{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34426785", "kind": "science-record", "revision": 7, "content_hash": "sha256:ac06b8907d9b668e446c90593cedbf8cecc5b9336ee09f6450049412d8ac438b", "created_at": "2026-11-01T15:41:49Z", "updated_at": "2026-11-01T22:04:32Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Genotypic Characteristics of Hepatoblastoma as Detected by Next Generation Sequencing and Their Correlation With Clinical Efficacy.", "doi": "10.3389/fonc.2021.628531", "pmid": "34426785", "authors": ["Huimin Hu", "Weiling Zhang", "Tian Zhi", "Jing Li", "Yuan Wen", "Fan Li", "Yanyan Mei", "Dongsheng Huang"], "journal": "Frontiers in oncology", "year": 2021, "abstract": "BACKGROUND: Hepatoblastoma (HB) is the most common malignant embryonic liver tumor type in children under 3 years of age. In the present study, the next generation sequencing (NGS) method was used to detect the genotype characteristics of HB and summarize the correlation between the common mutation genotypes noted in this disease and the clinical treatment and prognosis. The results may aid clinical prognosis and the successful application of targeted drugs.\nMETHODS: Initially, DNA was extracted from tumor tissue specimens and peripheral blood derived from 19 pediatric patients with HB. Subsequently, DNA panel and NGS methods were used to detect tumor diagnosis and the expression levels of treatment-associated genes, followed by the summary of genotype characteristics. In addition, in order to further assess the application of immunotherapy in HB, immunohistochemical detection of programmed cell death 1 ligand 1 (PDL1) was performed in combination with tumor mutation burden (TMB) and DNA mismatch repair status analysis. Furthermore, the clinical treatment effect and prognosis of the pediatric patients were statistically analyzed according to the characteristics of the genotype. Overall prognosis and prognostic analyses in different groups were performed by Kaplan-Meier and log-rank tests, respectively. Finally, expression validation and diagnostic analysis of commonly reported genes were performed in the GSE75271 dataset, which was obtained from the Gene Expression Omnibus (GEO) database.\nRESULTS: In the present study, certain mutated genes, including nuclear factor erythroid 2-related factor 2 (NFE2L2), catenin β1 (CTNNB1), MYCN, tumor protein p53, axis inhibition protein 1 (AXIN1) and adenomatous polyposis coli (APC) were associated with the pathogenesis of HB. During TMB and DNA mismatch repair status analyses, pediatric patients had a low TMB. All of them did not present with microsatellite instability. The immunohistochemical results indicated lower expression levels of PDL1 in HB. The complete remission (CR) rate of pediatric patients in the gene abnormality group was lower than that of the non-reported disease-associated gene abnormality group. The 2-year overall survival rate and disease-free survival rate of 19 pediatric patients with HB were 72.1% and 42.4%, respectively. Receiver operating characteristic (ROC) analysis demonstrated that CTNNB1, NFE2L2, AXIN1, APC, MYCN and insulin growth factor 2 (IGF2) may be potential biomarkers that could be used for the diagnosis of HB.\nCONCLUSION: The genotype changes in HB were more common and the CR rate of the pediatric patients with an altered genotype was lower than that of pediatric patients without an altered genotype. In addition, pediatric patients with HB exhibited lower TMB compared with adult patients. Moreover, the data indicated that CTNNB1, NFE2L2, AXIN1, APC, MYCN and IGF2 may be potential biomarkers that can be used for the diagnosis of HB.", "claims": [{"id": "claim-data-access", "statement": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34426785", "locator": "sections[22] \"Data Availability Statement\" paragraph 2", "quote": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34426785"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE75271"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:group_comparison_wilcoxon", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE75271"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:group_comparison_wilcoxon"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34426785", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fonc.2021.628531", "sha256": "sha256:34af2dd697650fa54548a89478b5c576e531a47db1c44a251f694dfe32eaa5a6", "bytes": 44807, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fonc.2021.628531", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8379014", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE75271", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE75271", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE75271", "version": null, "note": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1948559", "GSM1948560", "GSM1948561", "GSM1948562", "GSM1948563", "GSM1948564", "GSM1948565", "GSM1948566", "GSM1948567", "GSM1948568", "GSM1948569", "GSM1948570", "GSM1948571", "GSM1948572", "GSM1948573", "GSM1948574", "GSM1948575", "GSM1948576", "GSM1948577", "GSM1948578", "GSM1948579", "GSM1948580", "GSM1948581", "GSM1948582", "GSM1948583", "GSM1948584", "GSM1948585", "GSM1948586", "GSM1948587", "GSM1948588", "GSM1948589", "GSM1948590", "GSM1948591", "GSM1948592", "GSM1948593", "GSM1948594", "GSM1948595", "GSM1948596", "GSM1948597", "GSM1948598", "GSM1948599", "GSM1948600", "GSM1948601", "GSM1948602", "GSM1948603", "GSM1948604", "GSM1948605", "GSM1948606", "GSM1948607", "GSM1948608", "GSM1948609", "GSM1948610", "GSM1948611", "GSM1948612", "GSM1948613"], "sample_count": 55, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "mRNA profiles of 50 HB tumors", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:PRJNA751247", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PRJNA751247", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PRJNA751247", "version": null, "note": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data presented in the study are deposited in the SRA repository, accession number PRJNA751247.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": null, "resolution_checked_at": "2026-10-31T18:35:56Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34426785:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b0befce98f8bb33962af439cc0685490dde1aa9224a304b62474063bcb77c394", "bytes": 1532, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T1", "version": null, "note": "Clinical features of 19 pediatric patients with HB.", "structure": {"pmcid": "PMC8379014", "section_index": 14, "section_title": "Clinical Features of 19 Pediatric Patients With HB", "row_count": 40, "column_count": 3}, "table": {"label": "Table 1", "caption": "Clinical features of 19 pediatric patients with HB.", "rows": [["Feature", "Number of cases", "Proportion (%)"], ["Initial symptom", "", ""], ["Abdominal mass and liver space are occupied", "9", "47.37%"], ["Abdominal pain and bloating", "9", "47.37%"], ["Fever, fatigue and wasting", "1", "5.26%"], ["AFP value at onset (ng/mL)", "", ""], ["726-2170000, median: 31877", "", ""], ["<100", "0", "0"], ["≥100", "19", "100%"], ["PRETEXT staging", "", ""], ["PRETEXT II", "5", "26.32%"], ["PRETEXT III", "11", "57.89%"], ["PRETEXT IV", "3", "15.79%"], ["Intrahepatic lesion at onset", "", ""], ["Single lesion", "13", "68.42%"], ["Many lesions", "6", "31.58%"], ["COG staging", "", ""], ["COG II", "4", "21.05%"], ["COG III", "6", "31.58%"], ["COG IV", "9", "47.37%"], ["Pulmonary metastatic disease", "7", "36.84%"], ["Single lung metastasis", "2", "10.53%"], ["Double lung metastasis", "5", "26.32%"], ["Other distant metastases", "", ""], ["Osseous metastasis", "1", "5.26%"], ["Brain metastases", "1", "5.26%"], ["Other high risk factors affecting prognosis", "", ""], ["V+", "2", "10.53%"], ["P+", "2", "10.53%"], ["E+", "2", "10.53%"], ["H+", "1", "5.26%"], ["N+", "2", "10.53%"], ["Pathological type", "", ""], ["Epithelium type", "12", "63.16%"], ["Fetal type", "2", "10.53%"], ["Embryonal", "1", "5.26%"], ["Fetal and embryonic mixed type", "7", "36.84%"], ["Giant beam type", "1", "5.26%"], ["Embryo and giant beam mixed type", "1", "5.26%"], ["Epithelium and lobus intermedius mixed type", "7", "36.84%"]], "row_count": 40, "column_count": 3, "numeric_cells": 63, "header_rows": 1, "locator": "section[14]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:34426785:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:bb230bdd1511bf6a43eb5674f6ad1f7c142828ad274052e8f8dc9d3049ff3c13", "bytes": 3991, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#T2", "version": null, "note": "Specific genotypes of 19 clinical pediatric patients with HB. HB, hepatoblastoma.", "structure": {"pmcid": "PMC8379014", "section_index": 15, "section_title": "Genotypic Characteristics of Next-Generation Sequencing", "row_count": 43, "column_count": 13}, "table": {"label": "Table 2", "caption": "Specific genotypes of 19 clinical pediatric patients with HB. HB, hepatoblastoma.", "rows": [["Medical record No", "Genetic changes associated with HB paroxysm", "Abundance / Amplification multiple", "Unknown genetic change", "Abundance / Amplification multiple", "MSI", "TMB", "PDL1", "Pathological type", "β-catenin", "Recurrence or metastasis", "Survival time", "Prognosis"], ["1", "NFE2L2 c.230A>G p.D77G", "48.30%", "KMT2D c.5467G>T p.G1823X", "11.70%", "MSS", "3.9", "<1%", "Epithelium and lobus intermedius mixed type", "Positive", "Metastasis", "9", "PR"], ["NUP210L c.4475G>A p.G1492E", "20.00%"], ["ARID1A c. 2714C>G p.A905G", "18.50%"], ["TRIM23 c.868G>T p.A290S", "16.80%"], ["PTPRB c.5432A>G p.K1811R", "11.90%"], ["AURKA amplification", "1.51"], ["2", "", "", "", "", "MSS", "0", "<1%", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence", "17", "CR"], ["3", "", "", "ARID1A", "37.20%", "MSS", "1.69", "1.00%", "Fetal and embryonic mixed type", "Positive", "Recurrence", "29", "CR"], ["c.4764-4770delT p.A1589fs"], ["4", "NFE2L2 c.92G>C p.G31A", "22.00%", "EP300 c.3244_3245delinsTT p.Q1082L", "48.70%", "MSS", "1.69", "<1%", "Fetal type", "Positive", "Recurrence", "21", "CR"], ["PARP1 c.2680G>T p.G894N", "29.00%"], ["5", "CTNNB1 c.101G>T p.G34V", "11.60%", "", "", "MSS", "3.18", "", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence", "23", "PR"], ["6", "", "", "", "", "MSS", "0", "", "Fetal and embryonic mixed type", "Positive", "No", "12", "CR"], ["7", "MYCN amplification", "1.5", "TCF7L2 c.1258C>T p.R420W", "26.00%", "MSS", "2.25", "1-2%", "Epithelium and lobus intermedius mixed type", "Focal positive", "Recurrence", "22", "Dead"], ["MED12 c.5382G>T p.Q1794H", "24.70%"], ["8", "", "", "USP9X c.1916C>T p.P639L", "37.90%", "MSS", "3.93", "2.00%", "Embryo and giant trabecular mixed type", "Positive", "Recurrence", "15", "PR"], ["NOTCH3 c.3991C>G p.P1331A", "10.20%"], ["9", "CTNNB1 c.1003A>C p.K335Q", "45.50%", "", "", "MSS", "1.69", "", "Fetal and embryonic mixed type", "Positive", "Recurrence", "30", "Dead"], ["10", "", "", "BCL6 c.959A>G p.N320S", "12.70%", "MSS", "2.25", "", "Fetal type", "Positive", "Metastasis", "21", "CR"], ["HIST1H3F c.148C>G p.R50G", "11.90%"], ["11", "CTNNB1 c.94G>A p.D32N", "23.00%", "INPP4A c.959A>G p.N320S", "14.80%", "MSS", "", "", "Fetal and embryonic mixed type", "Positive", "Recurrence or metastasis", "17", "PD"], ["TP53 c.743G>A p.R248Q", "47.30%", "RFWD2 c.173C>G p.S58W", "13.90%"], ["12", "CTNNB1 c.121A>G p.T41A", "27.50%", "", "", "MSS", "", "", "Fetal and embryonic mixed type", "Positive", "No", "20", "CR"], ["13", "AXIN1", "13.11%", "EPHA7 c.1909C>T p.R637C", "7.16%", "MSS", "22", "", "giant beam type", "Positive", "Recurrence after PD", "50", "Dead"], ["c.516_537del CATGAAGCAGCTGATCGATCCT p.I172Mfs*63", "NRAS c.182A>G p.Q61R", "6.26%"], ["14", "APC c.5465T>A p.V1822D", "11.20%", "PIK3C2B c.533C>T p.P178L", "36.50%", "MSS", "5", "0", "Fetal type", "Positive", "Recurrence or metastasis", "40", "PR"], ["IGF2", "31.61%"], ["c.517_538dup ACACCTGGAAGCAGTCCACC p.Q180Rfs*78", ""], ["NORCH1 c.1820G>T p.C607F", ""], ["DICER1", "28.96%"], ["c.4082A>G p.K1361R", ""], ["c.4064A>G p.N1355S", "25.40%"], ["", "25.06%"], ["15", "CTNNB1 c.53_241+117del306", "47.50%", "", "", "MSS", "0", "", "Epithelium and lobus intermedius mixed type", "negative", "PD", "25", "Dead"], ["16", "CTNNB1", "21.20%", "NUP93 c.180-2A>T", "41.40%", "MSS", "1.34", "1-2%", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence or metastasis", "24", "CR"], ["c.66_95del p.His24_Ser33del", "PREX2 c.2741C>G p.A914G", "38.30%"], ["", "PAK7 c.1573T>C p.F525L", "28.60%"], ["17", "", "", "ATRX c.2701C>G p.I901V", "8.14%", "MSS", "9", "", "Epithelium and lobus intermedius mixed type", "Positive", "Recurrence", "9", "CR"], ["PTCH1 c.2479A>G p.S827G", "5.60%"], ["MPL c.173C>T p.A58VG", "6.40%"], ["18", "CTNNB1 c.94G>A p.D32N", "14.14%", "", "", "MSS", "4.8", "", "Fetal and embryonic mixed type", "Positive", "Recurrence", "15", "CR"], ["19", "", "", "", "", "MSS", "1.11", "", "Fetal and embryonic mixed type", "Positive", "Recurrence", "23", "CR"]], "row_count": 43, "column_count": 13, "numeric_cells": 147, "header_rows": 1, "locator": "section[15]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:GSE75271 not downloaded", "asset:data:geo:GSE75271 licence not read", "asset:data:geo:PRJNA751247 not downloaded", "asset:data:geo:PRJNA751247 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "wilcoxon", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "reordered", "quote": "“Expression verification was performed using the Wilcoxon signed-rank test in order to analyze significant differences.” “Expression validation and diagnostic analyses of commonly reported genes were performed in the GSE75271 dataset (involving 50 HB samples and five normal controls), which was obtained from the Gene Expression Omnibus (GEO) database (19).”"}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "log-rank"}}], "targets": [], "gaps": ["method.group_comparison_wilcoxon"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: wilcoxon."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["PRJNA751247", "GSE75271"], "resolved_accessions": ["GSE75271"], "statements": ["The data presented in the study are deposited in the SRA repository, accession number PRJNA751247."], "basis": "The paper names GSE75271 in SRA repository and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:34426785", "data:geo:GSE75271", "asset:table:pmid:34426785:1", "asset:table:pmid:34426785:2"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "group_comparison_wilcoxon", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE75271"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:33:51Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 35961, "completion_tokens": 1022, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34426785", "type": "paper", "label": "pmid:34426785"}, {"id": "source:pmid:34426785", "type": "manuscript", "label": "PMID 34426785 full text"}, {"id": "data:geo:GSE75271", "type": "dataset", "label": "GEO GSE75271"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34426785", "type": "paper", "label": "pmid:34426785"}, {"id": "source:pmid:34426785", "type": "manuscript", "label": "PMID 34426785 full text"}, {"id": "data:geo:GSE75271", "type": "dataset", "label": "GEO GSE75271"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34426785", "type": "extraction", "used": ["source:pmid:34426785"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE75271", "type": "accession_resolution", "used": ["data:geo:GSE75271"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34426785", "parent_hash": "sha256:0340eb34e732ebea7f7bdf9adff255884a52c9dd9bc0a9d4384ab0917c68609d", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE75271 licence not read", "asset:data:geo:GSE75271 not downloaded", "asset:data:geo:PRJNA751247 licence not read", "asset:data:geo:PRJNA751247 not downloaded", "execution.not_run", "method.group_comparison_wilcoxon", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:group_comparison_wilcoxon"], "assays": [{"role": "data_generation", "definition_id": "amplicon_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["esent study, the next generation sequencing (NGS) method was used to detect the genotype char", "atients with HB. Subsequently, DNA panel and NGS methods were used to detect tumor diagnosis", "nstability (MSI) (17). In the present study, NGS method was used to evaluate the length distr"], "order_basis": "paper_text_order:263", "id": "assay:1"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["sess the application of immunotherapy in HB, immunohistochemical detection of programmed cell death 1 ligand", "present with microsatellite instability. The immunohistochemical results indicated lower expression levels of"], "order_basis": "paper_text_order:947", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["“Expression verification was performed using the Wilcoxon signed-rank test in order to analyze significant differences.” “Expression validation and diagnostic analyses of commonly reported genes were performed in the GSE75271 dataset (involving 50 HB samples and five normal controls), which was obtained from the Gene Expression Omnibus (GEO) database (19).”"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:53:12+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}