Gene Expression Data\" paragraph 2", "quote": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33936160"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE114007"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE114007"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33936160", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fgene.2021.618803", "sha256": "sha256:e7e9703786252519a9df5b03aa726fd2646aa1ce04cda83ab0ba073a33dd6ec6", "bytes": 30794, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fgene.2021.618803", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8082497", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE114007", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE114007", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE114007", "version": null, "note": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3130531", "GSM3130532", "GSM3130533", "GSM3130534", "GSM3130535", "GSM3130536", "GSM3130537", "GSM3130538", "GSM3130539", "GSM3130540", "GSM3130541", "GSM3130542", "GSM3130543", "GSM3130544", "GSM3130545", "GSM3130546", "GSM3130547", "GSM3130548", "GSM3130549", "GSM3130550", "GSM3130551", "GSM3130552", "GSM3130553", "GSM3130554", "GSM3130555", "GSM3130556", "GSM3130557", "GSM3130558", "GSM3130559", "GSM3130560", "GSM3130561", "GSM3130562", "GSM3130563", "GSM3130564", "GSM3130565", "GSM3130566", "GSM3130567", "GSM3130568"], "sample_count": 38, "group_sizes": null, "group_sizes_basis": null, "platform": "11154;18573", "taxon": "Homo sapiens", "title": "Identification of transcription factors responsible for dysregulated networks in human osteoarthritis cartilage by global gene expression analysis", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE63106", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63106", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE63106", "version": null, "note": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1541309", "GSM1541310", "GSM1541311", "GSM1541312", "GSM1541313", "GSM1541314", "GSM1541315", "GSM1541316", "GSM1541317", "GSM1541318", "GSM1541319", "GSM1541320", "GSM1541321", "GSM1541322", "GSM1541323", "GSM1541324", "GSM1541325", "GSM1541326", "GSM1541327", "GSM1541328", "GSM1541329", "GSM1541330", "GSM1541331", "GSM1541332", "GSM1541333", "GSM1541334", "GSM1541335", "GSM1541336", "GSM1541337", "GSM1541338", "GSM1541339", "GSM1541340", "GSM1541341", "GSM1541342", "GSM1541343", "GSM1541344", "GSM1541345", "GSM1541346", "GSM1541347", "GSM1541348", "GSM1541349", "GSM1541350", "GSM1541351", "GSM1541352", "GSM1541353", "GSM1541354", "GSM1541355", "GSM1541356", "GSM1541357", "GSM1541358", "GSM1541359", "GSM1541360", "GSM1541361", "GSM1541362", "GSM1541363", "GSM1541364", "GSM1541365", "GSM1541366", "GSM1541367", "GSM1541368", "GSM1541369", "GSM1541370"], "sample_count": 62, "group_sizes": null, "group_sizes_basis": null, "platform": "13534", "taxon": "Homo sapiens", "title": "Assessing transcriptionally functional CpGs in articular cartilage", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33936160:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8766fddd7f478aa48b51cf0b899e047a7d6740c578e7f21b3ea9690a59767da9", "bytes": 542, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#T1", "version": null, "note": "Primer sequences of the genes used for RT-qPCR.", "structure": {"pmcid": "PMC8082497", "section_index": 9, "section_title": "Reverse Transcription Quantitative PCR (RT–qPCR)", "row_count": 7, "column_count": 3}, "table": {"label": "TABLE 1", "caption": "Primer sequences of the genes used for RT-qPCR.", "rows": [["", "Primer sequence (5′-3′)"], ["Target Gene", "Forward", "Reverse"], ["GAPDH", "CAATGACCCCTTCATTGACC", "GACAAGCTTCCCGTTCTCAG"], ["ELF3", "GATCTCCGAGCAAGAGCGTAG", "GTCTTCGACCAGAACTGGGG"], ["FOXD2", "GCGCCAAAGCCTTCTACG", "GAGCGATAGAGCCCGCTTAG"], ["RARA", "CACACACCTGAGCAGCATCAC", "CGGTCCTTTGGTCAAGCAGT"], ["SOX11", "AGCGGAGGAGGTTTTCAGTG", "TTCCATTCGGTCTCGCCAAA"]], "row_count": 7, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[9]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33936160:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b608321028f82a3f4da1caeedb0541fc52be606f0d8f8df424dca152c6aab0b8", "bytes": 800, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#T2", "version": null, "note": "DMS and Array sites (after filtering) in different genomic regions.", "structure": {"pmcid": "PMC8082497", "section_index": 15, "section_title": "Statistical Analysis of CpG Sites", "row_count": 14, "column_count": 5}, "table": {"label": "TABLE 2", "caption": "DMS and Array sites (after filtering) in different genomic regions.", "rows": [["Genomic regions", "DMS", "DMS rate", "Array sites (after filtering)", "Array Rate (after filtering)"], ["3’UTR", "83", "4%", "15005", "4%"], ["5’UTR", "179", "8%", "37756", "9%"], ["1stExon", "23", "1%", "19832", "5%"], ["Gene Body", "886", "41%", "139677", "34%"], ["TSS200", "52", "2%", "46675", "11%"], ["TSS1500", "132", "6%", "60212", "14%"], ["IGR", "815", "38%", "94216", "23%"], ["island", "125", "6%", "132924", "32%"], ["opensea", "1420", "65%", "144283", "35%"], ["shelf", "242", "11%", "38337", "9%"], ["shore", "383", "18%", "97829", "24%"], ["Enhancer", "1189", "55%", "94497", "23%"], ["No enhancer", "981", "45%", "318876", "77%"]], "row_count": 14, "column_count": 5, "numeric_cells": 57, "header_rows": 1, "locator": "section[15]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:33936160:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:cfbc8b473979000e5fe1f544f0f299a3fa787576b2507d82033e64c08bb1e3a7", "bytes": 1568, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#T3", "version": null, "note": "DETFs harboring DMS in knee articular cartilage from normal and OA patients.", "structure": {"pmcid": "PMC8082497", "section_index": 16, "section_title": "Integrative Analysis of DNA Methylation and Gene Expression", "row_count": 18, "column_count": 6}, "table": {"label": "TABLE 3", "caption": "DETFs harboring DMS in knee articular cartilage from normal and OA patients.", "rows": [["Methylation Status in OA", "TFs", "Gene expression status in OA", "Genomic regions", "logFC of GSE63106", "logFC of GSE114007"], ["Hyper-methylated", "SOX11", "Upregulated", "3’UTR", "0.114052191", "3.830859342"], ["", "ATOH8", "Downregulated", "Body", "0.156007596", "−2.082568147"], ["", "MSX2", "Upregulated", "TSS1500", "0.134644281", "1.303540248"], ["", "PITX1", "Downregulated", "3’UTR, Body", "0.154268857", "−1.638461524"], ["", "RARA", "Downregulated", "1stExon", "0.106699436", "−2.309531101"], ["", "PRDM16", "Downregulated", "Body", "0.162060676", "−1.769999863"], ["", "ELF3", "Downregulated", "TSS200", "0.111024436", "−3.022557431"], ["", "FOXD2", "Downregulated", "1stExon,3’UTR", "0.109470333", "−1.184733905"], ["", "TBX4", "Downregulated", "TSS200,TSS1500, Body", "0.15388695", "−1.554387492"], ["Hypo-methylated", "LEF1", "Upregulated", "Body", "−0.100907626", "2.020807828"], ["", "PPARG", "Upregulated", "Body", "−0.129022244", "1.599195067"], ["", "RFX8", "Upregulated", "TSS1500", "−0.174751917", "3.439724382"], ["", "TBX5", "Downregulated", "Body", "−0.205976918", "−1.661135603"], ["", "ARID5B", "Downregulated", "Body", "−0.105378211", "−1.201323891"], ["", "MLXIP", "Downregulated", "Body", "−0.119453723", "−1.459126795"], ["", "NFIL3", "Downregulated", "5’UTR", "−0.193317129", "−2.892963016"], ["", "BCL6", "Downregulated", "5’UTR", "−0.131035527", "−1.530121946"]], "row_count": 18, "column_count": 6, "numeric_cells": 48, "header_rows": 1, "locator": "section[16]/table-wrap[1]#T3"}}], "gaps": ["asset:data:geo:GSE114007 not downloaded", "asset:data:geo:GSE114007 licence not read", "asset:data:geo:GSE63106 not downloaded", "asset:data:geo:GSE63106 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.7, "band": "medium", "quote": "Limma"}}, {"id": "method-2", "family": "clustering", "specific": "hierarchical", "label": "Clustering", "dsl_operations": ["hierarchical_cluster"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["feature_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "hierarchical clustering"}}, {"id": "method-3", "family": null, "specific": null, "label": "unpaired Student’s t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Data between the two groups were compared using an unpaired Student’s t-test."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE63106", "GSE114007"], "resolved_accessions": ["GSE63106", "GSE114007"], "statements": ["GSE63106 was used to collect data from the preserved and affected cartilage samples obtained from 17 knees and 14 hip joints undergoing joint replacement surgery due to primary OA."], "basis": "The paper names GSE63106, GSE114007 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33936160", "data:geo:GSE114007", "asset:table:pmid:33936160:1", "asset:table:pmid:33936160:2", "asset:table:pmid:33936160:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE114007"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:33:01Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 22617, "completion_tokens": 1191, "cached_tokens": 528}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33936160", "type": "paper", "label": "pmid:33936160"}, {"id": "source:pmid:33936160", "type": "manuscript", "label": "PMID 33936160 full text"}, {"id": "data:geo:GSE114007", "type": "dataset", "label": "GEO GSE114007"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33936160", "type": "paper", "label": "pmid:33936160"}, {"id": "source:pmid:33936160", "type": "manuscript", "label": "PMID 33936160 full text"}, {"id": "data:geo:GSE114007", "type": "dataset", "label": "GEO GSE114007"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33936160", "type": "extraction", "used": ["source:pmid:33936160"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE114007", "type": "accession_resolution", "used": ["data:geo:GSE114007"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33936160", "parent_hash": "sha256:3b5ce78f6bfadb595c0574dd098550a6ff06f20b83a9c1155fb50feacdfddfe2", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE114007 licence not read", "asset:data:geo:GSE114007 not downloaded", "asset:data:geo:GSE63106 licence not read", "asset:data:geo:GSE63106 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["lysis of DNA methylation and gene expression microarray datasets and identified key transcription fa"], "order_basis": "paper_text_order:417", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["f selected TFs in normal and OA cartilage by RT-qPCR. Primary chondrocytes were cultured and trea", "LF3, SOX11, RARA, and FOXD2) were validated. RT-qPCR results showed the mRNA expression of SOX11,", "elected TFs in normal and OA cartilage by RT-qPCR. Primary chondrocytes were cultured and trea", ", SOX11, RARA, and FOXD2) were validated. RT-qPCR results showed the mRNA expression of SOX11,"], "order_basis": "paper_text_order:1138", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["Life Science and Technology Co., Ltd.) were cultured in DMEM/F12 medium (cat. no. SH30023.01; Hyclon"], "order_basis": "paper_text_order:3476", "id": "assay:3"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["Limma"], "order_basis": "consumes_earlier_output", "id": "assay:4"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:36:23+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}