{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34266408", "kind": "science-record", "revision": 7, "content_hash": "sha256:849e19661fdf9a27aaccd0a5422d3a0da717bfedb204a437ab034df4975d9684", "created_at": "2026-11-01T15:41:43Z", "updated_at": "2026-11-01T22:04:14Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Oncogenic role of ALX3 in cervical cancer cells through KDM2B-mediated histone demethylation of CDC25A.", "doi": "10.1186/s12885-021-08552-7", "pmid": "34266408", "authors": ["Jinhong Qi", "Li Zhou", "Dongqing Li", "Jingyuan Yang", "He Wang", "Huifang Cao", "Yunlan Huang", "Zhiming Zhang", "Linlin Chang", "Chenhao Zhu", "Juntong Zhan", "Yong Yuan"], "journal": "BMC cancer", "year": 2021, "abstract": "BACKGROUND: Cell division cycle 25A (CDC25A) is a well-recognized regulator of cell cycle progression and is involved in cancer development. This work focused on the function of CDC25A in cervical cancer cell growth and the molecules involved.\nMETHODS: A GEO dataset GSE63514 comprising data of cervical squamous cell carcinoma (CSCC) tissues was used to screen the aberrantly expressed genes in cervical cancer. The CDC25A expression in cancer and normal tissues was predicted in the GEPIA database and that in CSCC and normal cells was determined by RT-qPCR and western blot assays. Downregulation of CDC25A was introduced in CSCC cells to explore its function in cell growth and the cell cycle progression. The potential regulators of CDC25A activity and the possible involved signaling were explored.\nRESULTS: CDC25A was predicted to be overexpressed in CSCC, and high expression of CDC25A was observed in CSCC cells. Downregulation of CDC25A in ME180 and C33A cells reduced cell proliferation and blocked cell cycle progression, and it increased cell apoptosis. ALX3 was a positive regulator of CDC25A through transcription promotion. It recruited a histone demethylase, lysine demethylase 2B (KDM2B), to the CDC25A promoter, which enhanced CDC25A expression through demethylation of H3k4me3. Overexpression of ALX3 in cells blocked the inhibitory effects of CDC25A silencing. CDC25A was found as a positive regulator of the PI3K/Akt signaling pathway.\nCONCLUSION: This study suggested that the ALX3 increased CDC25A expression through KDM2B-mediated demethylation of H3K4me3, which induced proliferation and cell cycle progression of cervical cancer cells.", "claims": [{"id": "claim-data-access", "statement": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34266408", "locator": "sections[36] \"notes\" paragraph 1", "quote": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34266408"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE63514"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE63514"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34266408", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12885-021-08552-7", "sha256": "sha256:9495004ca6e20669530a58d11052493d8217a6b1e8fd017a7174ed7d0636bf29", "bytes": 45943, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12885-021-08552-7", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8284019", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE63514", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE63514", "version": null, "note": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1551311", "GSM1551312", "GSM1551313", "GSM1551314", "GSM1551315", "GSM1551316", "GSM1551317", "GSM1551318", "GSM1551319", "GSM1551320", "GSM1551321", "GSM1551322", "GSM1551323", "GSM1551324", "GSM1551325", "GSM1551326", "GSM1551327", "GSM1551328", "GSM1551329", "GSM1551330", "GSM1551331", "GSM1551332", "GSM1551333", "GSM1551334", "GSM1551335", "GSM1551336", "GSM1551337", "GSM1551338", "GSM1551339", "GSM1551340", "GSM1551341", "GSM1551342", "GSM1551343", "GSM1551344", "GSM1551345", "GSM1551346", "GSM1551347", "GSM1551348", "GSM1551349", "GSM1551350", "GSM1551351", "GSM1551352", "GSM1551353", "GSM1551354", "GSM1551355", "GSM1551356", "GSM1551357", "GSM1551358", "GSM1551359", "GSM1551360", "GSM1551361", "GSM1551362", "GSM1551363", "GSM1551364", "GSM1551365", "GSM1551366", "GSM1551367", "GSM1551368", "GSM1551369", "GSM1551370", "GSM1551371", "GSM1551372", "GSM1551373", "GSM1551374", "GSM1551375", "GSM1551376", "GSM1551377", "GSM1551378", "GSM1551379", "GSM1551380", "GSM1551381", "GSM1551382", "GSM1551383", "GSM1551384", "GSM1551385", "GSM1551386", "GSM1551387", "GSM1551388", "GSM1551389", "GSM1551390", "GSM1551391", "GSM1551392", "GSM1551393", "GSM1551394", "GSM1551395", "GSM1551396", "GSM1551397", "GSM1551398", "GSM1551399", "GSM1551400", "GSM1551401", "GSM1551402", "GSM1551403", "GSM1551404", "GSM1551405", "GSM1551406", "GSM1551407", "GSM1551408", "GSM1551409", "GSM1551410", "GSM1551411", "GSM1551412", "GSM1551413", "GSM1551414", "GSM1551415", "GSM1551416", "GSM1551417", "GSM1551418", "GSM1551419", "GSM1551420", "GSM1551421", "GSM1551422", "GSM1551423", "GSM1551424", "GSM1551425", "GSM1551426", "GSM1551427", "GSM1551428", "GSM1551429", "GSM1551430", "GSM1551431", "GSM1551432", "GSM1551433", "GSM1551434", "GSM1551435", "GSM1551436", "GSM1551437", "GSM1551438"], "sample_count": 128, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression analysis of cervical cancer progression", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34266408:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f5b9fe557260e6356293be693a78f8c0337d6b738d1cf5c7b382f24ce58aa8b4", "bytes": 489, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#Tab1", "version": null, "note": "Primer sequences for RT-qPCR", "structure": {"pmcid": "PMC8284019", "section_index": 6, "section_title": "RT-qPCR", "row_count": 9, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer sequences for RT-qPCR", "rows": [["Gene", "Primer sequence (5′-3′)"], ["CDC25A", "F: TCTGGACAGCTCCTCTCGTCAT"], ["R: ACTTCCAGGTGGAGACTCCTCT"], ["ALX3", "F: GGAGAAGGTCTTCCAGAAAACCC"], ["R: ACTTGGCTCTGCGGTTCTGGAA"], ["KDM2B", "F: CATGGAGTGCTCCATCTGCAATG"], ["R: ACTTCGGACACTCCCAGCAGTT"], ["GAPDH", "F: GTCTCCTCTGACTTCAACAGCG"], ["R: ACCACCCTGTTGCTGTAGCCAA"]], "row_count": 9, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[6]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:34266408:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:75ec2e7f67160051c356dcef1aba190c7af453cce2f03e86f463d6e299bec0d5", "bytes": 1600, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#Tab2", "version": null, "note": "DEGs in the GSE63514 dataset", "structure": {"pmcid": "PMC8284019", "section_index": 20, "section_title": "CDC25A is highly expressed in cervical cancer samples", "row_count": 25, "column_count": 6}, "table": {"label": "Table 2", "caption": "DEGs in the GSE63514 dataset", "rows": [["Gene Symbol", "logFC", "adj.p.Val", "Gene Symbol", "logFC", "adj.p.Val"], ["CDC25A", "3.41", "5.46E-33", "KIF14", "2.44", "2.76E-08"], ["CDC7", "2.44", "1.90E-12", "TTK", "2.07", "3.27E-08"], ["DTL", "2.88", "4.02E-12", "DDIAS", "2.64", "3.71E-08"], ["RMI2", "2.25", "5.17E-12", "HENMT1", "2.86", "4.81E-08"], ["CRISP2", "−4.18", "1.29E-11", "CRISP3", "−5.67", "1.14E-07"], ["UHRF1", "2.23", "1.29E-11", "C1orf112", "2.15", "1.31E-07"], ["CENPK", "2.39", "1.29E-11", "APOBEC3B", "2.31", "1.61E-07"], ["WDHD1", "2.34", "6.56E-11", "DNA2", "2.13", "2.74E-07"], ["ZNF367", "2.18", "1.14E-10", "SYNGR3", "3.44", "3.42E-07"], ["POLE2", "2.45", "5.03E-10", "KIF15", "2.39", "3.67E-07"], ["TIPIN", "2.12", "1.36E-09", "NUSAP1", "2.06", "4.16E-07"], ["CDKN2A", "2.68", "1.56E-09", "CTTNBP2", "−2.17", "5.04E-07"], ["TCAM1P", "3.83", "2.27E-09", "TOM1", "−2.02", "5.19E-07"], ["PHYHIP", "−3.2", "3.95E-09", "CTA-384D8.35", "2.89", "5.58E-07"], ["SPAG5", "2.4", "4.49E-09", "MLF1", "2.62", "9.82E-07"], ["C5orf34", "2.2", "5.79E-09", "CENPE", "2.5", "1.18E-06"], ["CENPQ", "2.24", "5.91E-09", "HS6ST2", "2.44", "1.23E-06"], ["HMMR", "2.13", "7.29E-09", "CCDC64B", "−2.19", "1.61E-06"], ["CDC6", "2.34", "7.64E-09", "SLC5A1", "−2.12", "1.65E-06"], ["NUF2", "2.25", "7.64E-09", "FAM86A", "−2.13", "1.73E-06"], ["KIF4A", "2.19", "1.28E-08", "APOC1", "2.31", "1.73E-06"], ["PRIM1", "2.5", "2.06E-08", "GGTLC1", "−2.05", "1.73E-06"], ["SYCP2", "2.2", "2.26E-08", "CITED4", "−2.63", "1.95E-06"], ["ACOX2", "−2.02", "2.54E-08", "EPB41L3", "−2.43", "2.29E-06"]], "row_count": 25, "column_count": 6, "numeric_cells": 106, "header_rows": 1, "locator": "section[20]/table-wrap[1]#Tab2"}}], "gaps": ["asset:data:geo:GSE63514 not downloaded", "asset:data:geo:GSE63514 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-2", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "Limma"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE63514"], "resolved_accessions": ["GSE63514"], "statements": ["All the data generated or analyzed during this study are included in this published article. The GSE63514 dataset is available at (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514)."], "basis": "The paper names GSE63514 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:34266408", "data:geo:GSE63514", "asset:table:pmid:34266408:1", "asset:table:pmid:34266408:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE63514"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:41:40Z", "independence": "single_reader"}, "evidence_check": {"method": "absent", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 37377, "completion_tokens": 1928, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34266408", "type": "paper", "label": "pmid:34266408"}, {"id": "source:pmid:34266408", "type": "manuscript", "label": "PMID 34266408 full text"}, {"id": "data:geo:GSE63514", "type": "dataset", "label": "GEO GSE63514"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34266408", "type": "paper", "label": "pmid:34266408"}, {"id": "source:pmid:34266408", "type": "manuscript", "label": "PMID 34266408 full text"}, {"id": "data:geo:GSE63514", "type": "dataset", "label": "GEO GSE63514"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34266408", "type": "extraction", "used": ["source:pmid:34266408"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE63514", "type": "accession_resolution", "used": ["data:geo:GSE63514"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34266408", "parent_hash": "sha256:5dd94d54b665dc96b724385e3af0fd8cc852d6f110d18356c5b8c2ef03b3cdd7", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE63514 licence not read", "asset:data:geo:GSE63514 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["t in CSCC and normal cells was determined by RT-qPCR and western blot assays. Downregulation of C", "n CSCC and normal cells was determined by RT-qPCR and western blot assays. Downregulation of C", "ical epithelial cells (PCS480) determined by RT-qPCR and western blot analysis. Data were present", "l epithelial cells (PCS480) determined by RT-qPCR and western blot analysis. Data were present"], "order_basis": "paper_text_order:611", "id": "assay:1"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["d normal cells was determined by RT-qPCR and western blot assays. Downregulation of CDC25A was introdu", "ial cells (PCS480) determined by RT-qPCR and western blot analysis. Data were presented as the mean ±"], "order_basis": "paper_text_order:623", "id": "assay:2"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["ell cycle progression, and it increased cell apoptosis. ALX3 was a positive regulator of CDC25A thr"], "order_basis": "paper_text_order:1115", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["rt-sequence tandem repeat region. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) su", "ture CSCC cell lines (CaSki, ME180, C33A and Hela) and a primary cervix epithelial cell line (", "expression in CSCC cell lines (C33A, Caski, HeLa and ME180) and in PCS480 cells. Likewise, in", "n of CDC25A in CSCC cell lines (C33A, Caski, HeLa and ME180) and normal cervical epithelial ce"], "order_basis": "paper_text_order:1783", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["analysis of variance"], "order_basis": "consumes_earlier_output", "id": "assay:5"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:38:21+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}