{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33994801", "kind": "science-record", "revision": 6, "content_hash": "sha256:c1937f91b689d336b1b66d40b4e42c4739293d7866e4d44eef76b9b7af90b056", "created_at": "2026-11-01T15:41:35Z", "updated_at": "2026-11-01T22:03:46Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identifying the Potential Therapeutic Targets for Atopic Dermatitis Through the Immune Infiltration Analysis and Construction of a ceRNA Network.", "doi": "10.2147/CCID.S310426", "pmid": "33994801", "authors": ["Shixiong Peng", "Mengjiao Chen", "Ming Yin", "Hao Feng"], "journal": "Clinical, cosmetic and investigational dermatology", "year": 2021, "abstract": "PURPOSE: This study was meant to analyze immune infiltration and construct a ceRNA network to explore the new therapeutic targets for atopic dermatitis (AD) through bioinformatics way.\nPATIENTS AND METHODS: We downloaded the AD patients' RNA expression profile datasets (GSE63741, GSE124700) from the Gene Expression Omnibus (GEO) database, which were analyzed through the GEO2R. We explored the hub genes by the enrichment analysis and the protein-protein interaction (PPI) analysis. Moreover, we estimated immune cell types and their proportions by ImmucellAI. GSE121212 dataset validation was performed to verify the robustness of the hub genes. Then, a ceRNA network was constructed by the miRWalk, miRNet, miRDB, DIANA, TargetScan, and starbase database. Finally, gene expression analysis was performed by using RT-qPCR.\nRESULTS: In total, we detected 22 differentially expressed genes (DEGs), which contained 8 downregulated genes and 14 upregulated genes. There were 5 hub genes confirmed as key genes through PPI network analysis and the ROC curves. KEGG pathway analysis revealed that they were significantly enriched in the IL-17 signaling pathway and GO analysis showed mainly in the immune cell chemotaxis. The immune infiltration profiles were different between normal controls and AD, and each of the key genes (S100A7, S100A8, S100A9, and LCE3D) was significantly correlated with the main infiltration cell of AD. A lncRNA-miRNA-mRNA ceRNA network containing the key genes was constructed, and NEAT1 and XIST, the core of ceRNA network, were significantly overexpressing verified by RT-qPCR in AD patients.\nCONCLUSION: Altogether, the key genes and their ceRNA network provided a novel perspective to the immunomodulation of AD, which may be potential and new therapeutic targets for AD.", "claims": [{"id": "claim-method", "statement": "Two groups’ data were analyzed through the unpaired Student’s t-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33994801", "locator": "sections[11] \"Statistical Analysis\" paragraph 2", "quote": "Two groups’ data were analyzed through the unpaired Student’s t-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33994801", "locator": "sections[3] \"Microarray Data\" paragraph 2", "quote": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/)."}, {"asset": "source:pmid:33994801", "locator": "sections[3] \"Microarray Data\" paragraph 2", "quote": "GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33994801"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121212"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121212"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33994801", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/CCID.S310426", "sha256": "sha256:23ebd56a837747aaad1fe43358fd56223080b5a4d6d0a8e4090e91808b1f178f", "bytes": 39214, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/CCID.S310426", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8112859", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE121212", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE121212", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE121212", "version": null, "note": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3427868", "GSM3427869", "GSM3427870", "GSM3427871", "GSM3427872", "GSM3427873", "GSM3427874", "GSM3427875", "GSM3427876", "GSM3427877", "GSM3427878", "GSM3427879", "GSM3427880", "GSM3427881", "GSM3427882", "GSM3427883", "GSM3427884", "GSM3427885", "GSM3427886", "GSM3427887", "GSM3427888", "GSM3427889", "GSM3427890", "GSM3427891", "GSM3427892", "GSM3427893", "GSM3427894", "GSM3427895", "GSM3427896", "GSM3427897", "GSM3427898", "GSM3427899", "GSM3427900", "GSM3427901", "GSM3427902", "GSM3427903", "GSM3427904", "GSM3427905", "GSM3427906", "GSM3427907", "GSM3427908", "GSM3427909", "GSM3427910", "GSM3427911", "GSM3427912", "GSM3427913", "GSM3427914", "GSM3427915", "GSM3427916", "GSM3427917", "GSM3427918", "GSM3427919", "GSM3427920", "GSM3427921", "GSM3427922", "GSM3427923", "GSM3427924", "GSM3427925", "GSM3427926", "GSM3427927", "GSM3427928", "GSM3427929", "GSM3427930", "GSM3427931", "GSM3427932", "GSM3427933", "GSM3427934", "GSM3427935", "GSM3427936", "GSM3427937", "GSM3427938", "GSM3427939", "GSM3427940", "GSM3427941", "GSM3427942", "GSM3427943", "GSM3427944", "GSM3427945", "GSM3427946", "GSM3427947", "GSM3427948", "GSM3427949", "GSM3427950", "GSM3427951", "GSM3427952", "GSM3427953", "GSM3427954", "GSM3427955", "GSM3427956", "GSM3427957", "GSM3427958", "GSM3427959", "GSM3427960", "GSM3427961", "GSM3427962", "GSM3427963", "GSM3427964", "GSM3427965", "GSM3427966", "GSM3427967", "GSM3427968", "GSM3427969", "GSM3427970", "GSM3427971", "GSM3427972", "GSM3427973", "GSM3427974", "GSM3427975", "GSM3427976", "GSM3427977", "GSM3427978", "GSM3427979", "GSM3427980", "GSM3427981", "GSM3427982", "GSM3427983", "GSM3427984", "GSM3427985", "GSM3427986", "GSM3427987", "GSM3427988", "GSM3427989", "GSM3427990", "GSM3427991", "GSM3427992", "GSM3427993", "GSM3427994", "GSM3427995", "GSM3427996", "GSM3427997", "GSM3427998", "GSM3427999", "GSM3428000", "GSM3428001", "GSM3428002", "GSM3428003", "GSM3428004", "GSM3428005", "GSM3428006", "GSM3428007", "GSM3428008", "GSM3428009", "GSM3428010", "GSM3428011", "GSM3428012", "GSM3428013", "GSM3428014"], "sample_count": 147, "group_sizes": null, "group_sizes_basis": null, "platform": "16791", "taxon": "Homo sapiens", "title": "Atopic Dermatitis, Psoriasis and healthy control RNA-seq cohort", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE124700", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE124700", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE124700", "version": null, "note": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3543594", "GSM3543595", "GSM3543596", "GSM3543597"], "sample_count": 4, "group_sizes": null, "group_sizes_basis": null, "platform": "10558", "taxon": "Homo sapiens", "title": "Gene expression data from healthy controls and atopic dermatitis patients skin", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE63741", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63741", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE63741", "version": null, "note": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1556392", "GSM1556393", "GSM1556394", "GSM1556395", "GSM1556396", "GSM1556397", "GSM1556398", "GSM1556399", "GSM1556400", "GSM1556401", "GSM1556402", "GSM1556403", "GSM1556404", "GSM1556405", "GSM1556406", "GSM1556407", "GSM1556408", "GSM1556409", "GSM1556410", "GSM1556411", "GSM1556412", "GSM1556413", "GSM1556414", "GSM1556415", "GSM1556416", "GSM1556417", "GSM1556418", "GSM1556419", "GSM1556420", "GSM1556421", "GSM1556422", "GSM1556423", "GSM1556424", "GSM1556425", "GSM1556426", "GSM1556427", "GSM1556428", "GSM1556429", "GSM1556430", "GSM1556431", "GSM1556432", "GSM1556433", "GSM1556434", "GSM1556435", "GSM1556436", "GSM1556437", "GSM1556438", "GSM1556439", "GSM1556440", "GSM1556441", "GSM1556442", "GSM1556443", "GSM1556444", "GSM1556445", "GSM1556446", "GSM1556447", "GSM1556448", "GSM1556449", "GSM1556450", "GSM1556451", "GSM1556452", "GSM1556453", "GSM1556454", "GSM1556455", "GSM1556456", "GSM1556457", "GSM1556458", "GSM1556459", "GSM1556460", "GSM1556461", "GSM1556462", "GSM1556463", "GSM1556464", "GSM1556465", "GSM1556466", "GSM1556467", "GSM1556468", "GSM1556469", "GSM1556470", "GSM1556471", "GSM1556472", "GSM1556473", "GSM1556474", "GSM1556475", "GSM1556476", "GSM1556477", "GSM1556478", "GSM1556479", "GSM1556480", "GSM1556481", "GSM1556482", "GSM1556483", "GSM1556484", "GSM1556485", "GSM1556486", "GSM1556487", "GSM1556488", "GSM1556489", "GSM1556490", "GSM1556491", "GSM1556492", "GSM1556493", "GSM1556494", "GSM1556495", "GSM1556496", "GSM1556497", "GSM1556498", "GSM1556499", "GSM1556500", "GSM1556501", "GSM1556502", "GSM1556503", "GSM1556504", "GSM1556505", "GSM1556506", "GSM1556507", "GSM1556508", "GSM1556509", "GSM1556510", "GSM1556511", "GSM1556512", "GSM1556513", "GSM1556514", "GSM1556515", "GSM1556516", "GSM1556517", "GSM1556518", "GSM1556519", "GSM1556520", "GSM1556521", "GSM1556522", "GSM1556523", "GSM1556524", "GSM1556525", "GSM1556526", "GSM1556527", "GSM1556528", "GSM1556529", "GSM1556530", "GSM1556531", "GSM1556532", "GSM1556533", "GSM1556534", "GSM1556535", "GSM1556536", "GSM1556537", "GSM1556538", "GSM1556539", "GSM1556540", "GSM1556541"], "sample_count": 150, "group_sizes": null, "group_sizes_basis": null, "platform": "19471", "taxon": "Homo sapiens", "title": "Gene Expression Analyses of Homo sapiens Inflammatory Skin Diseases", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33994801:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7b3d2e83d59d6fb2080c3ff7ae4854b29918cb663cb0687f98d73e643963f2a7", "bytes": 417, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#t0001", "version": null, "note": "Details of the GEO AD Data", "structure": {"pmcid": "PMC8112859", "section_index": 3, "section_title": "Microarray Data", "row_count": 3, "column_count": 3}, "table": {"label": "Table 1", "caption": "Details of the GEO AD Data", "rows": [["Dataset", "Platform", "Number of Samples (AD/Control, Subjects)"], ["GSE63741", "GPL19471 PIQOR (TM) Skin 2.0 Microarray, human, antisense (591)", "150(30/30,60)"], ["GSE124700", "GPL10558 Illumina HumanHT-12 V4.0 expression beadchip", "4(2/2,6)"]], "row_count": 3, "column_count": 3, "numeric_cells": 6, "header_rows": 1, "locator": "section[3]/table-wrap[1]#t0001"}}, {"id": "asset:table:pmid:33994801:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:62402719c4f200fce39c2788cb205d7fbe903fb35fcf980583176991a15061cd", "bytes": 416, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#t0002", "version": null, "note": "The Primer Used in RT-qPCR", "structure": {"pmcid": "PMC8112859", "section_index": 10, "section_title": "The RT-qPCR Analysis", "row_count": 7, "column_count": 2}, "table": {"label": "Table 2", "caption": "The Primer Used in RT-qPCR", "rows": [["Gene", "Primer Sequence (5ʹ – 3ʹ)"], ["H-actin", "F:ACCCTGAAGTACCCCATCGAG"], ["R:AGCACAGCCTGGATAGCAAC"], ["H-NEAT1", "F:CCTGCCTTCTTGTGCGTTT"], ["R:TAGCACAACACAATGACACCCT"], ["H-XIST", "F: ACTGCCACCCATATATAAGCTA"], ["R:AGTAATCACCATTCAGTAAGCCA"]], "row_count": 7, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[10]/table-wrap[1]#t0002"}}, {"id": "asset:table:pmid:33994801:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:94953c30a882b99d6e26543f13f5700fb5bc920a24a21853d8e5572d69511fe0", "bytes": 426, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#t0003", "version": null, "note": "The DEGs of AD", "structure": {"pmcid": "PMC8112859", "section_index": 13, "section_title": "Identification of DEGs in AD", "row_count": 4, "column_count": 2}, "table": {"label": "Table 3", "caption": "The DEGs of AD", "rows": [["Regulation", "Common DEGs of GSE63741 and GSE124700"], ["Upregulated(n=14)", "CCL18, CCL22, AKR1B10, CCL19, S100A7, LCE3D, IFI27"], ["CHI3L2, AQP3, LY6D, S100A8, RAB31, MMP12, S100A9"], ["Downregulated(n=8)", "FLG2, CST6, SERPINA12, HBB, KRT15, CCND1, LCE1B, HBA1"]], "row_count": 4, "column_count": 2, "numeric_cells": 6, "header_rows": 1, "locator": "section[13]/table-wrap[1]#t0003"}}, {"id": "asset:table:pmid:33994801:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:55ad3605d173f85a3d8dc0de63a3227e4d322be9358b0724d1747507b22baea8", "bytes": 2844, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#t0004", "version": null, "note": "The Top 10 Function and Pathway Enrichment Items of the DEGs", "structure": {"pmcid": "PMC8112859", "section_index": 14, "section_title": "Function and Pathway Enrichment Analyses of the DEGs", "row_count": 30, "column_count": 4}, "table": {"label": "Table 4", "caption": "The Top 10 Function and Pathway Enrichment Items of the DEGs", "rows": [["Category", "Description", "P value", "Genes"], ["GO BP", "GO:0008544 epidermis development", "5.45551E-08", "AQP3,CST6,KRT15,S100A7,LCE3D,LCE1B,FLG2"], ["GO BP", "GO:0071621 granulocyte chemotaxis", "5.44051E-10", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0097530 granulocyte migration", "1.54858E-09", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0097529 myeloid leukocyte migration", "1.64556E-08", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0030595 leukocyte chemotaxis", "2.08055E-08", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0060326 cell chemotaxis", "1.17284E-07", "S100A7,S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0030593 neutrophil chemotaxis", "1.53171E-08", "S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:1990266 neutrophil migration", "3.74245E-08", "S100A8,S100A9,CCL18,CCL19,CCL22"], ["GO BP", "GO:0048247 lymphocyte chemotaxis", "1.87602E-07", "S100A7,CCL18,CCL19,CCL22"], ["GO BP", "GO:0002548 monocyte chemotaxis", "2.25311E-07", "S100A7,CCL18,CCL19,CCL22"], ["GO CC", "GO:0060205 cytoplasmic vesicle lumen", "5.6214E-06", "HBA1,HBB,S100A7,S100A8,S100A9"], ["GO CC", "GO:0031983 vesicle lumen", "5.7024E-06", "HBA1,HBB,S100A7,S100A8,S100A9"], ["GO CC", "GO:0031012 extracellular matrix", "0.000923351", "MMP12,S100A7,S100A8,S100A9"], ["GO CC", "GO:0034774 secretory granule lumen", "0.001974261", "S100A7,S100A8,S100A9"], ["GO CC", "GO:0062023 collagen-containing extracellular matrix", "0.004403432", "S100A7,S100A8,S100A9"], ["GO CC", "GO:0030139 endocytic vesicle", "0.001821123", "HBA1,HBB,RAB31"], ["GO MF", "GO:0005509 calcium ion binding", "0.000192896", "MMP12,S100A7,S100A8,S100A9,FLG2"], ["GO MF", "GO:0043177 organic acid binding", "3.1967E-05", "HBA1,HBB,S100A8,S100A9"], ["GO MF", "GO:0050786 RAGE receptor binding", "6.92211E-08", "S100A7,S100A8,S100A9"], ["GO MF", "GO:0048020 CCR chemokine receptor binding", "6.67899E-06", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0008009 chemokine activity", "7.58116E-06", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0042379 chemokine receptor binding", "2.22851E-05", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0048306 calcium-dependent protein binding", "3.99042E-05", "S100A7,S100A8,S100A9"], ["GO MF", "GO:0016209 antioxidant activity", "4.13255E-05", "HBA1,HBB,S100A9"], ["GO MF", "GO:0005125 cytokine activity", "0.000799355", "CCL18,CCL19,CCL22"], ["GO MF", "GO:0005126 cytokine receptor binding", "0.001205692", "CCL18,CCL19,CCL22"], ["KEGG pathway", "hsa04657 IL-17 signaling pathway", "5.56373E-05", "S100A7,S100A8,S100A9"], ["KEGG pathway", "hsa04062 Chemokine signaling pathway", "0.000515188", "CCL18,CCL19,CCL22"], ["KEGG pathway", "hsa04060 Cytokine-cytokine receptor interaction", "0.002080696", "CCL18,CCL19,CCL22"]], "row_count": 30, "column_count": 4, "numeric_cells": 87, "header_rows": 1, "locator": "section[14]/table-wrap[1]#t0004"}}, {"id": "asset:table:pmid:33994801:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9776a69bd971d76d6e87034ff75f4b89148bd21d0be6f40cdb043df19d4dc749", "bytes": 549, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#t0005", "version": null, "note": "The Top 5 Hub Genes", "structure": {"pmcid": "PMC8112859", "section_index": 15, "section_title": "PPI Network and Module Analyses", "row_count": 6, "column_count": 5}, "table": {"label": "Table 5", "caption": "The Top 5 Hub Genes", "rows": [["Genes", "Description", "Degree", "MCC", "Expression Change"], ["HBB", "Hemoglobin subunit beta", "4", "4", "Downregulated"], ["LCE3D", "Late cornified envelope 3D", "3", "3", "Upregulated"], ["S100A7", "S100 calcium binding protein A7", "4", "4", "Upregulated"], ["S100A9", "S100 calcium binding protein A9", "3", "4", "Upregulated"], ["S100A8", "S100 calcium binding protein A8", "3", "4", "Upregulated"]], "row_count": 6, "column_count": 5, "numeric_cells": 17, "header_rows": 1, "locator": "section[15]/table-wrap[1]#t0005"}}, {"id": "asset:table:pmid:33994801:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f0f9eccf67d98975ad842eb97d8a91317517e40e2c3edaafda07d83144f6fa1c", "bytes": 476, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t0006", "version": null, "note": "Results of AUCs for Hub Genes", "structure": {"pmcid": "PMC8112859", "section_index": 17, "section_title": "Data Validation of the Hub Genes", "row_count": 6, "column_count": 4}, "table": {"label": "Table 6", "caption": "Results of AUCs for Hub Genes", "rows": [["Hub Genes", "AUC", "95% Confidence Interval", "P value"], ["LCE3D", "0.9342", "0.8710 to 0.9974", "<0.0001"], ["S100A8", "0.9328", "0.8717 to 0.9938", "<0.0001"], ["S100A9", "0.9246", "0.8586 to 0.9905", "<0.0001"], ["S100A7", "0.9122", "0.8383 to 0.9861", "<0.0001"], ["HBB", "0.7956", "0.6720 to 0.9193", "0.0002"]], "row_count": 6, "column_count": 4, "numeric_cells": 19, "header_rows": 1, "locator": "section[17]/table-wrap[1]#t0006"}}, {"id": "asset:table:pmid:33994801:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:98cbc775f9c966ced0fd9d28042327e7e243c578759404a860b207ca4baa1b36", "bytes": 996, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#t0007", "version": null, "note": "The miRNAs Targeting Hub Genes", "structure": {"pmcid": "PMC8112859", "section_index": 19, "section_title": "The lncRNA-miRNA-mRNA ceRNA Network of AD", "row_count": 15, "column_count": 2}, "table": {"label": "Table 7", "caption": "The miRNAs Targeting Hub Genes", "rows": [["Genes", "The miRNAs"], ["HBB", "hsa-miR-6851-3p hsa-miR-3922-5p hsa-miR-361-3p hsa-miR-1910-3p"], ["hsa-miR-6511a-5p hsa-miR-3914 hsa-miR-33a-3p hsa-miR-5009-5p"], ["hsa-miR-6822-5p hsa-miR-4307 hsa-miR-4423-3p hsa-miR-6750-5p"], ["hsa-miR-6886-3p hsa-miR-8058"], ["LCE3D", "hsa-miR-193b-5p hsa-miR-1224-5p hsa-miR-3170 hsa-miR-4700-5p"], ["hsa-miR-4320 hsa-miR-6763-5p hsa-miR-4667-5p hsa-miR-3690"], ["hsa-miR-4471 hsa-miR-513a-5p hsa-miR-4269 hsa-miR-4314"], ["hsa-miR-6750-5p hsa-miR-6855-5p hsa-miR-4691-5p hsa-miR-6792-3p"], ["hsa-miR-5004-5p"], ["S100A7", "hsa-miR-30c-2-3p hsa-miR-1343-3p hsa-miR-6788-5p hsa-miR-6852-5p"], ["S100A8", "hsa-miR-98-5p"], ["S100A9", "hsa-miR-4701-5p hsa-miR-132-5p hsa-miR-588 hsa-miR-1204"], ["hsa-miR-3677-5p hsa-miR-940 hsa-miR-6878-3p"], ["hsa-miR-766-5p hsa-miR-92a-1-5p hsa-miR-660-3p"]], "row_count": 15, "column_count": 2, "numeric_cells": 17, "header_rows": 1, "locator": "section[19]/table-wrap[1]#t0007"}}, {"id": "asset:table:pmid:33994801:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7d7a84b1b4a29e650a8d0639771a79df8d759615dcec5e09bc2fa4b7fe2de4b5", "bytes": 515, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[2]#t0008", "version": null, "note": "The ceRNA Network of AD", "structure": {"pmcid": "PMC8112859", "section_index": 19, "section_title": "The lncRNA-miRNA-mRNA ceRNA Network of AD", "row_count": 8, "column_count": 3}, "table": {"label": "Table 8", "caption": "The ceRNA Network of AD", "rows": [["mRNA", "miRNA", "lncRNA"], ["HBB", "hsa-miR-361-3p", "SNHG1, GUSBP11, MALAT1"], ["LCE3D", "hsa-miR-1224-5p", "NEAT1"], ["S100A8", "hsa-miR-98-5p", "NUTM2A-AS1, TRG-AS1, XIST, TTTY15"], ["S100A9", "hsa-miR-766-5p", "RMRP, STAG3L5P-PVRIG2P-PILRB, XIST"], ["NEAT1, LINC00894, KCNQ1OT1, NUTM2A-AS1"], ["hsa-miR-588", "XIST,NEAT1"], ["hsa-miR-132-5p", "TTN-AS1"]], "row_count": 8, "column_count": 3, "numeric_cells": 11, "header_rows": 1, "locator": "section[19]/table-wrap[2]#t0008"}}], "gaps": ["asset:data:geo:GSE121212 not downloaded", "asset:data:geo:GSE121212 licence not read", "asset:data:geo:GSE124700 not downloaded", "asset:data:geo:GSE124700 licence not read", "asset:data:geo:GSE63741 not downloaded", "asset:data:geo:GSE63741 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": null, "specific": null, "label": "unpaired Student’s t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Two groups’ data were analyzed through the unpaired Student’s t-test."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE63741", "GSE124700", "GSE121212"], "resolved_accessions": ["GSE63741", "GSE124700", "GSE121212"], "statements": ["The AD patients’ RNA expressed datasets (GSE63741, GSE124700) were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). GSE63741 included an RNA expression profile of 150 samples, containing 30 control samples and 30 AD samples, while GSE124700 included RNA expression datasets for 2 control samples and 2 AD samples (6 subjects)."], "basis": "The paper names GSE63741, GSE124700, GSE121212 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:33994801", "data:geo:GSE121212", "asset:table:pmid:33994801:1", "asset:table:pmid:33994801:2", "asset:table:pmid:33994801:3", "asset:table:pmid:33994801:4", "asset:table:pmid:33994801:5", "asset:table:pmid:33994801:6", "asset:table:pmid:33994801:7", "asset:table:pmid:33994801:8"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE121212"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:30:03Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 32894, "completion_tokens": 891, "cached_tokens": 785}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33994801", "type": "paper", "label": "pmid:33994801"}, {"id": "source:pmid:33994801", "type": "manuscript", "label": "PMID 33994801 full text"}, {"id": "data:geo:GSE121212", "type": "dataset", "label": "GEO GSE121212"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33994801", "type": "paper", "label": "pmid:33994801"}, {"id": "source:pmid:33994801", "type": "manuscript", "label": "PMID 33994801 full text"}, {"id": "data:geo:GSE121212", "type": "dataset", "label": "GEO GSE121212"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33994801", "type": "extraction", "used": ["source:pmid:33994801"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE121212", "type": "accession_resolution", "used": ["data:geo:GSE121212"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33994801", "parent_hash": "sha256:dba05a6f8f79aaa2d83aefc86993f8448aa38f1b7a923de999e0dd122ff9042c", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE121212 licence not read", "asset:data:geo:GSE121212 not downloaded", "asset:data:geo:GSE124700 licence not read", "asset:data:geo:GSE124700 not downloaded", "asset:data:geo:GSE63741 licence not read", "asset:data:geo:GSE63741 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["e expression analysis was performed by using RT-qPCR. RESULTS: In total, we detected 22 different", "ere significantly overexpressing verified by RT-qPCR in AD patients. CONCLUSION: Altogether, the", "xpression analysis was performed by using RT-qPCR. RESULTS: In total, we detected 22 different", "significantly overexpressing verified by RT-qPCR in AD patients. CONCLUSION: Altogether, the"], "order_basis": "paper_text_order:918", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T01:30:38+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}