{"data":{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34581419", "kind": "science-record", "revision": 9, "content_hash": "sha256:8085da66239b525041b57d60bff4e3a368177e53c9605b269ac1dddc9f528079", "created_at": "2026-11-01T15:41:54Z", "updated_at": "2026-11-01T22:47:37Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "BCG immunotherapy inhibits cancer progression by promoting the M1 macrophage differentiation of THP‑1 cells via the Rb/E2F1 pathway in cervical carcinoma.", "doi": "10.3892/or.2021.8196", "pmid": "34581419", "authors": ["Limin Liu", "Wenjuan Shi", "Xiao Xiao", "Xuemei Wu", "Haiyan Hu", "Shixin Yuan", "Kai Liu", "Zhihua Liu"], "journal": "Oncology reports", "year": 2021, "abstract": "Bacillus Calmette‑Guérin (BCG) immunotherapy increases macrophage polarization toward M1‑type macrophages. In the present study, to identify the M1/M2 marker genes in the carcinogenesis and progression of cervical cancer, the microarray datasets GSE9750 and GSE7803 were downloaded from The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO) and the University of California Santa Cruz (UCSC) Xena browser. Survival analysis revealed that M1 markers (IL‑12) were involved in anti‑tumour progression, and M2 markers (IL‑10) were involved in the carcinogenesis and invasion of cervical cancer. The expression of M1 markers (IL‑12, inducible nitric oxide synthase and CD80) and M2 markers (IL‑10 and arginase) was examined to determine whether BCG affects the polarization of macrophages and to elucidate the underlying mechanisms. The results revealed that BCG promoted macrophage polarization towards the M1 phenotype and enhanced the transition of M2 to M1 macrophages. The results also revealed that polarized M1 macrophages induced by BCG decreased the protein expression of phosphorylated (p‑)retinoblastoma (Rb)/E2F transcription factor 1 (E2F1), inhibited the proliferation and promoted the apoptosis of HeLa cells. On the whole, these results demonstrated that BCG promoted the anti‑tumour progression of M1 macrophages and inhibited the pro‑tumour activation of M2 macrophages via the Rb/E2F1 signalling pathway in HeLa cells. This suggests the possibility of a direct translation of this combination strategy to clinical practice for the treatment of cervical cancer.", "claims": [{"id": "claim-method", "statement": "The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34581419", "locator": "sections[5] \"Survival analysis\" paragraph 2", "quote": "The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34581419", "locator": "sections[4] \"Cervical cancer datasets and pre-processing\" paragraph 2", "quote": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34581419"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE7803"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE7803"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34581419", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3892/or.2021.8196", "sha256": "sha256:3b7806f6b99c11b369b64e40e564ef23d968c334ed983d849f11fefcfb2dd716", "bytes": 50842, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3892/or.2021.8196", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8493057", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE7803", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE7803", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE7803", "version": null, "note": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM189381", "GSM189382", "GSM189383", "GSM189384", "GSM189385", "GSM189386", "GSM189387", "GSM189388", "GSM189389", "GSM189390", "GSM189391", "GSM189392", "GSM189393", "GSM189394", "GSM189395", "GSM189396", "GSM189397", "GSM189398", "GSM189399", "GSM189400", "GSM189401", "GSM189402", "GSM189403", "GSM189404", "GSM189405", "GSM189406", "GSM189407", "GSM189408", "GSM189409", "GSM189410", "GSM189411", "GSM189412", "GSM189413", "GSM189414", "GSM189415", "GSM189416", "GSM189417", "GSM189418", "GSM189419", "GSM189420", "GSM189421"], "sample_count": 41, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Human pre-invasive and invasive cervical squamous cell carcinomas and normal cervical epithelia", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE9750", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE9750", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE9750", "version": null, "note": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM246087", "GSM246088", "GSM246089", "GSM246090", "GSM246119", "GSM246120", "GSM246121", "GSM246122", "GSM246123", "GSM246422", "GSM246423", "GSM246484", "GSM246485", "GSM246486", "GSM246487", "GSM246488", "GSM246489", "GSM246490", "GSM246491", "GSM247162", "GSM247163", "GSM247164", "GSM247165", "GSM247166", "GSM247168", "GSM247169", "GSM247171", "GSM247173", "GSM247174", "GSM247175", "GSM247188", "GSM247189", "GSM247190", "GSM247650", "GSM247651", "GSM247652", "GSM247653", "GSM247654", "GSM247655", "GSM247656", "GSM247657", "GSM247658", "GSM247659", "GSM247660", "GSM247661", "GSM247662", "GSM247663", "GSM247856", "GSM247857", "GSM247859", "GSM247860", "GSM247862", "GSM247864", "GSM247865", "GSM247866", "GSM247876", "GSM247877", "GSM247878", "GSM247879", "GSM247881", "GSM247882", "GSM247883", "GSM247884", "GSM247885", "GSM247886", "GSM247887"], "sample_count": 66, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Identification of gene expression profiles in cervical cancer ", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34581419:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5c9cb39bb335097d47971b0d0ed1fea04814d7f210e046349f08632ecef4ef79", "bytes": 666, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#tI-or-0-0-8196", "version": null, "note": "Primer sequences used for RT-qPCR.", "structure": {"pmcid": "PMC8493057", "section_index": 10, "section_title": "Reverse transcription-quantitative PCR (RT-qPCR)", "row_count": 10, "column_count": 2}, "table": {"label": "Table I.", "caption": "Primer sequences used for RT-qPCR.", "rows": [["IL-10", "Forward primer: CACTGCTCTGTTGCCTGGTC"], ["", "Reverse primer: GAAGCATGTTAGGCAGGTTGC"], ["IL-12", "Forward primer: GGACCTTGGACCAGAGCAGT"], ["", "Reverse primer: GGCTTAGAACCTCGCCTCCT"], ["ARG", "Forward primer: TTGGCTTGAGAGACGTGGAC"], ["", "Reverse primer: CCATCACCTTGCCAATTCCT"], ["iNOS", "Forward primer: GAGCCAGGCCACCTCTATGT"], ["", "Reverse primer: GTCCTCGACCTGCTCCTCAT"], ["GAPDH", "Forward primer: CGGAGTCAACGGATTTGGTCGTAT"], ["", "Reverse primer: AGCCTTCTCCATGGTGGTGAAGAC"]], "row_count": 10, "column_count": 2, "numeric_cells": 2, "header_rows": 0, "locator": "section[10]/table-wrap[1]#tI-or-0-0-8196"}}, {"id": "asset:table:pmid:34581419:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:208a2dbeed3a552a186052fd76454bccc851ca65c47c6dd1f48f33c8758e9b11", "bytes": 1066, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#tII-or-0-0-8196", "version": null, "note": "GO and KEGG pathway enrichment analysis of DEGs in GSE 7803/9750 CESC samples.", "structure": {"pmcid": "PMC8493057", "section_index": 18, "section_title": "Identification, KEGG and GO enrichment analyses of DEGs in GSE7803/9750", "row_count": 15, "column_count": 4}, "table": {"label": "Table II.", "caption": "GO and KEGG pathway enrichment analysis of DEGs in GSE 7803/9750 CESC samples.", "rows": [["Pathway ID", "Description", "Count in gene set", "P-value"], ["GO:0051301", "Cell division", "66", "<0.001"], ["GO:0006260", "DNA replication", "43", "<0.001"], ["GO:0000082", "G1/S transition of mitotic cell cycle", "31", "<0.001"], ["GO:0000086", "G2/M transition of mitotic cell cycle", "29", "<0.001"], ["GO:0008283", "Cell proliferation", "47", "<0.001"], ["GO:0007049", "Cell cycle", "26", "<0.001"], ["GO:1901796", "Regulation of signal transduction by p53", "18", "<0.001"], ["GO:0075733", "Intracellular transport of virus", "10", "<0.001"], ["GO:0006955", "Immune response", "34", "<0.01"], ["GO:0043066", "Negative regulation of apoptotic process", "36", "<0.01"], ["hsa04110", "Cell cycle", "34", "<0.001"], ["hsa03030", "DNA replication", "18", "<0.001"], ["hsa03420", "Nucleotide excision repair", "9", "<0.01"], ["hsa04115", "p53 signalling pathway", "10", "<0.05"]], "row_count": 15, "column_count": 4, "numeric_cells": 44, "header_rows": 1, "locator": "section[18]/table-wrap[1]#tII-or-0-0-8196"}}], "gaps": ["asset:data:geo:GSE7803 not downloaded", "asset:data:geo:GSE7803 licence not read", "asset:data:geo:GSE9750 not downloaded", "asset:data:geo:GSE9750 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test."}}, {"id": "method-2", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Student's t-test"}}, {"id": "method-3", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-4", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "log-rank"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE9750", "GSE7803"], "resolved_accessions": ["GSE9750", "GSE7803"], "statements": ["The microarray datasets, GSE9750 and GSE7803 (Affymetrix GPL96 platform, Affymetrix Human Genome U133A Array), and TCGA-cervical squamous cell carcinoma (CESC) were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo) and UCSC Xena browser (https://xenabrowser.net/datapages/). The GSE9750 dataset contains 24 normal cervical tissue samples and 28 cervical cancer tissue samples."], "basis": "The paper names GSE9750, GSE7803 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:34581419", "data:geo:GSE7803", "asset:table:pmid:34581419:1", "asset:table:pmid:34581419:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE7803"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:50:40Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 28887, "completion_tokens": 2087, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34581419", "type": "paper", "label": "pmid:34581419"}, {"id": "source:pmid:34581419", "type": "manuscript", "label": "PMID 34581419 full text"}, {"id": "data:geo:GSE7803", "type": "dataset", "label": "GEO GSE7803"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34581419", "type": "paper", "label": "pmid:34581419"}, {"id": "source:pmid:34581419", "type": "manuscript", "label": "PMID 34581419 full text"}, {"id": "data:geo:GSE7803", "type": "dataset", "label": "GEO GSE7803"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34581419", "type": "extraction", "used": ["source:pmid:34581419"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE7803", "type": "accession_resolution", "used": ["data:geo:GSE7803"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34581419", "parent_hash": "sha256:5c1877a9e4fd17ac9e253ee79cfaef83678e6724adb5b93af4aa5fef91f38041", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE7803 licence not read", "asset:data:geo:GSE7803 not downloaded", "asset:data:geo:GSE9750 licence not read", "asset:data:geo:GSE9750 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["esis and progression of cervical cancer, the microarray datasets GSE9750 and GSE7803 were downloaded"], "order_basis": "paper_text_order:336", "id": "assay:1"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["inhibited the proliferation and promoted the apoptosis of HeLa cells. On the whole, these results d"], "order_basis": "paper_text_order:1313", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["proliferation and promoted the apoptosis of HeLa cells. On the whole, these results demonstra", "phages via the Rb/E2F1 signalling pathway in HeLa cells. This suggests the possibility of a di", "humidified incubator with 5% CO2. Cells were cultured in Roswell Park Memorial Institute medium (RPMI"], "order_basis": "paper_text_order:1327", "id": "assay:3"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The association between mRNA expression and overall survival (OS), or disease-free survival (DFS) was determined using the ‘Cox PH Model’ with the Kaplan-Meier survival plot. The survival curves of samples with high and low gene expression were compared using the log-rank test."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T01:50:19+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}