{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34218797", "kind": "science-record", "revision": 8, "content_hash": "sha256:c5e03d5706e921ed08ca150b099cb010c705c45505cdf0245aa2bb41a9edd626", "created_at": "2026-11-01T15:41:41Z", "updated_at": "2026-11-01T22:47:00Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of candidate biomarkers and therapeutic agents for heart failure by bioinformatics analysis.", "doi": "10.1186/s12872-021-02146-8", "pmid": "34218797", "authors": ["Vijayakrishna Kolur", "Basavaraj Vastrad", "Chanabasayya Vastrad", "Shivakumar Kotturshetti", "Anandkumar Tengli"], "journal": "BMC cardiovascular disorders", "year": 2021, "abstract": "INTRODUCTION: Heart failure (HF) is a heterogeneous clinical syndrome and affects millions of people all over the world. HF occurs when the cardiac overload and injury, which is a worldwide complaint. The aim of this study was to screen and verify hub genes involved in developmental HF as well as to explore active drug molecules.\nMETHODS: The expression profiling by high throughput sequencing of GSE141910 dataset was downloaded from the Gene Expression Omnibus (GEO) database, which contained 366 samples, including 200 heart failure samples and 166 non heart failure samples. The raw data was integrated to find differentially expressed genes (DEGs) and were further analyzed with bioinformatics analysis. Gene ontology (GO) and REACTOME enrichment analyses were performed via ToppGene; protein-protein interaction (PPI) networks of the DEGs was constructed based on data from the HiPPIE interactome database; modules analysis was performed; target gene-miRNA regulatory network and target gene-TF regulatory network were constructed and analyzed; hub genes were validated; molecular docking studies was performed.\nRESULTS: A total of 881 DEGs, including 442 up regulated genes and 439 down regulated genes were observed. Most of the DEGs were significantly enriched in biological adhesion, extracellular matrix, signaling receptor binding, secretion, intrinsic component of plasma membrane, signaling receptor activity, extracellular matrix organization and neutrophil degranulation. The top hub genes ESR1, PYHIN1, PPP2R2B, LCK, TP63, PCLAF, CFTR, TK1, ECT2 and FKBP5 were identified from the PPI network. Module analysis revealed that HF was associated with adaptive immune system and neutrophil degranulation. The target genes, miRNAs and TFs were identified from the target gene-miRNA regulatory network and target gene-TF regulatory network. Furthermore, receiver operating characteristic (ROC) curve analysis and RT-PCR analysis revealed that ESR1, PYHIN1, PPP2R2B, LCK, TP63, PCLAF, CFTR, TK1, ECT2 and FKBP5 might serve as prognostic, diagnostic biomarkers and therapeutic target for HF. The predicted targets of these active molecules were then confirmed.\nCONCLUSION: The current investigation identified a series of key genes and pathways that might be involved in the progression of HF, providing a new understanding of the underlying molecular mechanisms of HF.", "claims": [{"id": "claim-method", "statement": "DEGs of dataset GSE141910 between HF groups and non heart failure groups were respectively analyzed using the limma package in R [21].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34218797", "locator": "sections[4] \"Identification of DEGs in HF\" paragraph 2", "quote": "DEGs of dataset GSE141910 between HF groups and non heart failure groups were respectively analyzed using the limma package in R [21]."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34218797"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34218797", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12872-021-02146-8", "sha256": "sha256:eb8184a8e33ad721f7e081c5dd5f18e4146e484293f23173dac9eb0cf61a7758", "bytes": 58982, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12872-021-02146-8", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8256614", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:34218797:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fc6e85b6cad727bfd46ed9fd450f44efba00a2b712c35d01a273dfc99f819d90", "bytes": 7015, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab2", "version": null, "note": "The enriched GO terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8256614", "section_index": 5, "section_title": "Functional enrichment analysis", "row_count": 15, "column_count": 9}, "table": {"label": "Table 2", "caption": "The enriched GO terms of the up and down regulated differentially expressed genes", "rows": [["GO ID", "CATEGORY", "GO Name", "P Value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["GO:0022610", "BP", "biological adhesion", "1.32E−13", "3.37E−10", "3.08E−09", "6.75E−10", "72", "HLA-DQA1, DACT2, CD83, MDK, UBASH3A, ITGBL1, FAP, MFAP4, SERPINE2, NRXN2, COL14A1, CCR7, ALOX15, COL1A1, LAMB4, COL8A2, STAB2, COL16A1, COMP, TBX21, FERMT1, XG, CCDC80, APOA1, PODXL2, ZAP70, HAPLN1, TENM4, SKAP1, CNTNAP2, PDE5A, CARD11, CTNNA2, SLAMF7, ATP1B2, CX3CR1, LRRC15, IDO1, MYOC, SIGLEC8, ISLR, SMOC2, ITGAL, ITGB7, FREM1, PTN, KIRREL3, NTM, GLI2, FBLN7, DPT, NT5E, ECM2, LCK, OMG, OPCML, TGFB2, RASGRP1, CD2, CD3E, THBS4, CD5, CD6, THY1, TIGIT, CD27, CD40LG, ROBO2, GREM1, LY9, HBB, LEF1"], ["GO:0002682", "BP", "regulation of immune system process", "2.20E−10", "2.25E−07", "2.05E−06", "1.12E−06", "72", "IL34, HLA-DQA1, ESR1, TLR7, CD83, IL17D, MDK, UBASH3A, TNFRSF4, PYHIN1, ZBP1, FCER1A, MS4A2, FCER2, FCN1, CCR7, SMPD3, CCL24, SCARA3, ALOX15, COL1A1, IL31RA, TBX21, XG, CXCL14, APOA1, ZAP70, SH2D1B, SKAP1, PDE5A, CARD11, SLAMF7, CTSG, CX3CR1, IDO1, CXCL10, ITGAL, ACE, SIT1, ITGB7, PTN, TBC1D10C, FCRL3, BPI, GLI2, KLRB1, NPPA, CAMK4, LCK, TGFB2, RASGRP1, CD1C, CD1E, CD2, CD3D, CD3E, THBS4, CD3G, CD247, CD5, CD6, THY1, TIGIT, MS4A1, CD27, GPR68, CD40LG, CD48, GREM1, SH2D1A, LEF1, LRRC17"], ["GO:0031012", "CC", "extracellular matrix", "1.09E−20", "2.77E−18", "1.89E−17", "5.54E−18", "52", "MATN2, COL22A1, MDK, COLQ, MFAP4, SERPINE2, HMCN2, AEBP1, FCN1, CMA1, CTHRC1, COL14A1, SCARA3, COL1A1, LAMB4, COL8A2, COL9A1, COL9A2, COL10A1, MXRA5, FMOD, COL16A1, COMP, CCDC80, APOA1, HAPLN1, CTSG, ADAMTSL2, LRRC15, ASPN, MYOC, NDP, SMOC2, FREM1, PTN, SSC5D, SULF1, DPT, NPPA, ADAMTSL1, ECM2, OGN, ITIH5, TGFB2, LEFTY2, EYS, THBS4, P3H2, LTBP2, GREM1, LUM, LRRC17"], ["GO:0009986", "CC", "cell surface", "5.07E−17", "8.61E−15", "5.86E−14", "2.58E−14", "63", "HYAL4, NRG1, HLA-DQA1, CD83, TNFRSF4, ITGBL1, FAP, SERPINE2, FCER1A, MS4A2, FCER2, FCN1, CXCL9, CCR7, IL31RA, SFRP4, STAB2, DUOX2, APOA1, ACKR4, FCRL6, SCUBE2, CNTNAP2, SLAMF7, CTSG, IL2RB, CX3CR1, LRRC15, CXCL10, NDP, ITGAL, ACE, ITGB7, GFRA3, PTN, PROM1, SSC5D, FCRL3, SULF1, MRC2, NTM, CLEC9A, NT5E, TGFB2, LHCGR, CD1C, HHIP, CD1E, CD2, CD3D, CD3E, CD3G, CD5, CD6, THY1, TIGIT, MS4A1, CD27, CD40LG, CD48, ROBO2, GREM1, LY9"], ["GO:0005102", "MF", "signaling receptor binding", "1.36E−09", "5.99E−07", "4.41E−06", "1.20E−06", "73", "IL34, NRG1, HLA-DQA1, ESR1, GDF6, PENK, TAC4, KDM5D, IL17D, MDK, ITGBL1, FAP, SERPINE2, FCER2, NRXN2, FCN1, CLEC11A, UCHL1, AGTR2, CXCL9, NGEF, CTHRC1, C1QTNF2, CCL22, CCL24, CXCL11, COL16A1, COMP, WNT10B, WNT9A, CXCL14, APOA1, FCRL6, GNA14, OASL, RASL11B, LRRC15, CXCL10, ADAM18, MYOC, SYTL2, NDP, ACE, GDNF, ITGB7, GFRA3, PTN, LYPD1, SCG2, NPPA, NPPB, MCHR1, ECM2, CMTM2, ESM1, LCK, OGN, TGFB2, LEFTY2, CD2, CD3E, THBS4, CD3G, THY1, TIGIT, MS4A1, C1QTNF9, CD40LG, LTB, GREM1, SYTL1, LEF1, LGI1"], ["GO:0098772", "MF", "molecular function regulator", "3.79E−04", "1.59E−02", "1.17E−01", "3.34E−01", "58", "IL34, NRG1, ESR1, GDF6, PENK, TAC4, IL17D, MDK, KCNIP1, SERPINE2, MYOZ1, NRXN2, CLEC11A, SCN2B, AGTR2, CXCL9, NGEF, CCL22, CCL24, CXCL11, HTR2B, PI16, SCG5, WNT10B, WNT9A, CXCL14, APOA1, LRRC55, PPP2R2B, ATP1B2, CXCL10, NDP, BIRC7, GDNF, PTN, TBC1D10C, LYPD1, SCG2, NPPA, NPPB, AZIN2, CMTM2, OGN, RGS4, ITIH5, TGFB2, LEFTY2, RASGRP1, THBS4, THY1, CD27, C1QTNF9, CD40LG, RGS17, LTB, GREM1, LEF1, INKA1"], ["Down regulated genes"], ["GO:0046903", "BP", "secretion", "1.07E−11", "5.64E−08", "5.16E−07", "5.64E−08", "78", "SERPINA3, HK3, SYN3, ACP3, TRPC4, CFTR, CD109, HMOX2, CHI3L1, F5, F8, F13A1, S100A8, S100A9, SAA1, FCER1G, MGST1, PIK3C2A, HP, AGTR1, PLA2G2A, CCR1, FGF10, C1QTNF1, PLA2G4F, FGR, MERTK, SERPINF2, ALOX5, SYT13, IL17RB, CNR1, ALOX15B, FLT3, ANPEP, P2RY12, ANXA3, FPR1, CR1, SLC1A1, SLC2A1, ARG1, ARNTL, SLC11A1, SLC22A16, LGI3, NSG1, ATP2A2, IL10, SIGLEC9, GPR84, NHLRC2, SSTR5, HPSE, KCNB1, IL1R2, PTX3, GLUL, SYN2, BANK1, WNK3, KNG1, CRISPLD2, CACNA1E, CD177, SIGLEC14, EDN1, EDN2, EDNRB, THBS1, RNASE2, CD38, TLR2, SERPINE1, ELANE, STEAP3, IL1RL1, MCEMP1"], ["GO:0006952", "BP", "defense response", "1.04E−06", "1.63E−04", "1.49E−03", "5.50E−03", "65", "SERPINA3, EREG, VSIG4, TMIGD3, CLEC7A, RAET1E, CHI3L1, F8, CD163, S100A8, S100A9, SAA1, FCER1G, HP, HPR, AGTR1, PLA2G2A, CCR1, FGR, SERPINF2, ALOX5, ALOX5AP, IL17RB, CNR1, SELE, ADAMTS4, ANXA3, FPR1, APOB, SAMHD1, CR1, FCN3, AQP4, ARG1, SLC11A1, MARCO, IL10, BCL6, IL18R1, GGT5, IL1R2, PTX3, SIGLEC10, KNG1, CACNA1E, CD177, SOCS3, SIGLEC14, ADAMTS5, LBP, S1PR3, EDN1, EDNRB, FOSL1, THBS1, RNASE2, NAMPT, TLR2, SERPINE1, ELANE, IRAK3, ELF3, IL1RL1, CALCRL, OSMR"], ["GO:0031226", "CC", "intrinsic component of plasma membrane", "1.74E−10", "4.55E−08", "3.11E−07", "9.10E−08", "74", "TPO, EREG, OPN4, TRPC4, CFTR, TMIGD3, KCNIP2, CD163, FCER1G, SCN3A, AGTR1, CCR1, C1QTNF1, MERTK, SYT13, IL17RB, CNR1, TRHDE, SELE, LRRC8E, FLT3, SLC4A7, P2RY12, SLC31A2, CR1, LGR5, AQP3, AQP4, SLC1A1, SLC2A1, SLC5A1, MSR1, SLC11A1, SIGLEC7, ART3, SLCO2A1, ATP2A2, MARCO, GABRR2, SIGLEC9, SLCO4A1, GPR84, SSTR2, SSTR5, IL18R1, LAPTM5, GGT5, SLC52A3, LYVE1, KCNA7, KCNB1, KCND3, NECTIN1, KCNK1, KCNK3, KCNS2, ADGRD1, CACNA1E, GPR4, GPR12, SLC38A4, GPR183, GPRC5A, RGR, S1PR3, RHAG, EDNRB, TGFBR3, TLR2, LGR6, CALCRL, OSMR, HAS2, CDH16"], ["GO:0098805", "CC", "whole membrane", "1.91E−03", "4.99E−02", "3.41E−01", "9.97E−01", "51", "EREG, SYN3, ACP3, TRPC4, CFTR, CD109, HMOX2, CD163, FCER1G, MGST1, PLA2G4F, GPAT2, MOG, CNR1, SELE, ANPEP, P2RY12, ANXA3, FPR1, APOB, SCGN, CR1, AQP4, SLC1A1, SLC2A1, ARG1, MSR1, SLC11A1, NSG1, RAB39A, MARCO, SIGLEC9, GPR84, HPSE, LAPTM5, KCND3, SYN2, SLC9A7, WASF1, CD177, SIGLEC14, GRB14, STEAP4, EDNRB, GRIP1, CD38, TLR2, STEAP3, HAS2, SERPINA5, MCEMP1"], ["GO:0038023", "MF", "signaling receptor activity", "2.36E−04", "1.97E−02", "1.49E−01", "2.53E−01", "55", "EREG, OPN4, CLEC7A, FCER1G, FCGR3A, AGTR1, CCR1, ADGRF5, ADGRF4, MERTK, IL17RB, CNR1, SELE, FLT3, MYOT, ANPEP, P2RY12, ANXA3, FPR1, CR1, LGR5, SIGLEC7, MARCO, PALLD, IL10, GABRR2, IL15RA, GPR82, DNER, PAQR5, GPR84, IL20RA, SSTR2, SSTR5, IL18R1, LYVE1, IL1R2, NECTIN1, ADGRD1, GPR4, GPR12, NPTX2, GPR183, GPRC5A, PKHD1L1, RGR, S1PR3, EDNRB, TGFBR3, TLR2, SERPINE1, IL1RL1, LGR6, CALCRL, OSMR"], ["GO:0060089", "MF", "molecular transducer activity", "4.71E−04", "2.10E−02", "1.59E−01", "5.04E−01", "58", "EREG, OPN4, CLEC7A, FCER1G, FCGR3A, AGTR1, CCR1, ADGRF5, ADGRF4, MERTK, IL17RB, CNR1, SELE, FLT3, MYOT, ANPEP, P2RY12, ANXA3, FPR1, CR1, LGR5, SIGLEC7, MARCO, PALLD, IL10, GABRR2, IL15RA, GPR82, DNER, PAQR5, GPR84, IL20RA, STOX1, SSTR2, SSTR5, IL18R1, BLM, CDKL5, LYVE1, IL1R2, NECTIN1, ADGRD1, GPR4, GPR12, NPTX2, GPR183, GPRC5A, PKHD1L1, RGR, S1PR3, EDNRB, TGFBR3, TLR2, SERPINE1, IL1RL1, LGR6, CALCRL, OSMR"]], "row_count": 15, "column_count": 9, "numeric_cells": 84, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:34218797:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:91dd15a29c48fafce4f82db7422df3ec793ebc8e8f2c7f61de90d6638775df68", "bytes": 3889, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#Tab3", "version": null, "note": "The enriched pathway terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8256614", "section_index": 5, "section_title": "Functional enrichment analysis", "row_count": 17, "column_count": 8}, "table": {"label": "Table 3", "caption": "The enriched pathway terms of the up and down regulated differentially expressed genes", "rows": [["Pathway ID", "Pathway name", "P-value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene count", "Gene"], ["Up regulated genes"], ["1270244", "Extracellular matrix organization", "3.33E−08", "1.80E−05", "1.23E−04", "1.80E−05", "24", "COL22A1, MFAP4, CMA1, COL14A1, COL1A1, COL8A2, COL9A1, COL9A2, COL10A1, FMOD, COL16A1, COMP, HAPLN1, ADAMTS14, CTSG, ASPN, ITGAL, ITGB7, CAPN6, TGFB2, P3H2, TLL2, LTBP2, LUM"], ["1269201", "Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell", "8.13E−06", "7.31E−04", "5.03E−03", "4.39E−03", "13", "SH2D1B, SLAMF7, SIGLEC8, ITGAL, ITGB7, KLRB1, CD1C, CD3D, CD3E, CD3G, CD247, CD40LG, SH2D1A"], ["1269544", "GPCR ligand binding", "3.92E−04", "1.51E−02", "1.04E−01", "2.12E−01", "22", "GNG8, PENK, F2RL2, AGTR2, APLNR, CXCL9, CCR7, CXCL11, OXER1, HTR2A, HTR2B, WNT10B, WNT9A, ACKR4, CRHBP, S1PR5, FZD2, CX3CR1, CXCL10, MCHR1, LHCGR, GPR68"], ["1268749", "Metabolism of Angiotensinogen to Angiotensins", "5.26E−04", "1.85E−02", "1.27E−01", "2.84E−01", "4", "CMA1, CTSG, ACE, GZMH"], ["1269868", "Muscle contraction", "3.44E−02", "4.03E−01", "1.00E+00", "1.00E+00", "9", "KCNIP1, RYR3, SCN2B, ATP1A4, ATP1B2, MYL1, KCNK17, NPPA, TNNI1"], ["1269340", "Hemostasis", "6.57E−02", "5.21E−01", "1.00E+00", "1.00E+00", "20", "GNG8, CEACAM3, F2RL2, SERPINE2, APOA1, GNA14, PDE5A, ATP1B2, IL2RB, CTSW, ISLR, ITGAL, LCK, TGFB2, LEFTY2, RASGRP1, CD2, P2RX6, CD48, HBB"], ["1269171", "Adaptive Immune System", "1.32E−01", "6.87E−01", "1.00E+00", "1.00E+00", "23", "NRG1, HLA-DQA1, ZAP70, SH2D1B, CARD11, SLAMF7, SIGLEC8, ITGAL, ITGB7, ASB18, IER3, MRC2, KLRB1, LCK, RASGRP1, CD1C, CD3D, CD3E, CD3G, CD247, FBXL16, CD40LG, SH2D1A"], ["Down regulated genes"], ["1457780", "Neutrophil degranulation", "4.82E−06", "3.14E−03", "2.22E−02", "3.14E−03", "28", "SERPINA3, HK3, ACP3, HMOX2, CHI3L1, S100A8, S100A9, FCER1G, MGST1, HP, FGR, ALOX5, ANPEP, FPR1, CR1, ARG1, SLC11A1, SIGLEC9, GPR84, HPSE, PTX3, CRISPLD2, CD177, SIGLEC14, RNASE2, TLR2, ELANE, MCEMP1"], ["1269907", "SLC-mediated transmembrane transport", "6.91E−04", "4.74E−02", "3.35E−01", "4.51E−01", "16", "HK3, SLC7A11, SLC4A7, SLC1A1, SLC2A1, SLC5A1, SLC11A1, SLC22A16, SLCO2A1, SLCO4A1, GCKR, LCN15, SLC9A7, SLC25A18, SLC38A4, RHAG"], ["1269545", "Class A/1 (Rhodopsin-like receptors)", "8.72E−04", "4.74E−02", "3.35E−01", "5.69E−01", "17", "OPN4, SAA1, AGTR1, CCR1, CNR1, P2RY12, FPR1, SSTR2, SSTR5, KNG1, GPR4, GPR183, RGR, S1PR3, EDN1, EDN2, EDNRB"], ["1269340", "Hemostasis", "2.18E−03", "7.11E−02", "5.02E−01", "1.00E+00", "26", "SERPINA3, CD109, SLC7A11, F5, F8, F13A1, SERPINB8, FCER1G, FGR, MERTK, SERPINF2, SELE, P2RY12, APOB, KIF18B, ATP2A2, NHLRC2, KNG1, PDE11A, CD177, DOCK9, GRB7, GRB14, THBS1, SERPINE1, SERPINA5"], ["1269903", "Transmembranetransport of small molecules", "4.89E−03", "1.28E−01", "9.01E−01", "1.00E+00", "26", "HK3, TRPC4, CFTR, HMOX2, SLC7A11, ABCB1, SLC4A7, AQP3, AQP4, SLC1A1, SLC2A1, SLC5A1, SLC11A1, SLC22A16, SLCO2A1, ATP2A2, GABRR2, SLCO4A1, GCKR, LCN15, SLC9A7, WNK3, SLC25A18, SLC38A4, RHAG, STEAP3"], ["1269203", "Innate Immune System", "9.62E−03", "1.96E−01", "1.00E+00", "1.00E+00", "42", "SERPINA3, EREG, HK3, MARK3, ACP3, CLEC7A, HMOX2, CHI3L1, S100A8, S100A9, SAA1, FCER1G, MGST1, FCGR3A, HP, GRAP2, PLA2G2A, FGF5, FGF10, FGR, ALOX5, ANPEP, FPR1, APOB, CR1, FCN3, ARG1, SLC11A1, SIGLEC9, GPR84, HPSE, PTX3, WASF1, CRISPLD2, CD177, SIGLEC14, LBP, RNASE2, TLR2, ELANE, IRAK3, MCEMP1"], ["1269310", "Cytokine Signaling in Immune system", "8.42E−02", "4.76E−01", "1.00E+00", "1.00E+00", "23", "EREG, MARK3, F13A1, SAA1, FGF5, CCR1, FGF10, ALOX5, IL17RB, FLT3, FPR1, SAMHD1, IL10, IL15RA, IL20RA, BCL6, IL18R1, IL1R2, SOCS3, LBP, IRAK3, IL1RL1, OSMR"]], "row_count": 17, "column_count": 8, "numeric_cells": 98, "header_rows": 1, "locator": "section[14]/table-wrap[2]#Tab3"}}, {"id": "asset:table:pmid:34218797:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d40d246e9267cdecbb667151bf6fc24dd1163f94c5e35a99f6a9287292c2dc92", "bytes": 2113, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#Tab5", "version": null, "note": "miRNA—target gene and TF—target gene interaction", "structure": {"pmcid": "PMC8256614", "section_index": 7, "section_title": "Target gene—miRNA regulatory network construction", "row_count": 30, "column_count": 8}, "table": {"label": "Table 5", "caption": "miRNA—target gene and TF—target gene interaction", "rows": [["Regulation", "Target Genes", "Degree", "MicroRNA", "Regulation", "Target Genes", "Degree", "TF"], ["Up", "FSCN1", "99", "hsa-mir-4533", "Up", "FSCN1", "62", "ESRRA"], ["Up", "ESR1", "72", "hsa-mir-548ac", "Up", "APOA1", "48", "RERE"], ["Up", "TMEM30B", "64", "hsa-mir-548i", "Up", "COL1A1", "21", "HMG20B"], ["Up", "SCN2B", "46", "hsa-mir-5585-3p", "Up", "HBB", "16", "THRAP3"], ["Up", "CENPA", "35", "hsa-mir-6750-3p", "Up", "LCK", "15", "ATF1"], ["Up", "APOA1", "22", "hsa-mir-6722-5p", "Up", "FOXS1", "14", "YBX1"], ["Up", "PPP2R2B", "14", "hsa-mir-149-3p", "Up", "CENPA", "10", "SAP30"], ["Up", "TP63", "12", "hsa-mir-1178-3p", "Up", "SCN2B", "5", "RCOR2"], ["Up", "PYHIN1", "5", "hsa-mir-205-3p", "Up", "TMEM30B", "5", "ZNF24"], ["Up", "APLNR", "2", "hsa-mir-10b-5p", "Up", "APLNR", "4", "FOXJ2"], ["Up", "PTN", "1", "hsa-mir-155-5p", "Up", "NRG1", "2", "SUZ12"], ["Up", "LCK", "1", "hsa-mir-335-5p", "Up", "PTN", "2", "L3MBTL2"], ["Up", "CD247", "1", "hsa-mir-346", "Up", "UCHL1", "2", "MAZ"], ["Down", "FKBP5", "88", "hsa-mir-200c-3p", "Up", "ESR1", "1", "EZH2"], ["Down", "PCLAF", "62", "hsa-mir-1273g-3p", "Up", "ZAP70", "1", "ZFX"], ["Down", "CEP55", "57", "hsa-mir-1244", "Down", "SOCS3", "48", "MXD3"], ["Down", "ATP2A2", "55", "hsa-mir-4789-3p", "Down", "BCL6", "44", "ARID4B"], ["Down", "TK1", "45", "hsa-mir-766-3p", "Down", "FKBP5", "43", "CBFB"], ["Down", "ZBTB16", "43", "hsa-mir-1976", "Down", "ANLN", "38", "TAF7"], ["Down", "SAMHD1", "26", "hsa-mir-3124-3p", "Down", "ATP2A2", "35", "CREM"], ["Down", "TOP2A", "17", "hsa-mir-186-5p", "Down", "CBS", "31", "IKZF1"], ["Down", "BCL6", "13", "hsa-mir-339-5p", "Down", "BLM", "19", "ZNF501"], ["Down", "ECT2", "13", "hsa-mir-132-3p", "Down", "ECT2", "15", "KLF16"], ["Down", "CFTR", "9", "hsa-mir-145-5p", "Down", "CEP55", "10", "FOSL2"], ["Down", "S100A9", "7", "hsa-mir-4679", "Down", "GRAP2", "10", "CEBPD"], ["Down", "AGTR1", "5", "hsa-mir-410-3p", "Down", "ZBTB16", "4", "TRIM28"], ["Down", "ANLN", "5", "hsa-mir-503-5p", "Down", "S100A8", "3", "STAT3"], ["Down", "BLM", "3", "hsa-mir-193b-3p", "Down", "S100A9", "2", "CEBPG"], ["", "", "", "", "Down", "AGTR1", "1", "EZH2"]], "row_count": 30, "column_count": 8, "numeric_cells": 104, "header_rows": 1, "locator": "section[16]/table-wrap[1]#Tab5"}}, {"id": "asset:table:pmid:34218797:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:848c0dbc1a78a523ff7254e102bab3b7e2a0a579d69f16124916986e39bc2598", "bytes": 806, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#Tab1", "version": null, "note": "The sequences of primers for quantitative RT-PCR", "structure": {"pmcid": "PMC8256614", "section_index": 10, "section_title": "RT-PCR analysis", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of primers for quantitative RT-PCR", "rows": [["Genes", "Forward primers", "Reverse primers"], ["ESR1", "CCTCTGGCTACCATTATGGG", "AGTCATTGTGTCCTTGAATGC"], ["PYHIN1", "GCAAGATCAGTACGACAGAG", "AGATAACTGAGCAACCTGTG"], ["PPP2R2B", "ACCAGAGACTATCTGACCG", "GTAGTCATGAACCTGGTATGTC"], ["LCK", "CTAGTCCGGCTTTATGCAG", "AAATCTACTAGGCTCCCGT"], ["TP63", "ATTCAATGAGGGACAGATTGC", "GGGTCTTCTACATACTGGGC"], ["PCLAF", "GACCAATATAAACTGTGGCGGG", "CCAGGGTAAACAAGGAGACGTT"], ["CFTR", "CTGTGGCCTTGGTTTACTG", "CTCTGATCTCTGTACTTCACCA"], ["TK1", "AGATTCAGGTGATTCTCGGG", "ACTTGTACTGGGCGATCTG"], ["ECT2", "GCTGTATTGTACGAGTATGCT", "GTCACCAATTTGACAAGCTC"], ["FKBP5", "CCTAAGTTTGGCATTGACCC", "CCAAGATTCTTTGGCCTTCTC"]], "row_count": 11, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[10]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:34218797:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:039e3c101909fdc467734aa90b6724fe12ab39ff52eed20c608fec81eb075919", "bytes": 5846, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#Tab6", "version": null, "note": "Docking results of Designed Molecules on Over Expressed Proteins", "structure": {"pmcid": "PMC8256614", "section_index": 11, "section_title": "Identification of candidate small molecules", "row_count": 38, "column_count": 16}, "table": {"label": "Table 6", "caption": "Docking results of Designed Molecules on Over Expressed Proteins", "rows": [["Sl. No/Code", "Over expressed gene: ESR1", "Over expressed gene: LCK", "Over expressed gene: PPP2R2B", "Over expressed gene: PYHIN 1", "Over expressed gene: TP63"], ["PDB: 4PXM", "PDB:1KSW", "PDB: 2HV7", "PDB: 3VD8", "PDB: 6RU6"], ["Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar"], ["HIM1", "5.097", "− 4.375", "0.114", "4.258", "− 1.555", "1.784", "4.904", "− 0.870", "0.004", "5.794", "− 0.514", "3.828", "5.770", "− 1.440", "2.231"], ["HIM2", "4.057", "− 6.172", "0.039", "4.624", "− 0.997", "1.959", "4.906", "− 0.468", "1.517", "5.052", "− 0.780", "3.415", "5.414", "− 1.529", "2.444"], ["HIM3", "5.353", "− 5.309", "0.161", "4.578", "− 1.492", "1.790", "5.042", "− 1.845", "1.073", "5.680", "− 0.804", "3.956", "5.350", "− 1.170", "2.316"], ["HIM4", "3.976", "− 5.132", "0.167", "3.839", "− 1.635", "1.196", "6.328", "− 1.172", "1.128", "4.966", "− 0.666", "1.818", "5.627", "− 1.416", "2.320"], ["HIM5", "2.707", "− 7.759", "0.179", "4.067", "− 0.997", "1.987", "5.254", "− 0.674", "1.618", "4.563", "− 1.068", "2.935", "5.698", "− 1.240", "2.485"], ["HIM6", "5.948", "− 3.902", "1.796", "5.229", "− 0.707", "3.656", "6.766", "− 1.424", "1.858", "6.670", "− 0.941", "5.519", "6.218", "− 1.468", "2.578"], ["HIM7", "5.019", "− 7.055", "0.203", "4.382", "− 2.443", "3.329", "6.028", "− 0.629", "1.660", "5.374", "− 1.876", "0.670", "6.627", "− 1.484", "2.579"], ["HIM8", "4.429", "− 3.983", "0.344", "4.150", "− 4.382", "4.210", "6.794", "− 1.279", "1.129", "5.468", "− 0.769", "3.444", "5.842", "− 2.088", "2.272"], ["HIM9", "3.722", "− 5.956", "0.197", "4.051", "− 2.006", "0.002", "6.116", "− 0.597", "1.717", "5.407", "− 0.565", "1.370", "5.877", "− 2.054", "0.792"], ["HIM10", "6.771", "− 3.977", "1.836", "5.176", "− 3.512", "4.023", "5.332", "− 1.378", "3.349", "6.071", "− 0.923", "3.854", "5.825", "− 0.966", "3.672"], ["HIM11", "3.775", "− 6.079", "0.898", "6.998", "− 2.086", "3.842", "8.678", "− 1.065", "2.876", "5.087", "− 0.881", "1.854", "5.948", "− 1.015", "1.202"], ["HIM12", "0.190", "− 8.149", "0.022", "5.302", "− 2.305", "3.475", "5.227", "− 1.636", "0.710", "7.322", "− 1.128", "4.099", "6.237", "− 2.562", "2.171"], ["HIM13", "4.523", "− 4.537", "0.014", "4.840", "− 0.664", "3.305", "6.181", "− 2.966", "3.523", "5.281", "− 0.503", "3.981", "5.905", "− 1.136", "2.218"], ["HIM14", "5.247", "− 3.183", "0.000", "4.888", "− 1.296", "2.563", "5.037", "− 0.377", "1.647", "7.057", "− 0.799", "4.256", "6.116", "− 1.366", "2.438"], ["HIM15", "4.633", "− 4.173", "0.180", "3.756", "− 0.710", "2.072", "5.188", "− 1.559", "1.143", "5.570", "− 1.125", "3.718", "6.238", "− 1.708", "2.443"], ["HIM16", "4.588", "− 2.883", "0.000", "6.027", "− 1.099", "3.903", "5.606", "− 0.987", "4.197", "5.661", "− 0.926", "2.751", "7.263", "− 1.533", "4.212"], ["HIM17", "3.944", "− 4.806", "0.236", "5.329", "− 0.590", "2.798", "4.830", "− 1.682", "1.617", "6.234", "− 0.830", "3.912", "5.366", "− 1.257", "3.022"], ["HTZ1", "0.593", "− 7.518", "0", "4.221", "− 0.692", "1.975", "3.993", "− 0.539", "0.003", "5.284", "− 0.566", "1.432", "5.227", "− 1.045", "0.903"], ["HTZ2", "− 1.770", "− 8.477", "0.000", "4.055", "− 1.438", "2.877", "4.388", "− 1.665", "1.170", "4.100", "− 0.546", "3.017", "4.563", "− 0.976", "1.266"], ["HTZ3", "4.649", "− 5.870", "0.148", "5.104", "− 0.861", "3.922", "4.243", "− 1.539", "1.933", "5.304", "− 1.370", "1.398", "5.138", "− 1.217", "1.930"], ["HTZ4", "− 3.169", "− 12.002", "0.482", "4.173", "− 1.898", "1.864", "4.654", "− 1.627", "1.128", "5.163", "− 0.745", "1.304", "5.084", "− 1.143", "1.018"], ["HTZ5", "4.021", "− 12.325", "0.246", "3.215", "− 1.481", "4.232", "3.256", "− 6.374", "2.317", "2.382", "− 5.263", "1.238", "4.623", "− 0.951", "1.280"], ["HTZ6", "6.605", "− 3.866", "1.6487", "4.004", "− 1.104", "2.851", "5.834", "− 1.310", "3.111", "5.286", "− 1.530", "1.436", "6.336", "− 2.326", "3.781"], ["HTZ7", "4.977", "− 5.434", "0.655", "5.197", "− 2.040", "3.250", "5.352", "− 1.371", "1.172", "6.138", "− 1.734", "1.627", "4.908", "− 1.057", "1.335"], ["HTZ8", "1.025", "− 8.223", "0.000", "3.549", "− 1.310", "2.403", "4.024", "− 3.825", "2.440", "4.980", "− 0.593", "1.474", "5.164", "− 1.291", "0.999"], ["HTZ9", "3.386", "− 7.041", "0.194", "5.567", "− 1.622", "3.057", "6.792", "− 2.581", "1.088", "5.794", "− 0.683", "1.774", "6.053", "− 1.408", "1.037"], ["HTZ10", "4.744", "− 5.463", "0.837", "4.520", "− 2.469", "3", "7.758", "− 1.518", "3.765", "5.345", "− 1.133", "3.661", "7.507", "− 2.080", "4.086"], ["HTZ11", "2.991", "− 6.177", "0", "3.453", "− 0.721", "1.266", "4.841", "− 1.738", "0.045", "4.368", "− 0.805", "1.074", "6.176", "− 1.380", "1.511"], ["HTZ12", "4.810", "− 6.157", "0.275", "5.296", "− 2.814", "3.605", "5.138", "− 1.840", "2.189", "5.083", "− 0.870", "1.536", "5.592", "− 1.321", "1.525"], ["HTZ13", "4.868", "− 3.837", "0", "4.863", "− 0.535", "2.405", "4.656", "− 0.681", "3.152", "4.246", "− 2.335", "0.529", "6.404", "− 0.975", "2.954"], ["HTZ14", "5.646", "− 3.473", "0", "4.948", "− 0.801", "2.324", "4.953", "− 1.672", "1.066", "5.058", "− 1.174", "1.121", "5.114", "− 1.299", "1.296"], ["HTZ15", "3.428", "− 4.957", "0.348", "3.949", "− 0.614", "1.873", "4.049", "− 0.787", "1.224", "4.796", "− 1.066", "1.489", "3.510", "− 0.607", "0.461"], ["HTZ16", "4.227", "− 4.787", "0.298", "4.654", "− 1.534", "2.096", "6.143", "− 1.204", "2.879", "4.854", "− 0.994", "1.564", "7.102", "− 0.917", "3.001"], ["HTZ17", "3.784", "− 5.018", "0.380", "3.661", "− 0.897", "1.676", "4.016", "− 1.179", "1.384", "4.039", "− 0.569", "2.706", "4.256", "− 1.040", "1.236"], ["HTZSTD", "4.722", "− 1.084", "1.063", "3.319", "− 0.890", "3.033", "3.564", "− 0.272", "2.367", "3.394", "− 0.882", "1.169", "4.237", "− 0.801", "1.855"]], "row_count": 38, "column_count": 16, "numeric_cells": 548, "header_rows": 3, "locator": "section[20]/table-wrap[1]#Tab6"}}, {"id": "asset:table:pmid:34218797:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fc6e85b6cad727bfd46ed9fd450f44efba00a2b712c35d01a273dfc99f819d90", "bytes": 7015, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab2", "version": null, "note": "The enriched GO terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8256614", "section_index": 14, "section_title": "Functional enrichment analysis", "row_count": 15, "column_count": 9}, "table": {"label": "Table 2", "caption": "The enriched GO terms of the up and down regulated differentially expressed genes", "rows": [["GO ID", "CATEGORY", "GO Name", "P Value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene Count", "Gene"], ["Up regulated genes"], ["GO:0022610", "BP", "biological adhesion", "1.32E−13", "3.37E−10", "3.08E−09", "6.75E−10", "72", "HLA-DQA1, DACT2, CD83, MDK, UBASH3A, ITGBL1, FAP, MFAP4, SERPINE2, NRXN2, COL14A1, CCR7, ALOX15, COL1A1, LAMB4, COL8A2, STAB2, COL16A1, COMP, TBX21, FERMT1, XG, CCDC80, APOA1, PODXL2, ZAP70, HAPLN1, TENM4, SKAP1, CNTNAP2, PDE5A, CARD11, CTNNA2, SLAMF7, ATP1B2, CX3CR1, LRRC15, IDO1, MYOC, SIGLEC8, ISLR, SMOC2, ITGAL, ITGB7, FREM1, PTN, KIRREL3, NTM, GLI2, FBLN7, DPT, NT5E, ECM2, LCK, OMG, OPCML, TGFB2, RASGRP1, CD2, CD3E, THBS4, CD5, CD6, THY1, TIGIT, CD27, CD40LG, ROBO2, GREM1, LY9, HBB, LEF1"], ["GO:0002682", "BP", "regulation of immune system process", "2.20E−10", "2.25E−07", "2.05E−06", "1.12E−06", "72", "IL34, HLA-DQA1, ESR1, TLR7, CD83, IL17D, MDK, UBASH3A, TNFRSF4, PYHIN1, ZBP1, FCER1A, MS4A2, FCER2, FCN1, CCR7, SMPD3, CCL24, SCARA3, ALOX15, COL1A1, IL31RA, TBX21, XG, CXCL14, APOA1, ZAP70, SH2D1B, SKAP1, PDE5A, CARD11, SLAMF7, CTSG, CX3CR1, IDO1, CXCL10, ITGAL, ACE, SIT1, ITGB7, PTN, TBC1D10C, FCRL3, BPI, GLI2, KLRB1, NPPA, CAMK4, LCK, TGFB2, RASGRP1, CD1C, CD1E, CD2, CD3D, CD3E, THBS4, CD3G, CD247, CD5, CD6, THY1, TIGIT, MS4A1, CD27, GPR68, CD40LG, CD48, GREM1, SH2D1A, LEF1, LRRC17"], ["GO:0031012", "CC", "extracellular matrix", "1.09E−20", "2.77E−18", "1.89E−17", "5.54E−18", "52", "MATN2, COL22A1, MDK, COLQ, MFAP4, SERPINE2, HMCN2, AEBP1, FCN1, CMA1, CTHRC1, COL14A1, SCARA3, COL1A1, LAMB4, COL8A2, COL9A1, COL9A2, COL10A1, MXRA5, FMOD, COL16A1, COMP, CCDC80, APOA1, HAPLN1, CTSG, ADAMTSL2, LRRC15, ASPN, MYOC, NDP, SMOC2, FREM1, PTN, SSC5D, SULF1, DPT, NPPA, ADAMTSL1, ECM2, OGN, ITIH5, TGFB2, LEFTY2, EYS, THBS4, P3H2, LTBP2, GREM1, LUM, LRRC17"], ["GO:0009986", "CC", "cell surface", "5.07E−17", "8.61E−15", "5.86E−14", "2.58E−14", "63", "HYAL4, NRG1, HLA-DQA1, CD83, TNFRSF4, ITGBL1, FAP, SERPINE2, FCER1A, MS4A2, FCER2, FCN1, CXCL9, CCR7, IL31RA, SFRP4, STAB2, DUOX2, APOA1, ACKR4, FCRL6, SCUBE2, CNTNAP2, SLAMF7, CTSG, IL2RB, CX3CR1, LRRC15, CXCL10, NDP, ITGAL, ACE, ITGB7, GFRA3, PTN, PROM1, SSC5D, FCRL3, SULF1, MRC2, NTM, CLEC9A, NT5E, TGFB2, LHCGR, CD1C, HHIP, CD1E, CD2, CD3D, CD3E, CD3G, CD5, CD6, THY1, TIGIT, MS4A1, CD27, CD40LG, CD48, ROBO2, GREM1, LY9"], ["GO:0005102", "MF", "signaling receptor binding", "1.36E−09", "5.99E−07", "4.41E−06", "1.20E−06", "73", "IL34, NRG1, HLA-DQA1, ESR1, GDF6, PENK, TAC4, KDM5D, IL17D, MDK, ITGBL1, FAP, SERPINE2, FCER2, NRXN2, FCN1, CLEC11A, UCHL1, AGTR2, CXCL9, NGEF, CTHRC1, C1QTNF2, CCL22, CCL24, CXCL11, COL16A1, COMP, WNT10B, WNT9A, CXCL14, APOA1, FCRL6, GNA14, OASL, RASL11B, LRRC15, CXCL10, ADAM18, MYOC, SYTL2, NDP, ACE, GDNF, ITGB7, GFRA3, PTN, LYPD1, SCG2, NPPA, NPPB, MCHR1, ECM2, CMTM2, ESM1, LCK, OGN, TGFB2, LEFTY2, CD2, CD3E, THBS4, CD3G, THY1, TIGIT, MS4A1, C1QTNF9, CD40LG, LTB, GREM1, SYTL1, LEF1, LGI1"], ["GO:0098772", "MF", "molecular function regulator", "3.79E−04", "1.59E−02", "1.17E−01", "3.34E−01", "58", "IL34, NRG1, ESR1, GDF6, PENK, TAC4, IL17D, MDK, KCNIP1, SERPINE2, MYOZ1, NRXN2, CLEC11A, SCN2B, AGTR2, CXCL9, NGEF, CCL22, CCL24, CXCL11, HTR2B, PI16, SCG5, WNT10B, WNT9A, CXCL14, APOA1, LRRC55, PPP2R2B, ATP1B2, CXCL10, NDP, BIRC7, GDNF, PTN, TBC1D10C, LYPD1, SCG2, NPPA, NPPB, AZIN2, CMTM2, OGN, RGS4, ITIH5, TGFB2, LEFTY2, RASGRP1, THBS4, THY1, CD27, C1QTNF9, CD40LG, RGS17, LTB, GREM1, LEF1, INKA1"], ["Down regulated genes"], ["GO:0046903", "BP", "secretion", "1.07E−11", "5.64E−08", "5.16E−07", "5.64E−08", "78", "SERPINA3, HK3, SYN3, ACP3, TRPC4, CFTR, CD109, HMOX2, CHI3L1, F5, F8, F13A1, S100A8, S100A9, SAA1, FCER1G, MGST1, PIK3C2A, HP, AGTR1, PLA2G2A, CCR1, FGF10, C1QTNF1, PLA2G4F, FGR, MERTK, SERPINF2, ALOX5, SYT13, IL17RB, CNR1, ALOX15B, FLT3, ANPEP, P2RY12, ANXA3, FPR1, CR1, SLC1A1, SLC2A1, ARG1, ARNTL, SLC11A1, SLC22A16, LGI3, NSG1, ATP2A2, IL10, SIGLEC9, GPR84, NHLRC2, SSTR5, HPSE, KCNB1, IL1R2, PTX3, GLUL, SYN2, BANK1, WNK3, KNG1, CRISPLD2, CACNA1E, CD177, SIGLEC14, EDN1, EDN2, EDNRB, THBS1, RNASE2, CD38, TLR2, SERPINE1, ELANE, STEAP3, IL1RL1, MCEMP1"], ["GO:0006952", "BP", "defense response", "1.04E−06", "1.63E−04", "1.49E−03", "5.50E−03", "65", "SERPINA3, EREG, VSIG4, TMIGD3, CLEC7A, RAET1E, CHI3L1, F8, CD163, S100A8, S100A9, SAA1, FCER1G, HP, HPR, AGTR1, PLA2G2A, CCR1, FGR, SERPINF2, ALOX5, ALOX5AP, IL17RB, CNR1, SELE, ADAMTS4, ANXA3, FPR1, APOB, SAMHD1, CR1, FCN3, AQP4, ARG1, SLC11A1, MARCO, IL10, BCL6, IL18R1, GGT5, IL1R2, PTX3, SIGLEC10, KNG1, CACNA1E, CD177, SOCS3, SIGLEC14, ADAMTS5, LBP, S1PR3, EDN1, EDNRB, FOSL1, THBS1, RNASE2, NAMPT, TLR2, SERPINE1, ELANE, IRAK3, ELF3, IL1RL1, CALCRL, OSMR"], ["GO:0031226", "CC", "intrinsic component of plasma membrane", "1.74E−10", "4.55E−08", "3.11E−07", "9.10E−08", "74", "TPO, EREG, OPN4, TRPC4, CFTR, TMIGD3, KCNIP2, CD163, FCER1G, SCN3A, AGTR1, CCR1, C1QTNF1, MERTK, SYT13, IL17RB, CNR1, TRHDE, SELE, LRRC8E, FLT3, SLC4A7, P2RY12, SLC31A2, CR1, LGR5, AQP3, AQP4, SLC1A1, SLC2A1, SLC5A1, MSR1, SLC11A1, SIGLEC7, ART3, SLCO2A1, ATP2A2, MARCO, GABRR2, SIGLEC9, SLCO4A1, GPR84, SSTR2, SSTR5, IL18R1, LAPTM5, GGT5, SLC52A3, LYVE1, KCNA7, KCNB1, KCND3, NECTIN1, KCNK1, KCNK3, KCNS2, ADGRD1, CACNA1E, GPR4, GPR12, SLC38A4, GPR183, GPRC5A, RGR, S1PR3, RHAG, EDNRB, TGFBR3, TLR2, LGR6, CALCRL, OSMR, HAS2, CDH16"], ["GO:0098805", "CC", "whole membrane", "1.91E−03", "4.99E−02", "3.41E−01", "9.97E−01", "51", "EREG, SYN3, ACP3, TRPC4, CFTR, CD109, HMOX2, CD163, FCER1G, MGST1, PLA2G4F, GPAT2, MOG, CNR1, SELE, ANPEP, P2RY12, ANXA3, FPR1, APOB, SCGN, CR1, AQP4, SLC1A1, SLC2A1, ARG1, MSR1, SLC11A1, NSG1, RAB39A, MARCO, SIGLEC9, GPR84, HPSE, LAPTM5, KCND3, SYN2, SLC9A7, WASF1, CD177, SIGLEC14, GRB14, STEAP4, EDNRB, GRIP1, CD38, TLR2, STEAP3, HAS2, SERPINA5, MCEMP1"], ["GO:0038023", "MF", "signaling receptor activity", "2.36E−04", "1.97E−02", "1.49E−01", "2.53E−01", "55", "EREG, OPN4, CLEC7A, FCER1G, FCGR3A, AGTR1, CCR1, ADGRF5, ADGRF4, MERTK, IL17RB, CNR1, SELE, FLT3, MYOT, ANPEP, P2RY12, ANXA3, FPR1, CR1, LGR5, SIGLEC7, MARCO, PALLD, IL10, GABRR2, IL15RA, GPR82, DNER, PAQR5, GPR84, IL20RA, SSTR2, SSTR5, IL18R1, LYVE1, IL1R2, NECTIN1, ADGRD1, GPR4, GPR12, NPTX2, GPR183, GPRC5A, PKHD1L1, RGR, S1PR3, EDNRB, TGFBR3, TLR2, SERPINE1, IL1RL1, LGR6, CALCRL, OSMR"], ["GO:0060089", "MF", "molecular transducer activity", "4.71E−04", "2.10E−02", "1.59E−01", "5.04E−01", "58", "EREG, OPN4, CLEC7A, FCER1G, FCGR3A, AGTR1, CCR1, ADGRF5, ADGRF4, MERTK, IL17RB, CNR1, SELE, FLT3, MYOT, ANPEP, P2RY12, ANXA3, FPR1, CR1, LGR5, SIGLEC7, MARCO, PALLD, IL10, GABRR2, IL15RA, GPR82, DNER, PAQR5, GPR84, IL20RA, STOX1, SSTR2, SSTR5, IL18R1, BLM, CDKL5, LYVE1, IL1R2, NECTIN1, ADGRD1, GPR4, GPR12, NPTX2, GPR183, GPRC5A, PKHD1L1, RGR, S1PR3, EDNRB, TGFBR3, TLR2, SERPINE1, IL1RL1, LGR6, CALCRL, OSMR"]], "row_count": 15, "column_count": 9, "numeric_cells": 84, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:34218797:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:91dd15a29c48fafce4f82db7422df3ec793ebc8e8f2c7f61de90d6638775df68", "bytes": 3889, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#Tab3", "version": null, "note": "The enriched pathway terms of the up and down regulated differentially expressed genes", "structure": {"pmcid": "PMC8256614", "section_index": 14, "section_title": "Functional enrichment analysis", "row_count": 17, "column_count": 8}, "table": {"label": "Table 3", "caption": "The enriched pathway terms of the up and down regulated differentially expressed genes", "rows": [["Pathway ID", "Pathway name", "P-value", "FDR B&H", "FDR B&Y", "Bonferroni", "Gene count", "Gene"], ["Up regulated genes"], ["1270244", "Extracellular matrix organization", "3.33E−08", "1.80E−05", "1.23E−04", "1.80E−05", "24", "COL22A1, MFAP4, CMA1, COL14A1, COL1A1, COL8A2, COL9A1, COL9A2, COL10A1, FMOD, COL16A1, COMP, HAPLN1, ADAMTS14, CTSG, ASPN, ITGAL, ITGB7, CAPN6, TGFB2, P3H2, TLL2, LTBP2, LUM"], ["1269201", "Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell", "8.13E−06", "7.31E−04", "5.03E−03", "4.39E−03", "13", "SH2D1B, SLAMF7, SIGLEC8, ITGAL, ITGB7, KLRB1, CD1C, CD3D, CD3E, CD3G, CD247, CD40LG, SH2D1A"], ["1269544", "GPCR ligand binding", "3.92E−04", "1.51E−02", "1.04E−01", "2.12E−01", "22", "GNG8, PENK, F2RL2, AGTR2, APLNR, CXCL9, CCR7, CXCL11, OXER1, HTR2A, HTR2B, WNT10B, WNT9A, ACKR4, CRHBP, S1PR5, FZD2, CX3CR1, CXCL10, MCHR1, LHCGR, GPR68"], ["1268749", "Metabolism of Angiotensinogen to Angiotensins", "5.26E−04", "1.85E−02", "1.27E−01", "2.84E−01", "4", "CMA1, CTSG, ACE, GZMH"], ["1269868", "Muscle contraction", "3.44E−02", "4.03E−01", "1.00E+00", "1.00E+00", "9", "KCNIP1, RYR3, SCN2B, ATP1A4, ATP1B2, MYL1, KCNK17, NPPA, TNNI1"], ["1269340", "Hemostasis", "6.57E−02", "5.21E−01", "1.00E+00", "1.00E+00", "20", "GNG8, CEACAM3, F2RL2, SERPINE2, APOA1, GNA14, PDE5A, ATP1B2, IL2RB, CTSW, ISLR, ITGAL, LCK, TGFB2, LEFTY2, RASGRP1, CD2, P2RX6, CD48, HBB"], ["1269171", "Adaptive Immune System", "1.32E−01", "6.87E−01", "1.00E+00", "1.00E+00", "23", "NRG1, HLA-DQA1, ZAP70, SH2D1B, CARD11, SLAMF7, SIGLEC8, ITGAL, ITGB7, ASB18, IER3, MRC2, KLRB1, LCK, RASGRP1, CD1C, CD3D, CD3E, CD3G, CD247, FBXL16, CD40LG, SH2D1A"], ["Down regulated genes"], ["1457780", "Neutrophil degranulation", "4.82E−06", "3.14E−03", "2.22E−02", "3.14E−03", "28", "SERPINA3, HK3, ACP3, HMOX2, CHI3L1, S100A8, S100A9, FCER1G, MGST1, HP, FGR, ALOX5, ANPEP, FPR1, CR1, ARG1, SLC11A1, SIGLEC9, GPR84, HPSE, PTX3, CRISPLD2, CD177, SIGLEC14, RNASE2, TLR2, ELANE, MCEMP1"], ["1269907", "SLC-mediated transmembrane transport", "6.91E−04", "4.74E−02", "3.35E−01", "4.51E−01", "16", "HK3, SLC7A11, SLC4A7, SLC1A1, SLC2A1, SLC5A1, SLC11A1, SLC22A16, SLCO2A1, SLCO4A1, GCKR, LCN15, SLC9A7, SLC25A18, SLC38A4, RHAG"], ["1269545", "Class A/1 (Rhodopsin-like receptors)", "8.72E−04", "4.74E−02", "3.35E−01", "5.69E−01", "17", "OPN4, SAA1, AGTR1, CCR1, CNR1, P2RY12, FPR1, SSTR2, SSTR5, KNG1, GPR4, GPR183, RGR, S1PR3, EDN1, EDN2, EDNRB"], ["1269340", "Hemostasis", "2.18E−03", "7.11E−02", "5.02E−01", "1.00E+00", "26", "SERPINA3, CD109, SLC7A11, F5, F8, F13A1, SERPINB8, FCER1G, FGR, MERTK, SERPINF2, SELE, P2RY12, APOB, KIF18B, ATP2A2, NHLRC2, KNG1, PDE11A, CD177, DOCK9, GRB7, GRB14, THBS1, SERPINE1, SERPINA5"], ["1269903", "Transmembranetransport of small molecules", "4.89E−03", "1.28E−01", "9.01E−01", "1.00E+00", "26", "HK3, TRPC4, CFTR, HMOX2, SLC7A11, ABCB1, SLC4A7, AQP3, AQP4, SLC1A1, SLC2A1, SLC5A1, SLC11A1, SLC22A16, SLCO2A1, ATP2A2, GABRR2, SLCO4A1, GCKR, LCN15, SLC9A7, WNK3, SLC25A18, SLC38A4, RHAG, STEAP3"], ["1269203", "Innate Immune System", "9.62E−03", "1.96E−01", "1.00E+00", "1.00E+00", "42", "SERPINA3, EREG, HK3, MARK3, ACP3, CLEC7A, HMOX2, CHI3L1, S100A8, S100A9, SAA1, FCER1G, MGST1, FCGR3A, HP, GRAP2, PLA2G2A, FGF5, FGF10, FGR, ALOX5, ANPEP, FPR1, APOB, CR1, FCN3, ARG1, SLC11A1, SIGLEC9, GPR84, HPSE, PTX3, WASF1, CRISPLD2, CD177, SIGLEC14, LBP, RNASE2, TLR2, ELANE, IRAK3, MCEMP1"], ["1269310", "Cytokine Signaling in Immune system", "8.42E−02", "4.76E−01", "1.00E+00", "1.00E+00", "23", "EREG, MARK3, F13A1, SAA1, FGF5, CCR1, FGF10, ALOX5, IL17RB, FLT3, FPR1, SAMHD1, IL10, IL15RA, IL20RA, BCL6, IL18R1, IL1R2, SOCS3, LBP, IRAK3, IL1RL1, OSMR"]], "row_count": 17, "column_count": 8, "numeric_cells": 98, "header_rows": 1, "locator": "section[14]/table-wrap[2]#Tab3"}}, {"id": "asset:table:pmid:34218797:8", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:839cfcfed9d2fc7852ecc423fbaff46f241f6bc95cf8e87698b1b153cb380dc9", "bytes": 16929, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#Tab4", "version": null, "note": "Topology table for up and down regulated genes", "structure": {"pmcid": "PMC8256614", "section_index": 15, "section_title": "Protein–protein interaction (PPI) network and module analysis", "row_count": 325, "column_count": 6}, "table": {"label": "Table 4", "caption": "Topology table for up and down regulated genes", "rows": [["Regulation", "Node", "Degree", "Betweenness", "Stress", "Closeness"], ["Up", "ESR1", "1094", "0.250896", "7.4E+08", "0.392769"], ["Up", "PYHIN1", "342", "0.054258", "1.1E+08", "0.339882"], ["Up", "PPP2R2B", "199", "0.023115", "35,268,762", "0.346839"], ["Up", "LCK", "162", "0.033618", "18,589,354", "0.353915"], ["Up", "TP63", "142", "0.018577", "39,426,608", "0.319664"], ["Up", "CD247", "129", "0.013832", "18,625,274", "0.317784"], ["Up", "PTN", "105", "0.016638", "36,892,166", "0.300662"], ["Up", "APLNR", "103", "0.016611", "40,715,208", "0.288093"], ["Up", "APOA1", "100", "0.018834", "13,935,332", "0.315866"], ["Up", "CENPA", "98", "0.009846", "31,131,318", "0.301786"], ["Up", "SKAP1", "97", "0.01599", "10,109,482", "0.313338"], ["Up", "FSCN1", "88", "0.010226", "9,387,016", "0.335367"], ["Up", "SCN2B", "86", "0.01089", "24,233,242", "0.284756"], ["Up", "TMEM30B", "79", "0.016411", "10,490,230", "0.270807"], ["Up", "FOXS1", "79", "0.009408", "26,398,078", "0.293247"], ["Up", "COL1A1", "76", "0.010472", "9,315,670", "0.308098"], ["Up", "ZAP70", "75", "0.007096", "5,315,196", "0.317614"], ["Up", "UCHL1", "74", "0.009753", "9,381,024", "0.331525"], ["Up", "HBB", "72", "0.009984", "14,209,592", "0.304767"], ["Up", "NRG1", "70", "0.01151", "13,449,066", "0.29526"], ["Up", "LEF1", "61", "0.007998", "18,260,094", "0.290744"], ["Up", "NT5E", "60", "0.009599", "11,470,634", "0.301563"], ["Up", "MDK", "59", "0.006889", "7,533,352", "0.305822"], ["Up", "ISLR", "58", "0.010139", "9,992,806", "0.294012"], ["Up", "FATE1", "57", "0.011609", "9,248,788", "0.281581"], ["Up", "LRRC15", "56", "0.010069", "4,772,792", "0.299094"], ["Up", "MATN2", "54", "0.004491", "9,580,600", "0.286792"], ["Up", "LIPH", "54", "0.008197", "6,873,658", "0.282347"], ["Up", "MYOC", "49", "0.005138", "12,313,276", "0.291029"], ["Up", "SCARA3", "49", "0.006492", "11,494,220", "0.290151"], ["Up", "NPPA", "46", "0.009502", "4,868,574", "0.307143"], ["Up", "CD83", "43", "0.005149", "5,484,906", "0.272841"], ["Up", "COL14A1", "41", "0.006129", "5,699,128", "0.292893"], ["Up", "CTSG", "40", "0.003821", "1,913,996", "0.296155"], ["Up", "SFRP4", "40", "0.004006", "7,876,966", "0.282518"], ["Up", "TRAF3IP3", "38", "0.006447", "4,263,002", "0.290602"], ["Up", "CLEC11A", "38", "0.005085", "3,520,012", "0.283596"], ["Up", "ATP1B4", "38", "0.005722", "2,476,482", "0.245939"], ["Up", "CD3E", "37", "0.003892", "1,537,326", "0.297624"], ["Up", "SH2D1A", "37", "0.003969", "2,117,220", "0.308113"], ["Up", "DDX3Y", "37", "0.003754", "1,632,916", "0.32095"], ["Up", "PRPH", "37", "0.001871", "1,994,266", "0.301494"], ["Up", "BIRC7", "35", "0.004835", "2,567,254", "0.28549"], ["Up", "CARD11", "35", "0.002249", "2,510,852", "0.292173"], ["Up", "RXRG", "35", "0.002394", "7,134,478", "0.26225"], ["Up", "CCL22", "34", "0.005706", "3,916,024", "0.281423"], ["Up", "CD27", "33", "0.003915", "2,076,446", "0.294263"], ["Up", "GZMB", "32", "0.003277", "6,141,522", "0.285602"], ["Up", "THY1", "32", "0.003561", "1,793,684", "0.291509"], ["Up", "CHRNA3", "32", "0.004247", "3,415,720", "0.236631"], ["Up", "LSP1", "32", "0.003371", "5,734,010", "0.281836"], ["Up", "IL2RB", "31", "0.002351", "1,938,172", "0.305808"], ["Up", "HTR2B", "30", "0.004018", "2,165,998", "0.27434"], ["Up", "DLGAP1", "29", "0.003816", "6,072,882", "0.277754"], ["Up", "TRIM17", "29", "0.002943", "5,543,810", "0.275137"], ["Up", "CTNNA2", "29", "0.003554", "3,511,510", "0.30254"], ["Up", "SERPINE2", "28", "0.002577", "3,031,536", "0.27426"], ["Up", "CD1E", "28", "0.003282", "3,419,392", "0.255229"], ["Up", "MRC2", "28", "0.003395", "2,950,548", "0.296276"], ["Up", "C1QTNF2", "28", "0.003203", "2,505,388", "0.270147"], ["Up", "SH2D1B", "27", "0.001864", "1,043,570", "0.29028"], ["Up", "BRINP1", "27", "0.001516", "4,402,948", "0.27726"], ["Up", "PDIA2", "27", "0.001967", "2,895,182", "0.286453"], ["Up", "CHD5", "27", "0.001918", "5,223,636", "0.286503"], ["Up", "FAP", "27", "0.003531", "5,820,086", "0.268583"], ["Up", "IL31RA", "26", "0.002073", "1,606,954", "0.263603"], ["Up", "GAP43", "25", "0.002745", "2,793,268", "0.279858"], ["Up", "CD5", "25", "0.001695", "655,904", "0.295861"], ["Up", "UBASH3A", "25", "0.001652", "1,347,264", "0.290951"], ["Up", "ROBO2", "25", "0.002959", "3,726,616", "0.267048"], ["Up", "ITGB7", "24", "0.002686", "3,351,660", "0.276124"], ["Up", "HTR2A", "24", "0.002571", "2,472,010", "0.275833"], ["Up", "MOXD1", "24", "0.002391", "2,492,756", "0.259926"], ["Up", "ASB18", "24", "9.77E−04", "3,202,162", "0.273001"], ["Up", "CD2", "23", "0.002221", "926,408", "0.287954"], ["Up", "BCL11B", "23", "8.18E−04", "1,888,298", "0.28836"], ["Up", "STAT4", "23", "0.001786", "2,435,506", "0.277166"], ["Up", "NGEF", "23", "0.001809", "1,548,206", "0.277636"], ["Up", "SMPD3", "23", "0.002518", "2,175,774", "0.281"], ["Up", "FZD2", "22", "0.003673", "3,239,390", "0.250335"], ["Up", "DUSP15", "22", "0.001253", "2,474,532", "0.284472"], ["Up", "CD3D", "21", "0.001725", "1,111,132", "0.288589"], ["Up", "SYT17", "21", "0.002549", "2,482,574", "0.285802"], ["Up", "FCGR3B", "21", "0.002748", "1,492,022", "0.282286"], ["Up", "EGR2", "21", "0.002934", "3,438,856", "0.266406"], ["Up", "ZBP1", "21", "0.001876", "2,664,938", "0.26006"], ["Up", "CAMK4", "21", "0.001773", "3,472,134", "0.272716"], ["Up", "DMC1", "20", "0.002511", "4,659,098", "0.254277"], ["Up", "GDNF", "20", "0.002515", "3,274,958", "0.244751"], ["Up", "FCN1", "20", "0.002571", "1,243,380", "0.236742"], ["Up", "LUM", "20", "0.002276", "1,515,870", "0.283903"], ["Up", "GZMA", "20", "0.001051", "3,258,230", "0.276498"], ["Up", "TGFB2", "20", "0.002259", "1,632,566", "0.277119"], ["Up", "SLAMF7", "20", "0.00211", "1,035,482", "0.271708"], ["Up", "MS4A1", "20", "0.002857", "1,169,078", "0.288398"], ["Up", "ETV4", "20", "0.001747", "1,674,080", "0.301883"], ["Up", "GLI2", "20", "0.001398", "2,977,194", "0.285902"], ["Up", "PHLDA1", "19", "4.37E−04", "818,256", "0.298194"], ["Up", "COL8A2", "19", "0.00147", "1,089,762", "0.273835"], ["Up", "GABRD", "19", "0.002826", "2,629,544", "0.25748"], ["Up", "LMF1", "19", "0.004342", "2,024,228", "0.265132"], ["Up", "F2RL2", "19", "0.001554", "790,338", "0.282933"], ["Up", "LYPD1", "19", "0.003123", "3,995,458", "0.266276"], ["Up", "CAPN6", "19", "0.001415", "3,046,736", "0.267802"], ["Up", "SOX8", "19", "0.003361", "2,763,024", "0.251306"], ["Up", "IER3", "18", "0.001921", "3,613,164", "0.282982"], ["Up", "BEX1", "18", "0.001034", "1,286,206", "0.273606"], ["Up", "COLQ", "18", "0.001173", "1,414,826", "0.261234"], ["Up", "NTM", "18", "0.00284", "2,486,684", "0.275102"], ["Up", "RPS4Y1", "18", "0.001013", "1,200,768", "0.287713"], ["Up", "FERMT1", "18", "0.001713", "4,279,868", "0.270315"], ["Up", "RGS17", "18", "0.002928", "3,868,106", "0.249895"], ["Up", "TNNI1", "17", "0.001349", "1,550,004", "0.266765"], ["Up", "MYOZ1", "17", "0.00128", "2,111,156", "0.283203"], ["Up", "KLHDC8A", "17", "0.001147", "7,007,508", "0.251036"], ["Up", "MYL1", "17", "7.90E−04", "1,213,666", "0.289945"], ["Up", "DIO2", "16", "0.001161", "1,959,228", "0.279416"], ["Up", "ITGAL", "16", "0.001182", "1,521,116", "0.271527"], ["Up", "CRABP2", "16", "4.13E−04", "675,182", "0.272171"], ["Up", "HSH2D", "16", "0.001425", "889,856", "0.26034"], ["Up", "CD48", "3", "0", "0", "0.265422"], ["Up", "CD3G", "2", "0", "0", "0.23833"], ["Up", "LY9", "2", "0", "0", "0.240141"], ["Up", "SIT1", "2", "0", "0", "0.264221"], ["Up", "ATP1A4", "2", "1.16E−04", "79,140", "0.235049"], ["Up", "FMOD", "2", "3.96E−05", "20,526", "0.240707"], ["Up", "CCDC80", "2", "3.58E−05", "499,704", "0.288908"], ["Up", "CCR7", "2", "0", "0", "0.244312"], ["Up", "KCNIP1", "1", "0", "0", "0.219995"], ["Up", "CD6", "1", "0", "0", "0.22832"], ["Up", "FCRL3", "1", "0", "0", "0.241062"], ["Up", "SERTAD4", "1", "0", "0", "0.257531"], ["Up", "PRF1", "1", "0", "0", "0.222162"], ["Up", "C1QTNF9", "1", "0", "0", "0.226548"], ["Up", "OPCML", "1", "0", "0", "0.215756"], ["Up", "ESM1", "1", "0", "0", "0.213551"], ["Up", "CD40LG", "1", "0", "0", "0.240053"], ["Up", "S1PR5", "1", "0", "0", "0.24224"], ["Up", "AGTR2", "1", "0", "0", "0.259256"], ["Up", "NPPB", "1", "0", "0", "0.211726"], ["Up", "SCG5", "1", "0", "0", "0.238721"], ["Up", "PDE5A", "1", "0", "0", "0.243548"], ["Up", "RYR3", "1", "0", "0", "0.274755"], ["Up", "RASEF", "1", "0", "0", "0.274755"], ["Up", "PODXL2", "1", "0", "0", "0.213106"], ["Up", "OGN", "1", "0", "0", "0.226548"], ["Up", "PLCH2", "1", "0", "0", "0.238721"], ["Up", "SCG2", "1", "0", "0", "0.267704"], ["Up", "P3H2", "1", "0", "0", "0.207132"], ["Up", "C12orf75", "1", "0", "0", "0.217608"], ["Up", "ACE", "1", "0", "0", "0.241159"], ["Up", "GNA14", "1", "0", "0", "0.217608"], ["Up", "HDC", "1", "0", "0", "0.216614"], ["Up", "CMA1", "1", "0", "0", "0.226713"], ["Up", "CEACAM3", "1", "0", "0", "0.265519"], ["Down", "PCLAF", "817", "0.135529", "4.95E+08", "0.365547"], ["Down", "CFTR", "800", "0.168404", "4.5E+08", "0.378823"], ["Down", "TK1", "188", "0.034997", "43,663,230", "0.331089"], ["Down", "ECT2", "164", "0.020509", "39,431,940", "0.325989"], ["Down", "FKBP5", "157", "0.028064", "15,963,868", "0.346288"], ["Down", "ANLN", "153", "0.021564", "38,168,832", "0.325066"], ["Down", "ATP2A2", "148", "0.027131", "19,656,040", "0.363859"], ["Down", "BCL6", "142", "0.022279", "29,419,916", "0.314181"], ["Down", "TOP2A", "132", "0.018571", "16,838,266", "0.361426"], ["Down", "ZBTB16", "132", "0.025165", "14,500,206", "0.349976"], ["Down", "S100A9", "124", "0.01355", "11,186,464", "0.352219"], ["Down", "CEP55", "123", "0.019583", "21,505,878", "0.316891"], ["Down", "BLM", "108", "0.014259", "18,458,556", "0.321945"], ["Down", "AGTR1", "100", "0.019518", "14,083,216", "0.313564"], ["Down", "SAMHD1", "94", "0.011463", "12,340,270", "0.337357"], ["Down", "S100A8", "88", "0.011637", "8,662,548", "0.361486"], ["Down", "GRAP2", "86", "0.011721", "16,819,438", "0.305936"], ["Down", "CBS", "83", "0.011248", "20,466,334", "0.301591"], ["Down", "SOCS3", "83", "0.011071", "9,067,820", "0.324888"], ["Down", "GFI1B", "80", "0.011791", "21,469,034", "0.299012"], ["Down", "APOB", "78", "0.014102", "9,290,092", "0.319133"], ["Down", "PCK1", "77", "0.004102", "12,732,476", "0.305408"], ["Down", "MARK3", "76", "0.008497", "19,265,788", "0.304512"], ["Down", "HMOX2", "75", "0.011098", "15,258,770", "0.312053"], ["Down", "PCNT", "74", "0.011297", "9,190,430", "0.312261"], ["Down", "PIK3C2A", "69", "0.005568", "8,768,122", "0.313053"], ["Down", "KIF14", "69", "0.01035", "12,506,564", "0.304668"], ["Down", "WASF1", "67", "0.009478", "18,219,554", "0.29633"], ["Down", "ARNTL", "65", "0.00974", "19,494,854", "0.295526"], ["Down", "ALOX5", "65", "0.010921", "7,343,824", "0.306424"], ["Down", "MCM10", "64", "0.006773", "8,807,396", "0.306438"], ["Down", "THBS1", "64", "0.008915", "6,203,038", "0.312694"], ["Down", "VSIG4", "64", "0.010353", "10,534,518", "0.302037"], ["Down", "WWC1", "64", "0.007241", "14,604,594", "0.301647"], ["Down", "MELK", "63", "0.008554", "18,629,232", "0.283953"], ["Down", "P2RY12", "63", "0.008962", "9,063,088", "0.286641"], ["Down", "PPL", "62", "0.007851", "16,137,388", "0.297313"], ["Down", "MYBL2", "59", "0.006189", "16,766,208", "0.291964"], ["Down", "FAM107A", "59", "0.006172", "12,510,302", "0.289688"], ["Down", "GRIP1", "58", "0.008069", "3,384,760", "0.320055"], ["Down", "ELF3", "56", "0.004945", "7,205,142", "0.309118"], ["Down", "PALLD", "55", "0.00509", "15,467,012", "0.293274"], ["Down", "CTH", "54", "0.007754", "5,179,060", "0.296908"], ["Down", "EIF4EBP1", "53", "0.005367", "9,748,852", "0.303946"], ["Down", "KNG1", "53", "0.007017", "4,204,766", "0.304243"], ["Down", "GLUL", "51", "0.00728", "10,616,752", "0.30116"], ["Down", "SLC2A1", "51", "0.004557", "8,307,646", "0.303974"], ["Down", "HP", "51", "0.006741", "3,398,298", "0.314741"], ["Down", "RPGR", "50", "0.004441", "10,097,488", "0.29384"], ["Down", "TLR2", "50", "0.00754", "8,322,330", "0.294595"], ["Down", "GRB7", "49", "0.004147", "4,832,846", "0.308113"], ["Down", "PPEF1", "49", "0.001983", "3,327,232", "0.298276"], ["Down", "TXNRD1", "49", "0.00627", "2,860,122", "0.328561"], ["Down", "NAMPT", "48", "0.005035", "10,420,710", "0.290538"], ["Down", "BMP7", "47", "0.007622", "4,442,306", "0.286981"], ["Down", "CA14", "47", "0.005218", "4,884,858", "0.279189"], ["Down", "CCR1", "46", "0.008305", "11,217,842", "0.27812"], ["Down", "CDC45", "45", "0.004479", "3,231,162", "0.30618"], ["Down", "ARG1", "45", "0.004931", "2,347,856", "0.32381"], ["Down", "SPC24", "43", "0.005356", "6,589,710", "0.294834"], ["Down", "FGR", "43", "0.003434", "3,020,950", "0.303452"], ["Down", "KIF5C", "42", "0.004876", "2,365,086", "0.319586"], ["Down", "IL1R2", "42", "0.006825", "9,489,620", "0.289265"], ["Down", "SERPINA3", "42", "0.005518", "4,047,110", "0.293168"], ["Down", "DEPDC1B", "42", "0.002978", "9,632,346", "0.260838"], ["Down", "SLC4A7", "41", "0.006314", "2,752,106", "0.316232"], ["Down", "SERPINA5", "41", "0.003604", "13,750,404", "0.273206"], ["Down", "MPP3", "40", "0.008262", "9,328,402", "0.297003"], ["Down", "NCEH1", "40", "0.009405", "3,554,728", "0.304214"], ["Down", "SLC1A1", "38", "0.008678", "2,278,154", "0.320573"], ["Down", "CLSPN", "38", "0.003668", "3,801,300", "0.294343"], ["Down", "BCAT1", "38", "0.0052", "9,066,238", "0.269657"], ["Down", "MYH6", "38", "0.005049", "1,731,786", "0.308578"], ["Down", "IL20RA", "37", "0.005252", "8,769,348", "0.267901"], ["Down", "HOOK1", "37", "0.005558", "7,195,380", "0.279177"], ["Down", "FLT3", "37", "0.002948", "1,938,440", "0.292408"], ["Down", "ADAMTS4", "37", "0.005524", "2,338,476", "0.307519"], ["Down", "CAMSAP3", "36", "0.003339", "4,795,892", "0.29578"], ["Down", "PLA2G2A", "35", "0.003637", "1,686,594", "0.300565"], ["Down", "FOSL1", "34", "0.004151", "10,955,318", "0.269402"], ["Down", "NQO1", "34", "0.001945", "5,351,260", "0.289201"], ["Down", "ELANE", "34", "0.005024", "2,289,646", "0.302834"], ["Down", "KCND3", "34", "0.002555", "9,153,178", "0.28203"], ["Down", "EPN3", "34", "0.005073", "7,423,282", "0.280302"], ["Down", "GPR183", "34", "0.003642", "4,243,792", "0.256783"], ["Down", "CD109", "34", "0.006381", "3,655,940", "0.303565"], ["Down", "TUBA3E", "34", "0.003459", "6,711,886", "0.289048"], ["Down", "TGFBR3", "33", "0.005143", "1,983,082", "0.267386"], ["Down", "NID1", "33", "0.004536", "1,702,236", "0.311503"], ["Down", "STEAP3", "33", "0.004665", "2,788,716", "0.285365"], ["Down", "AMD1", "32", "0.005714", "3,154,782", "0.29099"], ["Down", "EDNRB", "31", "0.003092", "7,273,156", "0.265368"], ["Down", "IL17RB", "31", "0.004227", "6,381,040", "0.261527"], ["Down", "SLC19A2", "30", "0.004653", "2,505,974", "0.281302"], ["Down", "SLC22A16", "30", "0.004545", "3,831,872", "0.240618"], ["Down", "PHACTR3", "29", "0.002193", "6,417,862", "0.280976"], ["Down", "LAPTM5", "29", "0.003298", "2,735,158", "0.274317"], ["Down", "ANGPTL4", "29", "0.003467", "1,447,446", "0.325163"], ["Down", "PPM1E", "29", "0.002894", "5,733,032", "0.270427"], ["Down", "E2F2", "28", "0.002816", "5,508,320", "0.28041"], ["Down", "SERPINE1", "28", "0.001474", "2,497,574", "0.271302"], ["Down", "ACPP", "28", "0.003084", "2,749,550", "0.291223"], ["Down", "KRT7", "28", "0.002861", "1,288,592", "0.315774"], ["Down", "SERPINB8", "28", "0.002944", "3,167,812", "0.28186"], ["Down", "FREM2", "28", "0.003954", "3,395,758", "0.276661"], ["Down", "RNF157", "28", "0.002172", "6,196,626", "0.265551"], ["Down", "PPIP5K2", "28", "0.003886", "8,572,108", "0.270014"], ["Down", "F8", "27", "0.002839", "4,879,016", "0.274836"], ["Down", "TUBAL3", "27", "0.002055", "1,052,840", "0.318915"], ["Down", "ELL2", "26", "0.003971", "6,281,508", "0.255859"], ["Down", "GRB14", "25", "0.002326", "3,092,024", "0.28378"], ["Down", "IRAK3", "25", "0.00257", "6,900,170", "0.265897"], ["Down", "MANEA", "25", "0.004508", "5,075,608", "0.263869"], ["Down", "CLEC7A", "25", "0.004246", "4,293,212", "0.277095"], ["Down", "KLF10", "24", "0.001607", "3,013,994", "0.281339"], ["Down", "GNMT", "24", "0.00165", "3,015,768", "0.269136"], ["Down", "ART3", "24", "0.002904", "2,401,360", "0.255748"], ["Down", "LRRC8E", "24", "0.003739", "4,188,308", "0.288665"], ["Down", "SLA", "23", "0.001714", "1,003,510", "0.289329"], ["Down", "CLEC4G", "23", "0.002667", "2,376,260", "0.277495"], ["Down", "TUBB4A", "5", "1.28E−04", "181,440", "0.250652"], ["Down", "CD38", "4", "0", "0", "0.268176"], ["Down", "FCGR3A", "4", "1.01E−04", "73,756", "0.268385"], ["Down", "F5", "3", "8.10E−07", "708", "0.248641"], ["Down", "EHF", "2", "7.11E−06", "4180", "0.254842"], ["Down", "KIAA1549", "2", "4.16E−04", "193,604", "0.261391"], ["Down", "S100A3", "2", "1.84E−05", "45,822", "0.254376"], ["Down", "ADH1B", "2", "3.40E−05", "28,184", "0.233546"], ["Down", "PAPSS2", "2", "1.05E−05", "8726", "0.251868"], ["Down", "PTX3", "1", "0", "0", "0.19143"], ["Down", "IL15RA", "1", "0", "0", "0.234199"], ["Down", "EDN1", "1", "0", "0", "0.209723"], ["Down", "SERPINF2", "1", "0", "0", "0.232451"], ["Down", "ZNF366", "1", "0", "0", "0.282018"], ["Down", "ACR", "1", "0", "0", "0.214588"], ["Down", "MATN3", "1", "0", "0", "0.222881"], ["Down", "CNR1", "1", "0", "0", "0.216205"], ["Down", "LBP", "1", "0", "0", "0.240053"], ["Down", "ALOX5AP", "1", "0", "0", "0.23456"], ["Down", "SCGN", "1", "0", "0", "0.23353"], ["Down", "MAMDC2", "1", "0", "0", "0.248745"], ["Down", "CDKL5", "1", "0", "0", "0.219891"], ["Down", "CENPM", "1", "0", "0", "0.231833"], ["Down", "KCNIP2", "1", "0", "0", "0.219995"], ["Down", "CPM", "1", "0", "0", "0.24533"], ["Down", "GPSM2", "1", "0", "0", "0.245855"], ["Down", "LSAMP", "1", "0", "0", "0.215756"], ["Down", "KCNK3", "1", "0", "0", "0.219353"], ["Down", "ALOX15B", "1", "0", "0", "0.234981"], ["Down", "ST6GALNAC3", "1", "0", "0", "0.233263"], ["Down", "GPRC5A", "1", "0", "0", "0.274755"], ["Down", "SLC31A2", "1", "0", "0", "0.215287"], ["Down", "MARVELD2", "1", "0", "0", "0.218671"], ["Down", "SNTG2", "1", "0", "0", "0.229"], ["Down", "TRHDE", "1", "0", "0", "0.208786"], ["Down", "SIGLEC7", "1", "0", "0", "0.245229"], ["Down", "SMTNL2", "1", "0", "0", "0.265519"], ["Down", "ANXA3", "1", "0", "0", "0.274755"], ["Down", "F13A1", "1", "0", "0", "0.248745"], ["Down", "ANKRD7", "1", "0", "0", "0.233438"], ["Down", "KCNS2", "1", "0", "0", "0.219721"], ["Down", "SIGLEC9", "1", "0", "0", "0.227565"], ["Down", "SIGLEC10", "1", "0", "0", "0.282018"], ["Down", "C20orf197", "1", "0", "0", "0.282018"], ["Down", "SCGB1D2", "1", "0", "0", "0.226548"], ["Down", "IL1RL1", "1", "0", "0", "0.21698"], ["Down", "PLIN2", "1", "0", "0", "0.241935"], ["Down", "CD163", "1", "0", "0", "0.239403"], ["Down", "HPR", "1", "0", "0", "0.240053"]], "row_count": 325, "column_count": 6, "numeric_cells": 1351, "header_rows": 1, "locator": "section[15]/table-wrap[1]#Tab4"}}, {"id": "asset:table:pmid:34218797:9", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d40d246e9267cdecbb667151bf6fc24dd1163f94c5e35a99f6a9287292c2dc92", "bytes": 2113, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#Tab5", "version": null, "note": "miRNA—target gene and TF—target gene interaction", "structure": {"pmcid": "PMC8256614", "section_index": 16, "section_title": "Target gene—miRNA regulatory network construction", "row_count": 30, "column_count": 8}, "table": {"label": "Table 5", "caption": "miRNA—target gene and TF—target gene interaction", "rows": [["Regulation", "Target Genes", "Degree", "MicroRNA", "Regulation", "Target Genes", "Degree", "TF"], ["Up", "FSCN1", "99", "hsa-mir-4533", "Up", "FSCN1", "62", "ESRRA"], ["Up", "ESR1", "72", "hsa-mir-548ac", "Up", "APOA1", "48", "RERE"], ["Up", "TMEM30B", "64", "hsa-mir-548i", "Up", "COL1A1", "21", "HMG20B"], ["Up", "SCN2B", "46", "hsa-mir-5585-3p", "Up", "HBB", "16", "THRAP3"], ["Up", "CENPA", "35", "hsa-mir-6750-3p", "Up", "LCK", "15", "ATF1"], ["Up", "APOA1", "22", "hsa-mir-6722-5p", "Up", "FOXS1", "14", "YBX1"], ["Up", "PPP2R2B", "14", "hsa-mir-149-3p", "Up", "CENPA", "10", "SAP30"], ["Up", "TP63", "12", "hsa-mir-1178-3p", "Up", "SCN2B", "5", "RCOR2"], ["Up", "PYHIN1", "5", "hsa-mir-205-3p", "Up", "TMEM30B", "5", "ZNF24"], ["Up", "APLNR", "2", "hsa-mir-10b-5p", "Up", "APLNR", "4", "FOXJ2"], ["Up", "PTN", "1", "hsa-mir-155-5p", "Up", "NRG1", "2", "SUZ12"], ["Up", "LCK", "1", "hsa-mir-335-5p", "Up", "PTN", "2", "L3MBTL2"], ["Up", "CD247", "1", "hsa-mir-346", "Up", "UCHL1", "2", "MAZ"], ["Down", "FKBP5", "88", "hsa-mir-200c-3p", "Up", "ESR1", "1", "EZH2"], ["Down", "PCLAF", "62", "hsa-mir-1273g-3p", "Up", "ZAP70", "1", "ZFX"], ["Down", "CEP55", "57", "hsa-mir-1244", "Down", "SOCS3", "48", "MXD3"], ["Down", "ATP2A2", "55", "hsa-mir-4789-3p", "Down", "BCL6", "44", "ARID4B"], ["Down", "TK1", "45", "hsa-mir-766-3p", "Down", "FKBP5", "43", "CBFB"], ["Down", "ZBTB16", "43", "hsa-mir-1976", "Down", "ANLN", "38", "TAF7"], ["Down", "SAMHD1", "26", "hsa-mir-3124-3p", "Down", "ATP2A2", "35", "CREM"], ["Down", "TOP2A", "17", "hsa-mir-186-5p", "Down", "CBS", "31", "IKZF1"], ["Down", "BCL6", "13", "hsa-mir-339-5p", "Down", "BLM", "19", "ZNF501"], ["Down", "ECT2", "13", "hsa-mir-132-3p", "Down", "ECT2", "15", "KLF16"], ["Down", "CFTR", "9", "hsa-mir-145-5p", "Down", "CEP55", "10", "FOSL2"], ["Down", "S100A9", "7", "hsa-mir-4679", "Down", "GRAP2", "10", "CEBPD"], ["Down", "AGTR1", "5", "hsa-mir-410-3p", "Down", "ZBTB16", "4", "TRIM28"], ["Down", "ANLN", "5", "hsa-mir-503-5p", "Down", "S100A8", "3", "STAT3"], ["Down", "BLM", "3", "hsa-mir-193b-3p", "Down", "S100A9", "2", "CEBPG"], ["", "", "", "", "Down", "AGTR1", "1", "EZH2"]], "row_count": 30, "column_count": 8, "numeric_cells": 104, "header_rows": 1, "locator": "section[16]/table-wrap[1]#Tab5"}}, {"id": "asset:table:pmid:34218797:10", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:848c0dbc1a78a523ff7254e102bab3b7e2a0a579d69f16124916986e39bc2598", "bytes": 806, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#Tab1", "version": null, "note": "The sequences of primers for quantitative RT-PCR", "structure": {"pmcid": "PMC8256614", "section_index": 19, "section_title": "RT-PCR analysis", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of primers for quantitative RT-PCR", "rows": [["Genes", "Forward primers", "Reverse primers"], ["ESR1", "CCTCTGGCTACCATTATGGG", "AGTCATTGTGTCCTTGAATGC"], ["PYHIN1", "GCAAGATCAGTACGACAGAG", "AGATAACTGAGCAACCTGTG"], ["PPP2R2B", "ACCAGAGACTATCTGACCG", "GTAGTCATGAACCTGGTATGTC"], ["LCK", "CTAGTCCGGCTTTATGCAG", "AAATCTACTAGGCTCCCGT"], ["TP63", "ATTCAATGAGGGACAGATTGC", "GGGTCTTCTACATACTGGGC"], ["PCLAF", "GACCAATATAAACTGTGGCGGG", "CCAGGGTAAACAAGGAGACGTT"], ["CFTR", "CTGTGGCCTTGGTTTACTG", "CTCTGATCTCTGTACTTCACCA"], ["TK1", "AGATTCAGGTGATTCTCGGG", "ACTTGTACTGGGCGATCTG"], ["ECT2", "GCTGTATTGTACGAGTATGCT", "GTCACCAATTTGACAAGCTC"], ["FKBP5", "CCTAAGTTTGGCATTGACCC", "CCAAGATTCTTTGGCCTTCTC"]], "row_count": 11, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[10]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:34218797:11", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:039e3c101909fdc467734aa90b6724fe12ab39ff52eed20c608fec81eb075919", "bytes": 5846, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#Tab6", "version": null, "note": "Docking results of Designed Molecules on Over Expressed Proteins", "structure": {"pmcid": "PMC8256614", "section_index": 20, "section_title": "Identification of candidate small molecules", "row_count": 38, "column_count": 16}, "table": {"label": "Table 6", "caption": "Docking results of Designed Molecules on Over Expressed Proteins", "rows": [["Sl. No/Code", "Over expressed gene: ESR1", "Over expressed gene: LCK", "Over expressed gene: PPP2R2B", "Over expressed gene: PYHIN 1", "Over expressed gene: TP63"], ["PDB: 4PXM", "PDB:1KSW", "PDB: 2HV7", "PDB: 3VD8", "PDB: 6RU6"], ["Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(-Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar", "Total Score", "Crash(−Ve)", "Polar"], ["HIM1", "5.097", "− 4.375", "0.114", "4.258", "− 1.555", "1.784", "4.904", "− 0.870", "0.004", "5.794", "− 0.514", "3.828", "5.770", "− 1.440", "2.231"], ["HIM2", "4.057", "− 6.172", "0.039", "4.624", "− 0.997", "1.959", "4.906", "− 0.468", "1.517", "5.052", "− 0.780", "3.415", "5.414", "− 1.529", "2.444"], ["HIM3", "5.353", "− 5.309", "0.161", "4.578", "− 1.492", "1.790", "5.042", "− 1.845", "1.073", "5.680", "− 0.804", "3.956", "5.350", "− 1.170", "2.316"], ["HIM4", "3.976", "− 5.132", "0.167", "3.839", "− 1.635", "1.196", "6.328", "− 1.172", "1.128", "4.966", "− 0.666", "1.818", "5.627", "− 1.416", "2.320"], ["HIM5", "2.707", "− 7.759", "0.179", "4.067", "− 0.997", "1.987", "5.254", "− 0.674", "1.618", "4.563", "− 1.068", "2.935", "5.698", "− 1.240", "2.485"], ["HIM6", "5.948", "− 3.902", "1.796", "5.229", "− 0.707", "3.656", "6.766", "− 1.424", "1.858", "6.670", "− 0.941", "5.519", "6.218", "− 1.468", "2.578"], ["HIM7", "5.019", "− 7.055", "0.203", "4.382", "− 2.443", "3.329", "6.028", "− 0.629", "1.660", "5.374", "− 1.876", "0.670", "6.627", "− 1.484", "2.579"], ["HIM8", "4.429", "− 3.983", "0.344", "4.150", "− 4.382", "4.210", "6.794", "− 1.279", "1.129", "5.468", "− 0.769", "3.444", "5.842", "− 2.088", "2.272"], ["HIM9", "3.722", "− 5.956", "0.197", "4.051", "− 2.006", "0.002", "6.116", "− 0.597", "1.717", "5.407", "− 0.565", "1.370", "5.877", "− 2.054", "0.792"], ["HIM10", "6.771", "− 3.977", "1.836", "5.176", "− 3.512", "4.023", "5.332", "− 1.378", "3.349", "6.071", "− 0.923", "3.854", "5.825", "− 0.966", "3.672"], ["HIM11", "3.775", "− 6.079", "0.898", "6.998", "− 2.086", "3.842", "8.678", "− 1.065", "2.876", "5.087", "− 0.881", "1.854", "5.948", "− 1.015", "1.202"], ["HIM12", "0.190", "− 8.149", "0.022", "5.302", "− 2.305", "3.475", "5.227", "− 1.636", "0.710", "7.322", "− 1.128", "4.099", "6.237", "− 2.562", "2.171"], ["HIM13", "4.523", "− 4.537", "0.014", "4.840", "− 0.664", "3.305", "6.181", "− 2.966", "3.523", "5.281", "− 0.503", "3.981", "5.905", "− 1.136", "2.218"], ["HIM14", "5.247", "− 3.183", "0.000", "4.888", "− 1.296", "2.563", "5.037", "− 0.377", "1.647", "7.057", "− 0.799", "4.256", "6.116", "− 1.366", "2.438"], ["HIM15", "4.633", "− 4.173", "0.180", "3.756", "− 0.710", "2.072", "5.188", "− 1.559", "1.143", "5.570", "− 1.125", "3.718", "6.238", "− 1.708", "2.443"], ["HIM16", "4.588", "− 2.883", "0.000", "6.027", "− 1.099", "3.903", "5.606", "− 0.987", "4.197", "5.661", "− 0.926", "2.751", "7.263", "− 1.533", "4.212"], ["HIM17", "3.944", "− 4.806", "0.236", "5.329", "− 0.590", "2.798", "4.830", "− 1.682", "1.617", "6.234", "− 0.830", "3.912", "5.366", "− 1.257", "3.022"], ["HTZ1", "0.593", "− 7.518", "0", "4.221", "− 0.692", "1.975", "3.993", "− 0.539", "0.003", "5.284", "− 0.566", "1.432", "5.227", "− 1.045", "0.903"], ["HTZ2", "− 1.770", "− 8.477", "0.000", "4.055", "− 1.438", "2.877", "4.388", "− 1.665", "1.170", "4.100", "− 0.546", "3.017", "4.563", "− 0.976", "1.266"], ["HTZ3", "4.649", "− 5.870", "0.148", "5.104", "− 0.861", "3.922", "4.243", "− 1.539", "1.933", "5.304", "− 1.370", "1.398", "5.138", "− 1.217", "1.930"], ["HTZ4", "− 3.169", "− 12.002", "0.482", "4.173", "− 1.898", "1.864", "4.654", "− 1.627", "1.128", "5.163", "− 0.745", "1.304", "5.084", "− 1.143", "1.018"], ["HTZ5", "4.021", "− 12.325", "0.246", "3.215", "− 1.481", "4.232", "3.256", "− 6.374", "2.317", "2.382", "− 5.263", "1.238", "4.623", "− 0.951", "1.280"], ["HTZ6", "6.605", "− 3.866", "1.6487", "4.004", "− 1.104", "2.851", "5.834", "− 1.310", "3.111", "5.286", "− 1.530", "1.436", "6.336", "− 2.326", "3.781"], ["HTZ7", "4.977", "− 5.434", "0.655", "5.197", "− 2.040", "3.250", "5.352", "− 1.371", "1.172", "6.138", "− 1.734", "1.627", "4.908", "− 1.057", "1.335"], ["HTZ8", "1.025", "− 8.223", "0.000", "3.549", "− 1.310", "2.403", "4.024", "− 3.825", "2.440", "4.980", "− 0.593", "1.474", "5.164", "− 1.291", "0.999"], ["HTZ9", "3.386", "− 7.041", "0.194", "5.567", "− 1.622", "3.057", "6.792", "− 2.581", "1.088", "5.794", "− 0.683", "1.774", "6.053", "− 1.408", "1.037"], ["HTZ10", "4.744", "− 5.463", "0.837", "4.520", "− 2.469", "3", "7.758", "− 1.518", "3.765", "5.345", "− 1.133", "3.661", "7.507", "− 2.080", "4.086"], ["HTZ11", "2.991", "− 6.177", "0", "3.453", "− 0.721", "1.266", "4.841", "− 1.738", "0.045", "4.368", "− 0.805", "1.074", "6.176", "− 1.380", "1.511"], ["HTZ12", "4.810", "− 6.157", "0.275", "5.296", "− 2.814", "3.605", "5.138", "− 1.840", "2.189", "5.083", "− 0.870", "1.536", "5.592", "− 1.321", "1.525"], ["HTZ13", "4.868", "− 3.837", "0", "4.863", "− 0.535", "2.405", "4.656", "− 0.681", "3.152", "4.246", "− 2.335", "0.529", "6.404", "− 0.975", "2.954"], ["HTZ14", "5.646", "− 3.473", "0", "4.948", "− 0.801", "2.324", "4.953", "− 1.672", "1.066", "5.058", "− 1.174", "1.121", "5.114", "− 1.299", "1.296"], ["HTZ15", "3.428", "− 4.957", "0.348", "3.949", "− 0.614", "1.873", "4.049", "− 0.787", "1.224", "4.796", "− 1.066", "1.489", "3.510", "− 0.607", "0.461"], ["HTZ16", "4.227", "− 4.787", "0.298", "4.654", "− 1.534", "2.096", "6.143", "− 1.204", "2.879", "4.854", "− 0.994", "1.564", "7.102", "− 0.917", "3.001"], ["HTZ17", "3.784", "− 5.018", "0.380", "3.661", "− 0.897", "1.676", "4.016", "− 1.179", "1.384", "4.039", "− 0.569", "2.706", "4.256", "− 1.040", "1.236"], ["HTZSTD", "4.722", "− 1.084", "1.063", "3.319", "− 0.890", "3.033", "3.564", "− 0.272", "2.367", "3.394", "− 0.882", "1.169", "4.237", "− 0.801", "1.855"]], "row_count": 38, "column_count": 16, "numeric_cells": 548, "header_rows": 3, "locator": "section[20]/table-wrap[1]#Tab6"}}], "gaps": []}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "DEGs of dataset GSE141910 between HF groups and non heart failure groups were respectively analyzed using the limma package in R [21]."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": [], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34218797", "asset:table:pmid:34218797:1", "asset:table:pmid:34218797:2", "asset:table:pmid:34218797:3", "asset:table:pmid:34218797:4", "asset:table:pmid:34218797:5", "asset:table:pmid:34218797:6", "asset:table:pmid:34218797:7", "asset:table:pmid:34218797:8", "asset:table:pmid:34218797:9", "asset:table:pmid:34218797:10", "asset:table:pmid:34218797:11"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:39:47Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 68038, "completion_tokens": 970, "cached_tokens": 44800}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34218797", "type": "paper", "label": "pmid:34218797"}, {"id": "source:pmid:34218797", "type": "manuscript", "label": "PMID 34218797 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34218797", "type": "paper", "label": "pmid:34218797"}, {"id": "source:pmid:34218797", "type": "manuscript", "label": "PMID 34218797 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34218797", "type": "extraction", "used": ["source:pmid:34218797"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34218797", "parent_hash": "sha256:e6bf6ace0392e9822ef4350372a36c0a6b1bbe69d469a6ff10f1aa0a6a91e8cd", "fork_of": null, "generation": 7}, "gaps": ["execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["DEGs of dataset GSE141910 between HF groups and non heart failure groups were respectively analyzed using the limma package in R [21]."], "order_basis": "analysis_only", "id": "assay:1"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T03:14:03+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}