{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34017995", "kind": "science-record", "revision": 8, "content_hash": "sha256:8cd11b76d9ac861af1f6614acbb89a8b4a3baf40fd78b9f9f9cb1d017f26f8fd", "created_at": "2026-11-01T15:41:36Z", "updated_at": "2026-11-01T22:46:44Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of potential diagnostic and prognostic biomarkers for LUAD based on TCGA and GEO databases.", "doi": "10.1042/BSR20204370", "pmid": "34017995", "authors": ["Qiangqiang Zheng", "Shihui Min", "Qinghua Zhou"], "journal": "Bioscience reports", "year": 2021, "abstract": "Accumulating evidence has demonstrated that gene alterations play a crucial role in LUAD development, progression, and prognosis. The present study aimed to identify the hub genes associated with LUAD. In the present study, we used TCGA database to screen the hub genes. Then, we validated the results by GEO datasets. Finally, we used cBioPortal, UALCAN, qRT-PCR, HPA database, TCGA database, and Kaplan-Meier plotter database to estimate the gene mutation, gene transcription, protein expression, clinical features of hub genes in patients with LUAD. A total of 5930 DEGs were screened out in TCGA database. Enrichment analysis revealed that DEGs were involved in the transcriptional misregulation in cancer, viral carcinogenesis, cAMP signaling pathway, calcium signaling pathway, and ECM-receptor interaction. The combining results of MCODE and CytoHubba showed that ADCY8, ADRB2, CALCA, GCG, GNGT1, and NPSR1 were hub genes. Then, we verified the above results by GSE118370, GSE136043, and GSE140797 datasets. Compared with normal lung tissues, the expression levels of ADCY8 and ADRB2 were lower in LUAD tissues, but the expression levels of CALCA, GCG, GNGT1, and NPSR1 were higher. In the prognosis analyses, the low expression of ADCY8 and ADRB2 and the high expression of CALCA, GCG, GNGT1, and NPSR1 were correlated with poor OS and poor PFS. The significant differences in the relationship of the expression of 6 hub genes and clinical features were observed. In conclusion, 6 hub genes will not only contribute to elucidating the pathogenesis of LUAD and may be potential therapeutic targets for LUAD.", "claims": [{"id": "claim-method", "statement": "Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34017995", "locator": "sections[4] \"Identification of the aberrantly expressed genes in LUAD\" paragraph 2", "quote": "Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34017995", "locator": "sections[30] \"Data Availability\" paragraph 2", "quote": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34017995"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE118370"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE118370"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34017995", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1042/BSR20204370", "sha256": "sha256:c30bb84c2ff29d30d944a6ed58866168d6dfff937407ae98b0585f9cd9f8a72d", "bytes": 51792, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1042/BSR20204370", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8182989", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE118370", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE118370", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE118370", "version": null, "note": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3325818", "GSM3325819", "GSM3325820", "GSM3325821", "GSM3325822", "GSM3325823", "GSM3325824", "GSM3325825", "GSM3325826", "GSM3325827", "GSM3325828", "GSM3325829"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data from lung adenocarcinoma tissues and paired normal lung tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE136043", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE136043", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE136043", "version": null, "note": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4040007", "GSM4040008", "GSM4040009", "GSM4040010", "GSM4040011", "GSM4040012", "GSM4040013", "GSM4040014", "GSM4040015", "GSM4040016"], "sample_count": 10, "group_sizes": null, "group_sizes_basis": null, "platform": "13497", "taxon": "Homo sapiens", "title": "mRNAs microarray from 5 fresh lung cancer tissues and 5 fresh non-tumor tissues.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE140797", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE140797", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE140797", "version": null, "note": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4185443", "GSM4185444", "GSM4185445", "GSM4185446", "GSM4185447", "GSM4185448", "GSM4185449", "GSM4185450", "GSM4185451", "GSM4185452", "GSM4185453", "GSM4185454", "GSM4185455", "GSM4185456"], "sample_count": 14, "group_sizes": null, "group_sizes_basis": null, "platform": "13497", "taxon": "Homo sapiens", "title": "Gene expression signatures for lung adenocarcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34017995:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:70c129995237f6eb1e2853d5df71bc610d765b75f6b302ea3fcbc34e5ddde3f3", "bytes": 795, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#T1", "version": null, "note": "The primer sequence of qRT-PCR", "structure": {"pmcid": "PMC8182989", "section_index": 12, "section_title": "RNA extraction and qRT-PCR of the hub genes", "row_count": 15, "column_count": 3}, "table": {"label": "Table 1", "caption": "The primer sequence of qRT-PCR", "rows": [["Gene", "Primer", "Sequence (5′ to 3′)"], ["ADRB2", "Forward", "TTGCTGGCACCCAATAGAAGC"], ["", "Reverse", "CAGACGCTCGAACTTGGCA"], ["ADCY8", "Forward", "CCTGCGGCACCAAAGTCTT"], ["", "Reverse", "CGAGTTGCTAGGGGCACAG"], ["CALCA", "Forward", "ATGGGCTTCCAAAAGTTCTCC"], ["", "Reverse", "GCCGATGAGTCACACAGGTG"], ["GCG", "Forward", "CTGAAGGGACCTTTACCAGTGA"], ["", "Reverse", "CCTGGCGGCAAGATTATCAAG"], ["GNGT1", "Forward", "ATTACGTTGAAGAACGATCTGGC"], ["", "Reverse", "GGATGCCCTTTACCAGTGGA"], ["NPSR1", "Forward", "ATGCCAGCCAACTTCACAGAG"], ["", "Reverse", "AAGGAGTAGTAGAAGGAACCCC"], ["GAPDH", "Forward", "GGACCTGACCTGCCGTCTAG"], ["", "Reverse", "GTAGCCCAGGATGCCCTTGA"]], "row_count": 15, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[12]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:34017995:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3a74b836187c48a34a450c80781ae4feca8ea23032557a1be9d3ced9c76e75ed", "bytes": 5387, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#T2", "version": null, "note": "Compared with adjacent non-tumorous tissues, the top 300 up-regulated and 300 down-regulated genes in LUAD based on TCGA database", "structure": {"pmcid": "PMC8182989", "section_index": 18, "section_title": "Aberrantly expressed genes based on TCGA data in LUAD", "row_count": 3, "column_count": 2}, "table": {"label": "Table 2", "caption": "Compared with adjacent non-tumorous tissues, the top 300 up-regulated and 300 down-regulated genes in LUAD based on TCGA database", "rows": [["DEGs", "Genes"], ["Up-regulated", "TFF2, REG4, LINC00676, FGB, DEFA5, MAGEA3, ALB, MAGEA6, RNU5B-1, MAGEC1, CALCA, TFF1, MAGEA10, MAGEA4, LINC01419, FGF19, AFP, CGA, MAGEA12, PRB4, SPINK4, PITX2, TFAP2D, CASP14, PSG1, GC, BARX1, GCG, INSL4, ACTL8, PDX1, HOXC12, C11orf86, TRIM48, FGL1, CSAG1, PRAME, LINC02418, LIN28B, KRT20, CPN1, PAEP, SERPINA4, TM4SF5, DSCAM-AS1, RNU5A-1, MAGEA1, DCAF4L2, RN7SKP255, RNY1, MAGEC2, PSG4, PSG5, COX7B2, SPP2, HIST1H1B, PAGE2, REG1A, F2, AKR1B10, PSG3, CGB5, SST, SPANXB1, CALML5, DLK1, HOXB9, SSX1, PADI3, UGT1A10, AC079466.1, NKX1-2, UGT2B11, SNORA71D, RNU4-1, DLL3, HOXC13, MAGEA11, MUC17, KRTAP4-1, APOBEC1, ANXA10, FOXD3-AS1, SPAG11B, OTX2, TPSP2, VIL1, AC026785.3, LHX1, HIST1H3C, BARX1-DT, FAM83A, TRPM8, GAGE2A, CYP24A1, AL160271.1, MAGEA9B, RNY3, PSG11, RF00100, PAX7, MAGEB2, SNORA74A, SPINK1, HIST1H4L, AL136537.2, IGF2BP1AC011298.1, HOXC11, HIST1H1D, AC007128.2, VGLL2, HOTAIR, NEUROD1, SPAG11A, MAGEB1, SLCO1B3, KRT81, PCSK1, POU3F2, RNU4-2, UGT1A8, LINC01667, CYP11B1, HIST1H3B, HIST1H3F, KLK6, DSCR8, BPIFB4, RNA5-8SP2, SNORA23, KRT6A, AC079062.1, CPS1, AC090502.1, CST4, LINC00942, AL513304.1, TMPRSS11E, AC133785.1, SP3P, HOXD13, EPS8L3, SP8, SNORA73B, AF274573.1, HIST1H2AJ, ASNSP1, SCARNA5, AC005256.1, TINAG, ANKS4B, AC061975.6, DPYSL5, PASD1, PHOX2B, FOXI3, SPRR1B, MMP13, SLCO1B1, BCAR4, CT83, KCNC2, MIR548XHG, FTHL17, RN7SKP203, FAM83A-AS1, ONECUT1, LIPK, GNGT1, INHA, LIN28A, AC114786.2, EEF1A2, HIST1H2BI, LINC01234, AC133681.1, IL37, SLC18A3, AL355075.4, FAR2P1, CLDN10-AS1, TCN1, NR0B1, MAGEA4-AS1, HOXC13-AS, LHX1-DT, LINC01833, AL354685.1, HOXA13, FUT9, TUBA3C, AL139023.1, PRSS1, MYEOV, DMBX1, HIST1H4F, SNORA49, AFAP1-AS1, AC098592.1, ADGRG7, GFY, LINC01559, PADI1, HOXB13, ERVV-2, LINC00973, POU6F2-AS2, AC026336.3, CALML3, AC023824.1, FEZF1, AS1, KRT75, SLC2A2, SCARNA10, KLK12, DPPA2, TM4SF20, LINC02163, LINC01980, HIST1H2BM, HMGA2, AL121949.2, VGF, AKR1B15, LINC01194, COL11A1, CTAG2, MAGEB16, SOX14, TRIM15, CST1, INS, IL36RN, VCX3A, ETNPPL, S100A7, PAH, OLFM4, LINC01468, GAGE1, AC016044.1, BRDT, Z98257.1, HOXC10, LINC01518, IL1RAPL2, HIST1H2BB, HHIPL2, CRABP1, RN7SKP9, KISS1R, ZNF280A, AC079160.1, BAGE2, SNORA54, MIR3609, RMRP, TEX19, DUSP13, PRB1, HIST1H4C, PIWIL3, FAM230C, AC020907.1, RN7SKP227, UGT3A1, GPX2, C6orf15, DKK4, HOXD11, UCA1, G6PC, LHX5, AC106785.2, LINC01511, EIF4E1B, LINC01214, ATP10B, NPSR1, AF127577.3, PCDH8, PPY2P, KCNU1, GABRA3, AP003900.1, PPP1R14D, PSG6, PRSS2, KIF1A, DSCR4, FETUB, MUC6, FABP7, PNPLA5, SNORA80A, SALL3, SP9, AC068228.1, HIST1H3J"], ["Down-regulated", "SLC6A4, CD300LG, AGER, AL606469.1, HTR3C, FABP4, SFTPC, LINC02016, CSF3, CHRM1, MYOC, FAM107A, ANKRD1, HBA1, AC095050.1, SERTM1, OR6K3, ANGPT4, ITLN2, FCN3, GPM6A, LGI3, LINC01996, TMEM100, CA4, AC084030.1, ALAS2, AP002856.2, RPL13AP17, UPK3B, AC128709.3, AC093787.1, AC104984.1, HBB, AC008763.3, MCEMP1, WNT3A, GPD1, HBA2, SH3GL3, AC135012.3, AC009093.3, NCAPGP2, RTKN2, LINC01082, CD5L, OVCH1, C10orf67, FENDRR, FREM3, PI16, AC104984.4, CLEC4M, AL354714.1, TNR, KCNA4, GPIHBP1, CLDN18, AC010776.3, MTATP8P1, AL590226.1, GRIA1, OTC, SGCG, ANGPTL7, CLEC3B, SOSTDC1, SSTR4, ADAMTS8, CHRNA2, CHIAP2, RS1, ADAMTS7P3, ARMH2, ARC, SCUBE1, VEGFD, CLIC5, LINC00656, AC104237.2, KRT79, MIR3945HG, EDNRB, AC104237.3, LANCL1, AS1, AC026369.3, PTPRQ, AL445307.1, NCKAP5, FHL1, INMT, BTNL9, CHRM2, PRX, CACNA1S, ADRA1A, LINC00968, TNNC1, HAS1, CYP1A2, DNASE1L3, LINC00163, STXBP6, CNTN6, GP9, ADH1B, INMT-MINDY4, MYZAP, PACRG-AS3, LINC01070, SCGB1A1, AC013457.1, CAV1, CAVIN2, Z82246.1, CTXND1, DES, AL772337.2, SLC4A1, AC104257.1, LINC01081, FMO2, LINC02570, GDF10, ADCY8, AC093110.1, LINC02154, GYPE, VIPR1, SEMA3G, AC044810.2, AC091305.1, TEK, ST8SIA6, SPOCK2, RAMP3, MGAT3, DEFA3, DNASE2B, CAV3, TCF21, AGBL1, ADRB1, NECAB1, ECEL1P2, ALKAL2, MYH2, FOLR3, HELT, LINC00551, ODAM, ACADL, AL591686.1, RETN, LINC01616, RSPO1, DPP6, AL136369.1, FGF10, MARCO, PCDH15, AL161740.1, LYVE1, AC027288.3, AL359378.1, FOSB, CCDC141, PTPN5, AGRP, CMTM5, OVCH2, AC004947.1, AC113404.1, RXFP1, FGF10-AS1, LINC01863, FXYD1, AC092691.1, PARAL1, FPR2, C2orf71, AP000438.1, MT1JP, ADRB2, SEC14L3, AC053503.6, SFRP5, AC010976.2, FGFBP2, GPA33, STX11, IL1RL1, AC119424.1, AQP4, SOX7, ADGRE3, AC027288.2, SCN4B, SLC14A1, SLC19A3, ADGRG4, FAM189A2, AC096531.2, ABCA8, PPP1R17, AC005324.1, WFIKKN2, AP001189.1, COL6A6, RAMP2, RGCC, IGSF10, LRRC36, ROBO4, CD36, KANK3, CD101, AL355974.2, SIRPB1, AL109741.3, FO681492.1, S1PR1, HHIP, ACTN2, LIMS2, HID1-AS1, AC116312.1, FHL5, RBP2, CXCR1, LINC00844, TAL1, ANOS1, AC092834.1, AL354714.3, CASQ2, FOXF1, HIGD1B, HPSE2, LINC01447, TNXB, HSPA12B, TENT5B, PLAC9, MASP1, SERPINA2, SFTPA1, EDN3, C2orf91, CCDC85A, MT1M, AWAT2, SOX17, EMCN, RXFP2, PLA2G4F, LRRN3, AC093890.1, NMUR1, MAMDC2, TUBB1, MFAP4, AP003385.4, AC026992.2, LAMP3, F11, AC104211.2, CLDN5, SCARA5, CALCRL, AC105914.2, SPAAR, NAV2-AS2, PLAC9P1, AOC3, ASPA, EMP2, AC010776.2, AL138737.1, CATSPERD, EPAS1, DCC, GSG1L, MOGAT1, AC097537.1, LINC01645, PLPPR5, AC018647.1, AC134312.1, CDO1, C14orf132, TGFBR3, NPR1, CCL24, GCOM1, MGAT3-AS1, JPH4, PRKG2, CRTAC1, ARHGEF26"]], "row_count": 3, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[18]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:34017995:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c961c7bcd4e6c7180382f48750f241f664a6cf43946d39b1b3e7cf0b06361f56", "bytes": 6150, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#T3", "version": null, "note": "GO analysis and KEGG pathway analysis of the top 300 up-regulated and 300 down-regulated genes associated with LUAD", "structure": {"pmcid": "PMC8182989", "section_index": 19, "section_title": "GO function and KEGG pathway analyses for the DEGs", "row_count": 97, "column_count": 5}, "table": {"label": "Table 3", "caption": "GO analysis and KEGG pathway analysis of the top 300 up-regulated and 300 down-regulated genes associated with LUAD", "rows": [["Category", "GO ID", "Term", "Count", "P value"], ["A. Up-regulated DEGs", ""], ["BP", "GO:0006366", "Transcription from RNA polymerase II promoter", "14", "0.003"], ["BP", "GO:0007275", "Multicellular organism development", "12", "4.58E-08"], ["BP", "GO:0006334", "Nucleosome assembly", "12", "0.021"], ["BP", "GO:0044267", "Cellular protein metabolic process", "11", "4.32E-07"], ["BP", "GO:0007267", "Cell–cell signaling", "10", "0.001"], ["BP", "GO:0007399", "Nervous system development", "8", "1.98E-05"], ["BP", "GO:0031047", "Gene silencing by RNA", "8", "1.62E-04"], ["BP", "GO:0009952", "Anterior/posterior pattern specification", "8", "0.031"], ["BP", "GO:0007565", "Female pregnancy", "7", "2.90E-07"], ["BP", "GO:0045815", "Positive regulation of gene expression, epigenetic", "7", "8.51E-07"], ["BP", "GO:0045814", "Negative regulation of gene expression, epigenetic", "7", "2.09E-06"], ["BP", "GO:0051290", "Protein heterotetramerization", "7", "4.52E-06"], ["BP", "GO:0000183", "Chromatin silencing at rDNA", "7", "1.28E-05"], ["BP", "GO:0006335", "DNA replication-dependent nucleosome assembly", "7", "4.46E-05"], ["BP", "GO:0032200", "Telomere organization", "7", "3.34E-04"], ["BP", "GO:0007596", "Blood coagulation", "6", "5.01E-04"], ["BP", "GO:0001501", "Skeletal system development", "6", "0.002"], ["BP", "GO:0042593", "Glucose homeostasis", "6", "0.004"], ["BP", "GO:0008544", "Epidermis development", "6", "0.014"], ["BP", "GO:0007586", "Digestion", "6", "0.044"], ["CC", "GO:0005576", "Extracellular region", "51", "2.03E-12"], ["CC", "GO:0005615", "Extracellular space", "33", "1.32E-05"], ["CC", "GO:0000786", "Nucleosome", "13", "3.16E-10"], ["CC", "GO:0043234", "Protein complex", "11", "0.013"], ["CC", "GO:0000784", "Nuclear chromosome, telomeric region", "8", "1.37E-06"], ["CC", "GO:0000228", "Nuclear chromosome", "8", "4.73E-04"], ["CC", "GO:0000788", "Nuclear nucleosome", "7", "6.59E-06"], ["CC", "GO:0005796", "Golgi lumen", "6", "0.004"], ["CC", "GO:0045095", "Keratin filament", "5", "0.022"], ["MF", "GO:0043565", "Sequence-specific DNA binding", "19", "8.84E-06"], ["MF", "GO:0046982", "Protein heterodimerization activity", "17", "3.21E-05"], ["MF", "GO:0005509", "Calcium ion binding", "15", "0.019"], ["MF", "GO:0001077", "Transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding", "10", "8.79E-04"], ["MF", "GO:0004252", "Serine-type endopeptidase activity", "8", "5.88E-05"], ["MF", "GO:0042393", "Histone binding", "8", "3.01E-04"], ["MF", "GO:0005179", "Hormone activity", "8", "0.018"], ["MF", "GO:0008083", "Growth factor activity", "6", "0.028"], ["MF", "GO:0031492", "Nucleosomal DNA binding", "5", "0.001"], ["KEGG", "hsa05202", "Transcriptional misregulation in cancer", "14", "5.84E-09"], ["KEGG", "hsa05203", "Viral carcinogenesis", "11", "3.48E-07"], ["KEGG", "hsa05034", "Alcoholism", "6", "0.019"], ["KEGG", "hsa04950", "Maturity onset diabetes of the young", "6", "0.041"], ["KEGG", "hsa04922", "Glucagon signaling pathway", "5", "8.74E-05"], ["KEGG", "hsa04910", "Insulin signaling pathway", "5", "0.008"], ["KEGG", "hsa04911", "Insulin secretion", "5", "0.008"], ["KEGG", "hsa04970", "Salivary secretion", "5", "0.013"], ["KEGG", "hsa05322", "Systemic lupus erythematosus", "5", "0.039"], ["B. Down-regulated DEGs", ""], ["BP", "GO:0007155", "Cell adhesion", "17", "3.85E-05"], ["BP", "GO:0007166", "Cell surface receptor signaling pathway", "14", "9.13E-07"], ["BP", "GO:0001525", "Angiogenesis", "14", "8.83E-06"], ["BP", "GO:0006898", "Receptor-mediated endocytosis", "9", "5.60E-04"], ["BP", "GO:0001666", "Response to hypoxia", "9", "9.35E-04"], ["BP", "GO:0031623", "Receptor internalization", "7", "6.32E-06"], ["BP", "GO:0006935", "Chemotaxis", "6", "0.001"], ["BP", "GO:0006936", "Muscle contraction", "6", "0.006"], ["BP", "GO:0006816", "Calcium ion transport", "6", "0.010"], ["BP", "GO:0001934", "Positive regulation of protein phosphorylation", "5", "0.001"], ["BP", "GO:0045766", "Positive regulation of angiogenesis", "5", "0.003"], ["BP", "GO:0060021", "Palate development", "5", "0.005"], ["BP", "GO:0072659", "Protein localization to plasma membrane", "5", "0.009"], ["BP", "GO:0001570", "Vasculogenesis", "5", "0.036"], ["BP", "GO:0015701", "Bicarbonate transport", "5", "0.049"], ["CC", "GO:0016021", "Integral component of membrane", "86", "3.44E-06"], ["CC", "GO:0005886", "Plasma membrane", "79", "3.44E-08"], ["CC", "GO:0005576", "Extracellular region", "42", "1.29E-07"], ["CC", "GO:0070062", "Extracellular exosome", "41", "0.034"], ["CC", "GO:0005887", "Integral component of plasma membrane", "37", "9.02E-07"], ["CC", "GO:0005615", "Extracellular space", "34", "6.22E-06"], ["CC", "GO:0009986", "Cell surface", "17", "2.48E-04"], ["CC", "GO:0005578", "Proteinaceous extracellular matrix", "14", "6.55E-06"], ["CC", "GO:0016324", "Apical plasma membrane", "9", "0.002"], ["CC", "GO:0045121", "Membrane raft", "9", "0.013"], ["CC", "GO:0009897", "External side of plasma membrane", "8", "2.79E-04"], ["CC", "GO:0016323", "Basolateral plasma membrane", "8", "0.003"], ["CC", "GO:0030018", "Z disc", "8", "0.008"], ["CC", "GO:0072562", "Blood microparticle", "6", "0.012"], ["CC", "GO:0043235", "Receptor complex", "6", "0.024"], ["CC", "GO:0005581", "Collagen trimer", "5", "0.005"], ["CC", "GO:0030666", "Endocytic vesicle membrane", "5", "0.017"], ["MF", "GO:0008201", "Heparin binding", "9", "2.46E-04"], ["MF", "GO:0004872", "Receptor activity", "7", "0.025"], ["MF", "GO:0044325", "Ion channel binding", "6", "0.006"], ["KEGG", "hsa04024", "cAMP signaling pathway", "16", "8.29E-06"], ["KEGG", "hsa04022", "cGMP-PKG signaling pathway", "10", "0.002"], ["KEGG", "hsa04080", "Neuroactive ligand-receptor interaction", "9", "0.004"], ["KEGG", "hsa04512", "ECM–receptor interaction", "8", "0.001"], ["KEGG", "hsa05144", "Malaria", "8", "0.008"], ["KEGG", "hsa04924", "Renin secretion", "7", "0.014"], ["KEGG", "hsa04020", "Calcium signaling pathway", "6", "0.001"], ["KEGG", "hsa04270", "Vascular smooth muscle contraction", "6", "0.007"], ["KEGG", "hsa04923", "Regulation of lipolysis in adipocytes", "5", "0.005"], ["KEGG", "hsa05414", "Dilated cardiomyopathy", "5", "0.013"], ["KEGG", "hsa04261", "Adrenergic signaling in cardiomyocytes", "5", "0.035"], ["KEGG", "hsa04970", "Salivary secretion", "5", "0.036"]], "row_count": 97, "column_count": 5, "numeric_cells": 282, "header_rows": 1, "locator": "section[19]/table-wrap[1]#T3"}}, {"id": "asset:table:pmid:34017995:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:10409102e0e24fefe1ecf69b99b137396eb1bcd7865ccb7849eb06305ac1391e", "bytes": 500, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#T4", "version": null, "note": "The Venn analysis result of Cytoscape plugins CytoHabba and MCODE", "structure": {"pmcid": "PMC8182989", "section_index": 20, "section_title": "PPI network construction and module analysis of DEGs", "row_count": 4, "column_count": 3}, "table": {"label": "Table 4", "caption": "The Venn analysis result of Cytoscape plugins CytoHabba and MCODE", "rows": [["Names", "Total", "Elements"], ["CytoHubba and MCODE", "6", "ADCY8, ADRB2, CALCA, GCG, GNGT1, NPSR1"], ["CytoHubba", "14", "ADCY8, ADRB1, ADRB2, CALCA, CALCRL, GCG, CGA, GNGT1, NPSR1, RAMP2, RAMP3, RXFP1, RXFP2, VIPR1"], ["MCODE", "10", "ADCY8, ADRB2, ALB, CALCA, F2, GCG, GNGT1, INS, NPSR1, SST"]], "row_count": 4, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[20]/table-wrap[1]#T4"}}, {"id": "asset:table:pmid:34017995:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f7ca0937d568a0a6ee66e273fe06ca889d2003a77e184bedffa97e64d3213596", "bytes": 13026, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#T5", "version": null, "note": "The Venn analysis result of GSE118370, GSE136043, and GSE140797 datasets in GEO database", "structure": {"pmcid": "PMC8182989", "section_index": 21, "section_title": "The verification results of GEO database", "row_count": 5, "column_count": 3}, "table": {"label": "Table 5", "caption": "The Venn analysis result of GSE118370, GSE136043, and GSE140797 datasets in GEO database", "rows": [["Names", "Total", "Elements"], ["GSE118370, GSE136043, GSE140797", "77", "ABCC3, ACADL, ADCY8, ADH1B, ADRB2, AGER, AGR2, ANKRD29, AOC3, AQP4, ARHGAP6, ASPA, BTNL9, CALCA, CAV1, CCDC85A, CD24, CD36, CDO1, CLDN18, CLIC5, COL10A1, COL13A1, COL6A6, CP, DACH1, DPP6, EMCN, EMP2, FLJ34503, FMO2, FOXF1, FRMD3, GCG, GJB2, GNGT1, GPC3, GPM6A, GRK5, HHIP, IGSF10, ITGA8, KANK3, KIAA1462, LAMA3, LDB2, LOC400568, MFAP4, MYOC, MYZAP, NPSR1, NTNG1, PDE5A, PKHD1L1, RASIP1, RBP2, ROBO4, RTKN2, SCN7A, SEMA5A, SGCG, SGPP2, SIX1, SLIT2, SPINK1, SPOCK2, SSTR1, SVEP1, TBX3, TCF21, TEK, TMEM100, TMPRSS4, TNXB, TTN, VGLL3, WFDC2"], ["GSE118370", "407", "ABCA6, ABCA9, ABCC3, ABI3BP, ACADL, ACE, ACSS3, ACTN2, ACVRL1, ADAMTS17, ADAMTS7, ADARB1, ADCY8, ADGRL2, ADGRL3, ADH1B, ADRA1A, ADRB2, AFAP1-AS1, AFAP1L1, AGAP11, AGER, AGR2, AKAP12, AKAP2, ALX1, AMER2, ANGPT1, ANKRD29, ANXA8L1, AOC3, APOL3, AQP3, AQP4, ARHGAP29, ARHGAP6, ARHGEF15, ARHGEF26, ARHGEF33, ART4, ASPA, AXIN2, B3GALT5-AS1, B4GALNT3, BAALC, BCL6B, BEX1, BICDL1, BLACAT1, BMP1, BTNL9, C10orf25, C10orf91, C12orf74, C19orf84, C1orf53, CA2, CADM3-AS1, CALCA, CALCRL, CASP12, CAV1, CCBE1, CCDC68, CCDC85A, CCM2L, CD24, CD300LG, CD36, CD93, CDH5, CDO1, CDT1, CEACAM6, CEACAM7, CHRNA4, CLDN18, CLEC1A, CLIC5, CLIC6, CNTLN, COL10A1, COL13A1, COL4A6, COL6A6, CORO6, CP, CYTH4, CYYR1, DACH1, DMRTC1B, DPP6, DSCC1, DST, DUOX1, ECSCR, EDNRB, EFCC1, EMCN, EML1, EMP2, EPAS1, EPB41L2, EPT1, ERG, ERICH4, EYA4, FABP4, FAM107A, FAM124B, FAM135B, FAM65A, FAM83A, FAM83H, FAT3, FBXO40, FCN3, FENDRR, FGD5, FGFR4, FHL1, FHL5, FLI1, FLJ34503, FMO2, FOXF1, FPR1, FRMD3, GALNT13, GBP4, GCG, GDF15, GHR, GIMAP1, GIMAP8, GJB2, GNGT1, GNLY, GPC3, GPM6A, GPR182, GPX3, GRIA1, GRK5, GRM8, GSTM5, GUCY1A2, GYG2, GZMB, HABP2, HBA2, HBB, HCN3, HEG1, HHIP, HIF3A, HMGCLL1, HOXA10-HOXA9, HSPB6, HSPC324, IGHA2, IGHV4-31, IGK, IGKC, IGLJ3, IGSF10, IL18RAP, IL1RL1, IL23A, IL7R, ILDR1, INSC, IQGAP3, ITGA8, JAM2, KANK3, KCNB1, KCNK3, KCNT2, KCTD16, KIAA0087, KIAA1462, KIAA1614, KIF18B, KIF26B, KL, KLF13, KLF15, KLF4, KLRC3, KLRD1, KLRF1, KRT6A, LAMA3, LAMA4, LAPTM4B, LCAL1, LCNL1, LDB2, LDHAL6A, LEPROT, LIMK1, LIN7A, LINC00052, LINC00312, LINC00472, LINC00643, LINC00842, LINC00845, LINC00961, LINC00968, LINC01021, LINC01123, LINC01545, LOC100506725, LOC100507487, LOC100996760, LOC101927699, LOC101928161, LOC101928307, LOC101928417, LOC101929398, LOC101929486, LOC101930541, LOC102725051, LOC105379426, LOC285147, LOC400568, LOC400794, LTBP4, LYVE1, MACF1, MAOB, MAPRE2, MBD5, MCEMP1, MCOLN3, MEIS1, MESDC1, MFAP4, MGST1, MIR1204, MME, MMP1, MMP7, MRAP, MSMB, MTO1, MUC3, MUC3B, MYCT1, MYOC, MYZAP, NAALAD2, NAV2-IT1, NDRG2, NDRG4, NECAB2, NECTIN4, NEGR1, NEK2, NFASC, NOTCH4, NOVA2, NPR1, NPSR1, NQO1, NR5A2, NRG3, NTNG1, NTNG2, NTRK2, OR5E1P, OR5P2, OR5P3, OR6W1P, P2RY1, PAPOLB, PCAT19, PCDH15, PDE5A, PDE8B, PDGFB, PDK4, PDLIM3, PECAM1, PGR, PIR-FIGF, PKHD1L1, PPBP, PPP1R14A, PRF1, PRKCB, PROM2, PRPH, PRX, PTPRB, PTPRS, QKI, RAMP3, RASEF, RASIP1, RBP2, RGCC, RHOJ, RNF152, ROBO4, RTKN2, RXFP1, RYR2, S100B, S1PR1, S1PR5, SCARA5, SCN10A, SCN7A, SCNN1A, SDPR, SEC14L1, SEMA3G, SEMA5A, SEMA6D, SERPIND1, SFTPC, SGCG, SGPP2, SH2D3C, SH3GL3, SHANK3, SHROOM4, SIX1, SLC14A1, SLC19A3, SLC5A9, SLC6A4, SLCO2A1, SLIT2, SLIT3, SMAD6, SMAD9, SMPDL3B, SOX17, SOX7, SPDEF, SPINK1, SPOCK2, SPTBN1, SRCIN1, SSTR1, STARD13, STARD13-AS, STX11, STXBP6, SULT1C4, SUSD4, SV2C, SVEP1, SYCP2L, SYN2, TAS1R1, TBX2, TBX3, TBX4, TCEAL2, TCF21, TEK, TFAP2A, TGFBR3, TIE1, TIMP3, TMC2, TMEM100, TMEM246, TMEM252, TMEM45B, TMEM47, TMEM74, TMEM74B, TMEM75, TMIE, TMPRSS4, TMTC1, TNNC1, TNR, TNXB, TOX3, TRDV3, TRHDE, TRHDE-AS1, TRIM58, TRPA1, TRPC6, TTC16, TTLL7, TTN, URB1, VGLL3, VIPR1, VWF, WFDC2, WISP2, WNT7B, ZNF366, ZNF471, ZNF662, ZNF677, ZPLD1"], ["GSE136043", "554", "AATK, ABCA12, ABCB1, ABCC3, ABLIM3, ACADL, ACAN, ACAP3, ADAM8, ADAMTS14, ADAMTS16, ADAMTS8, ADAMTSL3, ADCY8, ADH1A, ADH1B, ADM2, ADORA3, ADRA1D, ADRB2, AGER, AGR2, AGTR1, AHNAK, AKNA, AKR1B10, ANKFN1, ANKRD18B, ANKRD20A2, ANKRD20A5P, ANKRD20A9P, ANKRD22, ANKRD29, ANXA10, ANXA3, AOC3, AOX1, APEH, APLN, AQP4, AQP6, ARHGAP6, ARHGEF16, ARHGEF19, ARHGEF26, ASPA, ASPHD1, ASS1, ATL2, ATP10B, B3GAT1, B3GNT3, BAI3, BCAS1, BCL6B, BDNF, BIK, BPIFA1, BPIFB1, BTNL8, BTNL9, C10orf116, C10orf140, C10orf67, C10orf81, C12orf39, C1orf81, C1QTNF4, C1QTNF7, C20orf202, C2CD4A, C4orf49, C6orf174, C6orf222, C8B, C9orf125, C9orf129, C9orf140, CA4, CADM3, CALCA, CAMK1D, CAMK2N1, CAPN13, CAPN8, CASP12, CASR, CAV1, CAV2, CAV3, CCDC129, CCDC48, CCDC85A, CCK, CCL20, CCL24, CCNO, CCRL1, CD180, CD24, CD36, CD79A, CDCA7, CDH13, CDH3, CDO1, CEACAM1, CEACAM3, CEACAM5, CEACAM6, CEACAM7, CES1, CFD, CHAC1, CHRDL1, CHRM1, CKMT1A, CLDN18, CLDN4, CLEC1B, CLEC3B, CLIC5, CLIC6, CNOT3, CNTN6, CNTNAP3, COL10A1, COL13A1, COL17A1, COL24A1, COL6A6, COMP, COPG2IT1, COX2, CP, CPB2, CPNE4, CPNE5, CPNE7, CST6, CT45A5, CXCL13, CXCL14, CYP1B1, CYP27B1, DACH1, DCDC2, DEFA3, DEFA4, DEPTOR, DERL3, DFNB31, DLX5, DMRT2, DNASE1L3, DPEP3, DPP6, DPT, DSP, E2F8, ECEL1P2, EDN3, EFNB3, EHF, ELF3, ELFN2, ELMOD1, EMCN, EMP2, EPHA10, EPN3, ERN2, ERV18-1, FAM105A, FAM150B, FAM155B, FAM162B, FAM189A2, FAM84A, FBLIM1, FBN3, FCGBP, FER1L4, FERMT2, FGD5, FGF12, FGF2, FGL1, FHL2, FIBIN, FIGF, FLJ13744, FLJ30901, FLJ34503, FLJ44635, FMO2, FOXF1, FOXF2, FRAS1, FRMD3, FRMD5, FUT1, FUT3, FUT8, FZD10, GAPDH, GCG, GDF10, GHR, GJB2, GJC2, GKN2, GMDS, GNG11, GNGT1, GOLGA7B, GOLM1, GPA33, GPC3, GPC5, GPIHBP1, GPM6A, GPR110, GPR158, GPR160, GPR4, GPT2, GREM1, GRIA1, GRIP1, GRK5, GRRP1, GSTA2, GSTA5, HAMP, HAS1, HCN4, HDGF, HES7, HHIP, HIGD1B, HMGB3, HNRNPH1, HOXA4, HOXA5, HS3ST1, HS6ST2, HSH2D, HSPA12B, IER3, IFITM1, IGFBP2, IGSF10, IGSF9, IHH, IL16, IL20RA, INHBB, INMT, ISYNA1, ITGA8, ITLN1, ITLN2, IYD, JAKMIP2, KAL1, KANK3, KANK4, KCNA4, KCNK12, KDELR3, KHDRBS2, KIAA1217, KIAA1324, KIAA1462, L1TD1, LAD1, LAMA3, LCN2, LDB2, LEMD1, LEPR, LGALS4, LGR4, LIN7A, LINC00163, LINC00472, LINGO1, LMF1, LOC100127983, LOC100128905, LOC100129463, LOC100130428, LOC100130899, LOC100131094, LOC100133669, LOC100192426, LOC100505933, LOC100507055, LOC158376, LOC283392, LOC284080, LOC338653, LOC388906, LOC389023, LOC389033, LOC389332, LOC400550, LOC400568, LOC553137, LOC572558, LOC643650, LOC643988, LOC645431, LOC646324, LOC646513, LOC729860, LOC731424, LOC91948, LPHN2, LPL, LRP4, LRRC15, LRRC19, LRRC31, LRRN3, LRRN4CL, LRRTM4, LTF, LUZP2, LYG2, LYPD5, MAGED4B, MAL, MAMDC2, MAMDC4, MANEAL, MAP7D2, MAPK4, MARCO, MDK, MEF2D, MESP1, MESP2, MFAP4, MFSD6L, MGAT3, MGC20647, MIOX, MME, MMP11, MMP12, MNX1, MOGAT1, MPP6, MS4A15, MSR1, MUC4, MX2, MYH2, MYOC, MYOM2, MYZAP, NCKAP5, NDNF, NDRG4, NECAB1, NGEF, NHS, NOS1AP, NOS2, NOV, NPSR1, NR5A2, NRG1, NTNG1, OCIAD2, ODAM, OR5L2, OTX1, OVOL1, P2RY1, PAX9, PCA3, PCDH9, PCM1, PCOLCE2, PDE1C, PDE5A, PDE6A, PEAR1, PHLDA2, PIN1P1, PIP5K1B, PITPNM2, PITX1, PITX2, PKHD1L1, PKIB, PKNOX2, PLAC9, PLEKHH2, PLIN5, PNMA6C, POPDC3, POU3F2, PPARGC1A, PPDPF, PPP1R17, PRKG2, PROM1, PROS1, PRSS50, PSAPL1, PSAT1, PTN, PTPRD, PTPRZ1, PVRL4, PYCR1, QRFPR, RAB26, RADIL, RAG1, RALGPS2, RAMP1, RANBP3L, RAPH1, RASIP1, RBP2, RECK, REEP6, RET, RETN, RGS17, RGS9BP, RHBDL2, RN28S1, RNASE13, RNF122, RNF182, ROBO4, RPL28, RSPO1, RSPO2, RTKN2, RUNDC3B, RUNX1, S100A3, S100B, SAA1, SAA2, SAA4, SALL4, SBK1, SCD5, SCEL, SCN3B, SCN4B, SCN7A, SEMA3B, SEMA3D, SEMA3E, SEMA5A, SERTM1, SGCG, SGPP2, SH2D1B, SH3GL2, SH3GL3, SIDT1, SIX1, SIX4, SLC15A1, SLC16A12, SLC19A3, SLC1A1, SLC1A7, SLC22A18, SLC22A18AS, SLC2A5, SLC39A8, SLC44A4, SLC46A2, SLC7A5, SLC8A2, SLCO4C1, SLIT2, SMOX, SNCB, SOSTDC1, SOX2, SOX7, SPINK1, SPOCK2, SPP1, SPRYD7, SPTBN1, SPTBN2, SRRM4, SSTR1, ST6GALNAC1, ST6GALNAC5, STEAP3, STRA6, STXBP6, SUN1, SUSD4, SVEP1, SYNM, SYNPO2L, SYT12, TAL1, TBX3, TBX4, TCEA2, TCF21, TEK, TFF3, TGM1, TINAGL1, TMEM100, TMEM132C, TMEM139, TMEM238, TMEM63A, TMEM63C, TMPRSS4, TNNC1, TNXB, TOX3, TSPAN1, TTC39A, TTI2, TTN, TUSC1, UACA, UNC5CL, USHBP1, VEGFA, VGLL3, VPREB3, VSTM2L, VTCN1, VWF, WFDC2, WIF1, WNK2, WNT3A, ZBED2, ZNF331, ZNF365, ZNF534, ZNF626"], ["GSE140797", "641", "ABCA12, ABCA4, ABCA6, ABCA8, ABCB4, ABCC3, ABLIM3, ACACB, ACADL, ACOXL, ACTG2, ACVRL1, ADAMDEC1, ADAMTS14, ADAMTS8, ADARB1, ADCY8, ADH1A, ADH1B, ADM2, ADRB1, ADRB2, AGER, AGR2, AGTR1, AIM2, AK4, AKNAD1, AKR1B10, AKR1B15, ANGPT1, ANGPTL1, ANGPTL7, ANKRD20A2, ANKRD20A9P, ANKRD29, ANKRD30BP2, ANKRD34B, ANLN, ANXA8L2, AOC3, APOE, AQP4, ARAP3, ARHGAP29, ARHGAP6, ARHGEF16, ARHGEF4, ASPA, ASPM, ATP10B, ATP1A2, AURKAPS1, B3GNT3, BAALC, BCHE, BEX1, BIRC5, BMPER, BMPR2, BNIP2, BPIFA1, BRIP1, BTNL3, BTNL9, BUB1, C10orf116, C10orf67, C10orf81, C11orf88, C12orf39, C14orf132, C15orf48, C18orf56, C1orf173, C1orf194, C1orf81, C20orf160, C2orf40, C4orf7, C5orf4, C6orf174, C6orf222, C6orf225, C8B, C9orf125, C9orf85, CA4, CABYR, CACNA2D2, CADM1, CALCA, CALCRL, CAMK2N1, CAMP, CASQ2, CAV1, CAV2, CAV3, CBFA2T3, CCDC129, CCDC147, CCDC48, CCDC68, CCDC85A, CCL14, CCL19, CCL23, CCL7, CCNB2, CCNE1, CCNO, CD24, CD36, CDC45, CDCA2, CDCA3, CDCA5, CDCA7, CDH13, CDH19, CDHR4, CDKN2A, CDKN3, CDO1, CDT1, CEACAM3, CEACAM5, CENPA, CENPF, CENPM, CEP55, CFD, CGNL1, CHI3L1, CHIA, CHRDL1, CHRM1, CILP, CIT, CKM, CLDN18, CLDN3, CLEC1B, CLEC3B, CLIC5, CNTNAP2, COL10A1, COL13A1, COL17A1, COL1A1, COL28A1, COL3A1, COL4A3, COL6A6, COMP, COPG2IT1, COX7A1, CP, CPB2, CR2, CRABP2, CRTAC1, CTHRC1, CTLA4, CX3CR1, CXCL10, CXCL13, CXCL14, CXCL9, CXCR5, CXorf41, CXorf61, CYP3A5, CYP4B1, CYS1, CYYR1, DACH1, DACT2, DCDC2B, DES, DFNB31, DIXDC1, DLGAP5, DLX5, DMRT2, DMRTA2, DNAH12, DNASE1L3, DPP6, DUOX1, DUSP10, E2F8, ECEL1P2, ECSCR, EDN2, EDNRB, EEF1A2, EFCAB1, EGFL7, ELF3, EMCN, EMP2, ENPP3, EPAS1, EPHA10, ERCC6L, ERN2, ESCO2, ETS2, ETV1, EXO1, EZH2, F11, FABP4, FAM105A, FAM107A, FAM13C, FAM150B, FAM162B, FAM167A, FAM189A2, FAM3D, FANCA, FAP, FBLIM1, FCN3, FCRL4, FCRL5, FER1L4, FEZ1, FGF2, FHL1, FIBIN, FIGF, FLJ13744, FLJ30901, FLJ34503, FMO2, FOXF1, FRMD3, FRMD5, FRY, FUT3, FZD4, GAD1, GALNTL4, GAPDH, GCG, GDA, GDF10, GDF15, GENE_SYMBOL, GFOD1, GIMAP8, GINS1, GJB2, GJC2, GKN2, GLDN, GNAZ, GNG11, GNGT1, GOLGA7B, GPC3, GPER, GPIHBP1, GPM6A, GPM6B, GPR110, GPR133, GPRIN2, GPX3, GRASP, GREM1, GRK5, GRRP1, GSDMC, GUCY1B2, HAMP, HBA2, HBB, HBD, HBG1, HCAR3, HECW2, HEG1, HHIP, HIGD1B, HIST1H2AI, HJURP, HLF, HMGA2, HMGB3, HORMAD1, HPGD, HRASLS2, HS6ST2, HSD17B6, HSPA12B, HSPB2, IGF2BP3, IGFBP1, IGFBP3, IGFL2, IGLL1, IGLL5, IGSF10, IGSF9, IL18R1, IL1RL1, IL2RA, IL4I1, IL7R, INHBB, INMT, IRX1, IRX2, ITGA10, ITGA8, ITLN1, ITLN2, JAM2, JPH4, KAL1, KANK3, KANK4, KCNB1, KCNN4, KDELR2, KHDRBS2, KIAA0408, KIAA1324L, KIAA1462, KIF18A, KIF23, KISS1R, KLRD1, KRT14, KRT15, KRT17, KRT23, KRT8, KRT80, KRT8P12, L1TD1, LAD1, LAMA3, LAMP3, LCN2, LDB2, LEMD1, LEPR, LGALS4, LGI2, LGSN, LHFP, LIFR, LILRB4, LIMCH1, LIMS2, LINC00261, LINC00312, LINGO1, LOC100127983, LOC100129940, LOC100131395, LOC254896, LOC283392, LOC284080, LOC284276, LOC389023, LOC400550, LOC400568, LOC400891, LOC643037, LOC645431, LOC729860, LPL, LRRC10B, LRRC36, LRRK2, LRRN3, LTF, LY6K, LYPD1, LYVE1, MAGEA6, MAMDC2, MAOA, MAP3K15, MAPK4, MARCO, MATN3, MDK, MELK, MEX3A, MFAP4, MGAT3, MIOX, MIR205HG, MLF1IP, MMP1, MMP11, MMP12, MMP13, MMP7, MMP9, MMRN1, MND1, MNX1, MOGAT1, MS4A15, MSRB3, MUC16, MUC21, MUC4, MYH10, MYH11, MYH2, MYOC, MYOM2, MYZAP, MZB1, NCKAP5, NDC80, NECAB1, NEDD4L, NEIL3, NEK2, NEXN, NMNAT2, NOSTRIN, NOTCH4, NOTUM, NPNT, NPR3, NPSR1, NPY1R, NTNG1, NTRK3, NUF2, NUSAP1, NXPH4, OCA2, ODZ2, OGN, PABPC1L, PADI1, PAQR5, PAX9, PBK, PCDH7, PCOLCE2, PCSK9, PDE1C, PDE5A, PDE8B, PDK4, PDZD2, PDZRN4, PEBP4, PECAM1, PHLDA2, PI16, PIK3R1, PITX1, PITX2, PKHD1L1, PLA2G1B, PLAC9, PLAU, PLCXD3, PLEKHH2, POU2AF1, PP14571, PPP1R3C, PRKCE, PRSS22, PSCA, PTCH1, PTGFR, PTPN21, PTPRB, PTPRM, PTPRQ, PVRL4, PYCR1, RAB26, RAD54L, RADIL, RALGPS2, RASIP1, RBP2, RECK, RECQL4, REG1A, RETN, RGS1, RHBDL2, RNF182, RNFT2, ROBO4, RP11-165H20.1, RSPO2, RTKN2, RUNX1, RXFP1, S100A2, S100P, S1PR1, SALL4, SCARA5, SCN1A, SCN4B, SCN7A, SDPR, SEC14L3, SEC14L4, SELENBP1, SEMA3E, SEMA3G, SEMA5A, SEPP1, SFN, SFTPD, SGCA, SGCG, SGPP2, SH2D3C, SHANK3, SIX1, SIX4, SLC14A1, SLC16A12, SLC17A9, SLC1A1, SLC2A1, SLC39A8, SLC5A8, SLC6A4, SLC7A11, SLCO2A1, SLIT2, SLIT3, SLITRK3, SMAD6, SMAD9, SNX1, SNX22, SOSTDC1, SPAG5, SPARCL1, SPINK1, SPOCK2, SPOCK3, SPP1, SPRYD7, SSTR1, ST6GALNAC1, STAC, STARD9, STEAP1, STIL, STRA6, STX1A, STYK1, SULF1, SULT1C2, SUSD2, SVEP1, SYCP3, SYN2, SYNE1, SYNM, SYNPO2, SYNPO2L, SYT12, TAL1, TBC1D3B, TBC1D3G, TBX2, TBX3, TCAM1P, TCF21, TCN1, TDO2, TDRD1, TEK, TEKT5, THBD, THBS2, THSD4, THY1, TIMP1, TIMP3, TK1, TMEM100, TMEM45B, TMEM47, TMEM63C, TMPRSS4, TMSB15A, TNS4, TNXB, TOP2A, TPPP, TSPAN12, TTK, TTN, TUBB1, TUBB2B, TUBB3, TWIST1, TYMS, UBD, UBE2C, UBE2T, UCK2, UHRF1, VAPA, VEPH1, VGF, VGLL3, VIL1, VIPR1, VMP1, VSTM2L, WDR16, WDR17, WFDC2, WIF1, WISP2, WNT3A, XAGE1A, XDH, ZBED2, ZNF300P1, ZNF385B, ZWINT, ZYG11A"]], "row_count": 5, "column_count": 3, "numeric_cells": 12, "header_rows": 1, "locator": "section[21]/table-wrap[1]#T5"}}, {"id": "asset:table:pmid:34017995:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0997e170b1b42bea4568bb0f5d6b7cb8704bce4f12a0996902f2259a5da1946f", "bytes": 3150, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[2]#T6", "version": null, "note": "GO analysis and KEGG pathway analysis of 77 common DEGs in 3 GEO datasets", "structure": {"pmcid": "PMC8182989", "section_index": 21, "section_title": "The verification results of GEO database", "row_count": 46, "column_count": 5}, "table": {"label": "Table 6", "caption": "GO analysis and KEGG pathway analysis of 77 common DEGs in 3 GEO datasets", "rows": [["Category", "GO ID", "Term", "Count", "P value"], ["BP", "GO:0007155", "Cell adhesion", "12", "2.86E-06"], ["BP", "GO:0030198", "Extracellular matrix organization", "6", "0.001"], ["BP", "GO:0001525", "Angiogenesis", "6", "0.002"], ["BP", "GO:0007267", "Cell–cell signaling", "6", "0.004"], ["BP", "GO:0016337", "Single organismal cell–cell adhesion", "5", "8.34E-04"], ["BP", "GO:0001570", "Vasculogenesis", "4", "0.002"], ["BP", "GO:0001666", "Response to hypoxia", "4", "0.035"], ["BP", "GO:0001763", "Morphogenesis of a branching structure", "3", "4.72E-04"], ["BP", "GO:0001958", "Endochondral ossification", "3", "0.005"], ["BP", "GO:0007188", "Adenylate cyclase-modulating G-protein coupled receptor signaling pathway", "3", "0.010"], ["BP", "GO:0010811", "Positive regulation of cell–substrate adhesion", "3", "0.011"], ["BP", "GO:0001657", "Ureteric bud development", "3", "0.011"], ["BP", "GO:0007190", "Activation of adenylate cyclase activity", "3", "0.012"], ["BP", "GO:0001658", "Branching involved in ureteric bud morphogenesis", "3", "0.013"], ["BP", "GO:0031623", "Receptor internalization", "3", "0.014"], ["BP", "GO:0007189", "Adenylate cyclase-activating G-protein coupled receptor signaling pathway", "3", "0.018"], ["BP", "GO:0008104", "Protein localization", "3", "0.027"], ["BP", "GO:0030574", "Collagen catabolic process", "3", "0.029"], ["BP", "GO:0043627", "Response to estrogen", "3", "0.030"], ["BP", "GO:0030334", "Regulation of cell migration", "3", "0.038"], ["BP", "GO:0051897", "Positive regulation of protein kinase B signaling", "3", "0.048"], ["BP", "GO:0045986", "Negative regulation of smooth muscle contraction", "2", "0.017"], ["BP", "GO:0070836", "Caveola assembly", "2", "0.021"], ["BP", "GO:0043549", "Regulation of kinase activity", "2", "0.021"], ["BP", "GO:0060426", "Lung vasculature development", "2", "0.025"], ["BP", "GO:0048251", "Elastic fiber assembly", "2", "0.029"], ["BP", "GO:0002024", "Diet-induced thermogenesis", "2", "0.037"], ["BP", "GO:0030857", "Negative regulation of epithelial cell differentiation", "2", "0.045"], ["BP", "GO:0045779", "Negative regulation of bone resorption", "2", "0.049"], ["BP", "GO:0001944", "Vasculature development", "2", "0.049"], ["CC", "GO:0005886", "Plasma membrane", "28", "0.0029"], ["CC", "GO:0005576", "Extracellular region", "17", "3.80E-04"], ["CC", "GO:0005615", "Extracellular space", "12", "0.015"], ["CC", "GO:0005887", "Integral component of plasma membrane", "11", "0.047"], ["CC", "GO:0009986", "Cell surface", "8", "0.005"], ["CC", "GO:0005578", "Proteinaceous extracellular matrix", "7", "6.16E-04"], ["CC", "GO:0045121", "Membrane raft", "5", "0.009"], ["CC", "GO:0005581", "Collagen trimer", "4", "0.006"], ["CC", "GO:0005667", "Transcription factor complex", "4", "0.040"], ["CC", "GO:0045177", "Apical part of cell", "3", "0.035"], ["MF", "GO:0008201", "Heparin binding", "4", "0.024"], ["KEGG", "hsa04151", "PI3K-Akt signaling pathway", "6", "0.044"], ["KEGG", "hsa04512", "ECM–receptor interaction", "5", "0.001"], ["KEGG", "hsa04510", "Focal adhesion", "5", "0.028"], ["KEGG", "hsa05414", "Dilated cardiomyopathy", "4", "0.012"]], "row_count": 46, "column_count": 5, "numeric_cells": 135, "header_rows": 1, "locator": "section[21]/table-wrap[2]#T6"}}, {"id": "asset:table:pmid:34017995:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:78aea2f619fd47301803e349e4ed9c3e4c1b3f1a81858d91ece76a58f006d286", "bytes": 1565, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[27]/table-wrap[1]#T7", "version": null, "note": "The clinicopathologic features of LUAD patients in TCGA database", "structure": {"pmcid": "PMC8182989", "section_index": 27, "section_title": "Relationship between the 6 hub genes and clinical features in LUAD patients", "row_count": 14, "column_count": 15}, "table": {"label": "Table 7", "caption": "The clinicopathologic features of LUAD patients in TCGA database", "rows": [["Clinical characteristics", "Subgroup", "Total (N)", "Expression of ADCY8", "Expression of ADRB2", "Expression of CALCA", "Expression of GCG", "Expression of GNGT1", "Expression of NPSR1"], ["", "", "", "Low", "High", "Low", "High", "Low", "High", "Low", "High", "Low", "High", "Low", "High"], ["Age", "≤65", "233", "172", "61", "119", "114", "119", "114", "102", "131", "117", "116", "173", "60"], ["", ">65", "237", "162", "75", "115", "122", "115", "122", "132", "105", "117", "120", "161", "76"], ["Gender", "male", "223", "102", "121", "126", "97", "105", "118", "121", "102", "111", "112", "108", "115"], ["", "female", "266", "141", "125", "118", "148", "265", "1", "122", "144", "132", "134", "135", "131"], ["Primary tumor", "T1-2", "426", "185", "241", "181", "245", "228", "198", "222", "204", "221", "205", "227", "199"], ["", "T3-4", "60", "41", "19", "50", "10", "24", "36", "30", "30", "21", "39", "20", "40"], ["Nodal metastasis", "N0", "317", "152", "165", "141", "176", "223", "94", "180", "157", "186", "121", "177", "140"], ["", "N1-3", "158", "89", "69", "96", "62", "44", "114", "37", "121", "51", "107", "60", "98"], ["Distant metastasis", "M0", "333", "144", "189", "135", "198", "193", "140", "188", "145", "173", "160", "184", "149"], ["", "M1", "24", "19", "5", "20", "4", "6", "18", "7", "17", "9", "15", "11", "13"], ["Stage", "I-II", "378", "177", "201", "163", "215", "208", "170", "201", "177", "197", "181", "204", "174"], ["", "III-IV", "103", "63", "40", "76", "27", "42", "61", "39", "64", "43", "60", "36", "67"]], "row_count": 14, "column_count": 15, "numeric_cells": 161, "header_rows": 2, "locator": "section[27]/table-wrap[1]#T7"}}, {"id": "asset:table:pmid:34017995:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3287c0634185b1b87739352463407557564937e4eb7eea9e0a8686089ca6ce20", "bytes": 1132, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[27]/table-wrap[2]#T8", "version": null, "note": "Correlation between 6 hub genes expression and the clinicopathologic features of LUAD patients", "structure": {"pmcid": "PMC8182989", "section_index": 27, "section_title": "Relationship between the 6 hub genes and clinical features in LUAD patients", "row_count": 7, "column_count": 8}, "table": {"label": "Table 8", "caption": "Correlation between 6 hub genes expression and the clinicopathologic features of LUAD patients", "rows": [["Clinical characteristics", "Total (N)", "OR in ADCY8 expression", "P value", "OR in ADRB2 expression", "P value", "OR in CALCA expression", "P value"], ["Age (≥65 vs. <65)", "470", "1.31 (0.87–1.95)", "0.191", "1.11 (0.77–1.59)", "0.580", "1.11 (0.77–1.59)", "0.580"], ["Gender (male vs. female)", "489", "0.75 (0.52–1.07)", "0.109", "1.63 (1.14–2.33)", "0.007", "0.01 (0.00–0.02)", "0.000"], ["Primary tumor (T1-2 vs. T3-4)", "486", "0.36 (0.20–0.63)", "0.000", "0.15 (0.07–0.30)", "0.000", "1.73 (1.00–3.00)", "0.054"], ["Nodal metastasis (N0 vs. N1-3)", "475", "0.71 (0.49–1.05)", "0.098", "0.52 (0.35–0.76)", "0.001", "6.15 (4.03–9.38)", "0.000"], ["Distant metastasis (M0 vs. M1)", "357", "0.20 (0.07–0.55)", "0.001", "0.14 (0.05–0.41)", "0.000", "4.14 (1.60–10.69)", "0.002"], ["Stage (I-II vs. III-VI)", "481", "0.56 (0.36–0.87)", "0.011", "0.27 (0.17–0.44)", "0.000", "1.78 (1.14–2.77)", "0.011"]], "row_count": 7, "column_count": 8, "numeric_cells": 45, "header_rows": 1, "locator": "section[27]/table-wrap[2]#T8"}}], "gaps": ["asset:data:geo:GSE118370 not downloaded", "asset:data:geo:GSE118370 licence not read", "asset:data:geo:GSE136043 not downloaded", "asset:data:geo:GSE136043 licence not read", "asset:data:geo:GSE140797 not downloaded", "asset:data:geo:GSE140797 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "edger", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14]."}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "PPI"}}, {"id": "method-4", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.8, "band": "high", "quote": "ROC curve"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: edger."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE118370", "GSE136043", "GSE140797"], "resolved_accessions": ["GSE118370", "GSE136043", "GSE140797"], "statements": ["High-throughput gene expression data of LUAD and normal lung tissues were extracted from the TCGA Data Portal (https://tcga-data.nci.nih.gov/tcga). These RNA-seq data (HTSeq-count) from Illumina HiSeq RNASeq platform consisted of 502 LUAD samples and 49 adjacent non-cancerous lung tissues, and were achieved from the publicly available Genomic Data Commons (GDC) data portal (https://portal.gdc.cancer.gov/). In addition, gene expression profiles of datasets GSE118370, GSE136043, and GSE140797 were obtained from GEO."], "basis": "The paper names GSE118370, GSE136043, GSE140797 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34017995", "data:geo:GSE118370", "asset:table:pmid:34017995:1", "asset:table:pmid:34017995:2", "asset:table:pmid:34017995:3", "asset:table:pmid:34017995:4", "asset:table:pmid:34017995:5", "asset:table:pmid:34017995:6", "asset:table:pmid:34017995:7", "asset:table:pmid:34017995:8"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE118370"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:30:14Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 39324, "completion_tokens": 2252, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34017995", "type": "paper", "label": "pmid:34017995"}, {"id": "source:pmid:34017995", "type": "manuscript", "label": "PMID 34017995 full text"}, {"id": "data:geo:GSE118370", "type": "dataset", "label": "GEO GSE118370"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34017995", "type": "paper", "label": "pmid:34017995"}, {"id": "source:pmid:34017995", "type": "manuscript", "label": "PMID 34017995 full text"}, {"id": "data:geo:GSE118370", "type": "dataset", "label": "GEO GSE118370"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34017995", "type": "extraction", "used": ["source:pmid:34017995"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE118370", "type": "accession_resolution", "used": ["data:geo:GSE118370"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34017995", "parent_hash": "sha256:75253f3543859bd3f2dde2ec69fc50aefebb8e424065cba762f521e1860ebf1a", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE118370 licence not read", "asset:data:geo:GSE118370 not downloaded", "asset:data:geo:GSE136043 licence not read", "asset:data:geo:GSE136043 not downloaded", "asset:data:geo:GSE140797 licence not read", "asset:data:geo:GSE140797 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Differential expression analysis of individual genes was carried out by edgeR Bioconductor package [14]."], "order_basis": "analysis_only", "id": "assay:1"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:12:35+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}