{"data":{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:39979267", "kind": "science-record", "revision": 2, "content_hash": "sha256:1873a34e2c19cf9458d0033665eef688ddf8b3f8cbed1717e6bc67ca002eaa51", "created_at": "2026-11-01T10:25:49Z", "updated_at": "2026-11-01T14:01:36Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "HNF4A mitigates sepsis-associated lung injury by upregulating NCOR2/GR/STAB1 axis and promoting macrophage polarization towards M2 phenotype.", "doi": "10.1038/s41419-025-07452-z", "pmid": "39979267", "authors": null, "journal": "Cell death & disease", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:39979267"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:39979267", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:39979267' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:39979267", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1038/s41419-025-07452-z", "sha256": "sha256:a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1038/s41419-025-07452-z", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:39979267:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c8aba1fd180d18bc6b20b40268dd328bec2345eccd5fc4aed97ad67bb2757b8a", "bytes": 663, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#Tab1", "version": null, "note": "primer sequences used in real-time PCR.", "structure": {"pmcid": "PMC11842871", "section_index": 15, "section_title": "Real-time PCR", "row_count": 3, "column_count": 3}, "table": {"label": "Table 1", "caption": "primer sequences used in real-time PCR.", "rows": [["primer", "Forward", "Reverse"], ["mus Arg-1mus CD163mus CD206mus HNF4Amus NCOA2", "TATCTGCCAAAGACATCGCAGCTTCGCTTGGTAGGGCAAGTGATTTGGAGGCTTGGTCGAGTGGGCCAAGTACTCATCCGTTCTCAGACTACTA", "ATCACCTTGCCAATCCCCACATTGGCATCAGTCATAATAGGAAACGGGAGAACCGTGCCGAGGGACGATGTAGATGCCCATTTGTTCCTTT"], ["mus Stab1mus iNOSmus MHCIImus GAPDH", "TGCTTCACTCCCTCAACTCACCACCCTCCTCGTTCCAGCCAAGATCAAAGTGCGTGTTCCTACCCCCAATGTGTCCGTC", "CCCAAGGCTAACTACACCCAATCCACAACTCGCTCCGCCAAGCCCGAGGAAGACTGGTCCTCAGTGTAGCCCAAGATG"]], "row_count": 3, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[15]/table-wrap[1]#Tab1"}}], "gaps": ["asset:source:pmid:39979267 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:39979267", "asset:table:pmid:39979267:1"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:39979267"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "blocked", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "1cb8ab65f2ddf8684878368a3823eb67eb965bbdcb32cf71c1fd8d406dd46ff7", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response_sha256": "sha256:0b2608b5d5232de35e63b090d6c23c7044d7320d72d982dfc1bd46243c78fcd0", "raw_response_chars": 3505}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "6be38c3f825e1f7263531219fc05bc2ac44230e621605ea77a39cc29ddd22db3", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response_sha256": "sha256:2960135d7c0921b3b17b917a7d8d62c02a2d0a1e2e3f760cc11c6d8312768429", "raw_response_chars": 50911}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "d1191e5a3dc2da54a9a615840070deca10f4af593eff7bba10e3cac853c1353a", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response": "{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"The paper states that HNF4A overexpression resulted in a higher survival rate in septic mice and amelioration of pulmonary damage, but it does not state the numerical survival rate or another headline numerical result for the main finding.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "The paper states that HNF4A overexpression resulted in a higher survival rate in septic mice and amelioration of pulmonary damage, but it does not state the numerical survival rate or another headline numerical result for the main finding.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:30:58.428773+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "251f9c4f4528b478c62cc4796af20bc8cbb182dd9f4e63d1704b49c6a04c0e3a", "source_hash": "a5c03eff9dbfc62aa27bc60194ff12264cfc39ad59699c9fbcbc099d8d4ba592", "raw_response": "<think>We need answer JSON only. Need determine source text contains headline numerical result for registered target? Source is abstract/methods snippets, no quantitative headline result except perhaps no survival rate numerical percentage, no main effect value. Need say number_stated false, parent_value 0, unit/evidence empty, target_result what text states instead. Need exact? Evidence empty due instruction if no number. target_result can summarize text states qualitative findings. Need not invent. JSON valid.\n\nQuestion nuanced: \"find the single numerical result that a replication of registered target has to reproduce. Report headline number only: value paper itself states for registered target\". The supplied text lacks headline numeric result. Could there be thresholds, 10 DEGs, but not headline main finding. So false.\n\nNeed make target_result perhaps \"The text states that HNF4A overexpression resulted in a higher survival rate in septic mice and amelioration of pulmonary damage...\" Maybe mention mechanistic axis. Since asks \"say in target_result what the text does state instead.\" Could use wording concise. Ensure no numerical claims? It says no number. We can state no numerical main-finding result; text reports qualitative outcomes. Evidence empty. Unit empty.\n\nNeed perhaps exact contiguous quote? Evidence only required exact quotation containing number; absent means empty. target_result likely prose. JSON with schema.</think>\n\n{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"No numerical value is stated for the main finding. The text reports that HNF4A overexpression resulted in a higher survival rate in septic mice, ameliorated pulmonary damage, reduced inflammatory-cell infiltration, impeded M1 polarization, and facilitated M2 polarization.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "No numerical value is stated for the main finding. The text reports that HNF4A overexpression resulted in a higher survival rate in septic mice, ameliorated pulmonary damage, reduced inflammatory-cell infiltration, impeded M1 polarization, and facilitated M2 polarization.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:30:59.793594+00:00"}], "agreement": false, "disagreements": {"target_result": {"minimax": "HNF4A overexpression resulted in a higher survival rate in septic mice, although no numerical survival value was reported.", "minimax_alt": "unclear — the closest headline result stated is that \"HNF4A overexpression resulted in a higher survival rate in septic mice,\" but no numerical survival value or effect size is provided in the supplied text.", "decisive": false}, "physical_methods": {"minimax": ["Cecal ligation and puncture mouse sepsis model", "Adenoviral HNF4A overexpression in mice", "Western blot analysis", "Flow cytometer analysis of macrophage polarization", "Interleukin-4 treatment of bone marrow-derived macrophages"], "minimax_alt": ["Cecal ligation and puncture (CLP) mouse sepsis model", "Adenovirus-vector-mediated HNF4A overexpression injected into mice", "In vitro interleukin-4 treatment of bone marrow-derived macrophages", "Transcriptome sequencing (mRNA-seq)", "Western blot analysis", "Flow cytometry analysis"], "decisive": false}, "analysis_methods": {"minimax": ["Transcriptomic analysis of lung tissues", "Differential expressed gene analysis using ∣log2FoldChange∣> 1 and −log10 (p-value) > 2.5", "Gene Ontology enrichment analysis", "Venn diagram analysis", "Transcriptome sequencing analysis"], "minimax_alt": ["Transcriptomic differential-expression analysis of CLP and sham lung tissues (|log2FoldChange| > 1 and −log10(p-value) > 2.5)", "Gene Ontology enrichment analysis of biological process and molecular function terms", "Venn diagram overlap analysis", "Western-blot band optical-density quantification using Gel-Pro-Analyzer", "Flow-cytometric assessment of M1/M2 macrophage polarization", "Two-group comparisons using two-tailed unpaired Student t-tests", "Three-or-more-group comparisons using one-way ANOVA with post hoc Tukey's tests", "Survival-curve comparison using the log-rank test and Kaplan–Meier plotting"], "decisive": false}, "statistical_method": {"minimax": "log-rank test", "minimax_alt": "Log-rank test for the survival comparison; Kaplan–Meier method for plotting the survival curve.", "decisive": true}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "blocked", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.blocked"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:0ac1f16e4cc6c0c62af99adcf55f5d4577e06674aa56e42284d55bb8e8656f98", "type": "sep_package", "label": "SEP v1 package for pmid:39979267"}], "activities": [{"id": "activity:conversion:pmid:39979267", "type": "conversion", "used": ["package:0ac1f16e4cc6c0c62af99adcf55f5d4577e06674aa56e42284d55bb8e8656f98"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:39979267", "parent_hash": "sha256:ac54179ed04682156e9f192bac66e8f748bc5a99689fa62131cb21794bf85504", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:39979267 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.blocked", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:39979267' does not resolve to a declared asset", "targets"]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:45:41+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}