{"data":{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:40746896", "kind": "science-record", "revision": 2, "content_hash": "sha256:e344e61aa59ed393615ca0db3a108b269fb9cfa01e982f31565f04a36ab4076a", "created_at": "2026-11-01T10:25:52Z", "updated_at": "2026-11-01T14:01:45Z", "generator": {"name": "corpus-assay-engine", "converter": "sep_to_sci_v1", "source_package_schema": "urn:bntrg:sep:1.0.0"}, "paper": {"state": "partial", "title": "OTUD7B Stabilization by METTL14-Mediated m6A Methylation Drives HIF-1α Expression in Esophageal Squamous Cell Carcinoma.", "doi": "10.32604/or.2025.061301", "pmid": "40746896", "authors": null, "journal": "Oncology research", "year": 2025, "abstract": null, "claims": [{"id": "claim-1", "statement": "the headline numerical result the paper states for its main finding", "kind": "qualitative", "state": "blocked", "target": {"value": null, "unit": null, "tolerance": null, "source": null}, "evidence": []}], "gaps": ["abstract", "authors"]}, "experiment": {"state": "partial", "objective": "the headline numerical result the paper states for its main finding", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate and its interval from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The number a replication must land on, and the sentence it came from.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:40746896"], "outputs": ["the published estimate, its unit and its interval"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data behind the published result", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:not_downloaded", "description": "The published result cannot be recomputed without the data the paper analysed.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the analysis programme", "kind": "analysis", "state": "blocked", "blocked_on": "no owned computational capability is bound to this experiment", "description": "Re-run the paper's analysis on the source data and produce the registered result. | SEP input not carried into the asset list: materials:the source data behind the published result in pmid:40746896", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the registered result"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40746896' does not resolve to a declared asset"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:40746896", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.32604/or.2025.061301", "sha256": "sha256:ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.32604/or.2025.061301", "version": null, "note": "Source read by the package builder: full_text.", "structure": {"access_state": "full_text"}}, {"id": "asset:table:pmid:40746896:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a00bd21218e9bae088e8c588f13360cab760bc5fdafa446a19ea684399b4a18a", "bytes": 567, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#table-1", "version": null, "note": "Antibodies used for western blotting", "structure": {"pmcid": "PMC12308248", "section_index": 8, "section_title": "Western Blotting", "row_count": 7, "column_count": 4}, "table": {"label": "Table 1", "caption": "Antibodies used for western blotting", "rows": [["Antibody", "Manufacturer", "Cat. No.", "Dilution"], ["Anti-METTL14", "Abcam (Cambridge, MA, USA)", "ab309096", "1:1000"], ["Anti-OTUD7B", "ProSci (Poway, CA, USA)", "57-615", "1:1000"], ["Anti-β-actin", "Beyotime", "AF5003", "1:2000"], ["Anti-YTHDF1", "Beyotime", "AF8382", "1:1000"], ["Anti-HIF-1α", "Beyotime", "AG2135", "1:1000"], ["HRP-labeled Goat Anti-Rabbit IgG", "Beyotime", "A0208", "1:1000"]], "row_count": 7, "column_count": 4, "numeric_cells": 14, "header_rows": 1, "locator": "section[8]/table-wrap[1]#table-1"}}, {"id": "asset:table:pmid:40746896:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d1140054a45871123e20a74eb6f26fa36b36b79311399bd9508f518d7a1bc153", "bytes": 503, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#table-2", "version": null, "note": "Primers used for PCR", "structure": {"pmcid": "PMC12308248", "section_index": 9, "section_title": "RNA Extraction and RT-qPCR Analysis", "row_count": 7, "column_count": 3}, "table": {"label": "Table 2", "caption": "Primers used for PCR", "rows": [["Gene", "Sequence", ""], ["METTL14 (Homo sapiens)", "Forward", "CTGAAAGTGCCGACAGCATTGG"], ["", "Reverse", "CTCTCCTTCATCCAGATACTTACG"], ["β-actin (Homo sapiens)", "Forward", "CACCATTGGCAATGAGCGGTTC"], ["", "Reverse", "AGGTCTTTGCGGATGTCCACGT"], ["OTUD7B (Homo sapiens)", "Forward", "TCTCAGAGGCTGCTTCCTTTGG"], ["", "Reverse", "CGCCTTTTCAACGCTTCCTTCTC"]], "row_count": 7, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[9]/table-wrap[1]#table-2"}}], "gaps": ["asset:source:pmid:40746896 not verified"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "targets"]}, "capability": {"state": "absent", "requirements": [], "gaps": ["capability"]}, "readiness": {"state": "partial", "tier": null, "blocking_axis": null, "blocked_on": null, "axes": {}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:40746896", "asset:table:pmid:40746896:1", "asset:table:pmid:40746896:2"], "steps": ["read_published_estimate"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": ["xml"], "capabilities": [], "data_gaps": ["source:pmid:40746896"]}, "gaps": ["corpus_record_absent"]}, "review": {"state": "partial", "machine_critique": {"status": "passed", "providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "full-text-reading-v1", "prompt_hash": "2f71756a7f592acc7ae5ff639ad788c83665fd891e2a517a00dcf59d7ef7afc8", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response_sha256": "sha256:bf2722ac91091fe50b929753af0ff12d7b93eadad79e5f54bd661578a6bb298c", "raw_response_chars": 7016}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "full-text-reading-v1", "prompt_hash": "bf96a8bf0bca8ae5b5f8236eadad237cf41890a2334637dbd6258b891dcd5c9c", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response_sha256": "sha256:32a5abb0aa07473474cac4bf9e5fae55f32be39c7516a7dac98a124388a0d2ad", "raw_response_chars": 39599}], "target_providers": [{"provider": "minimax", "model": "MiniMax-M3.1-Flash", "prompt_version": "replication-target-v2", "prompt_hash": "3de72f38172b8f70463f87e4fa7d432d240bbddd9f8f87625833e9f1acb1031a", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response": "{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"The text states that METTL14 enhances OTUD7B mRNA stability and expression through m6A methylation, and that OTUD7B stabilizes HIF-1α by promoting deubiquitination, but it does not state a numerical result for this main finding.\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "The text states that METTL14 enhances OTUD7B mRNA stability and expression through m6A methylation, and that OTUD7B stabilizes HIF-1α by promoting deubiquitination, but it does not state a numerical result for this main finding.", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:24:37.963112+00:00"}, {"provider": "minimax_alt", "model": "MiniMax-M3", "prompt_version": "replication-target-v2", "prompt_hash": "a2d54080066234a44743298be5010cc0594e6109b4409486bef89be67cbe84aa", "source_hash": "ec4cf1de586c034017d5401ceb43e796640eb8c163b662b00dd5a42d7a2884b6", "raw_response": "<think>We need answer JSON only. Need carefully interpret task. Source text contains many numbers but headline numerical result for main finding? It seems no numeric headline result stated. Need assess. User registered target generic: \"the headline numerical result the paper states for its main finding\". Need find single numerical result paper states for main finding. Text abstract/results qualitative, no numeric experimental result. There are methods thresholds, dataset IDs, dates, sample counts, etc. We must not invent. Likely number_stated false, parent 0, unit \"\", evidence \"\", target_result explain no numerical headline result, only qualitative claims. Need exact JSON.\n\nNeed ensure perhaps headline number could be \"top 20 differentially m6A-modified genes\" but that's methods, not main finding. \"GSE179267\" not result. \"two m6A-enriched... one control\" methodology, not headline numerical result. Registered target asks main finding headline numerical. No number stated. Need set false. target_result what text does state instead. Could quote / summarize main finding: METTL14-mediated m6A methylation stabilizes OTUD7B, which promotes deubiquitination and stabilization of HIF-1α in ESCC. Need output exact source? target_result need no exact quote requirement except evidence. Since evidence empty. We can state no headline numerical result; the paper states qualitative main finding.\n\nNeed parent_value 0 numeric, unit \"\", evidence \"\". number_stated false. JSON no markdown. Ensure no hidden issue \"single numerical result\" perhaps study title no number. Main finding no number. Yes.\n\nLet's formulate target_result \"No headline numerical result is stated for the main finding; the paper instead states that METTL14-mediated m6A methylation stabilizes OTUD7B, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\" This is paraphrase but permissible target_result. Could exact quote instead: \"No numerical result is stated for the main finding. The text states: \\\"METTL14 plays a crucial role in the stabilization of OTUD7B through m6A methylation, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\\\"\" Fine. Need no evidence because no number. Answer only JSON.</think>\n\n{\"parent_value\":0,\"unit\":\"\",\"evidence\":\"\",\"target_result\":\"No headline numerical result is stated for the main finding. The paper instead states: \\\"METTL14 plays a crucial role in the stabilization of OTUD7B through m6A methylation, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\\\"\",\"number_stated\":false}", "reading": {"parent_value": 0, "unit": "", "evidence": "", "target_result": "No headline numerical result is stated for the main finding. The paper instead states: \"METTL14 plays a crucial role in the stabilization of OTUD7B through m6A methylation, thereby inhibiting the ubiquitin-proteasomal degradation of HIF-1α in ESCC.\"", "number_stated": false, "source_locator": null}, "recorded_at": "2026-10-31T15:24:44.900582+00:00"}], "agreement": true, "disagreements": {"target_result": {"minimax": "No headline numerical result is stated. The paper's main finding is qualitative: OTUD7B is identified as an m6A-driven oncogene correlated with METTL14 and HIF-1α, with METTL14 enhancing OTUD7B mRNA stability and expression through m6A methylation, while OTUD7B stabilizes HIF-1α by promoting deubiquitination.", "minimax_alt": "unknown", "decisive": false}, "physical_methods": {"minimax": ["dot blot assay", "gene-specific m6A-PCR", "clonogenic assay", "Transwell assay", "co-immunoprecipitation assay", "quantitative real-time PCR (qPCR) using SYBR Green master mix on a QX100 Droplet Digital PCR system", "comparative Ct (2−ΔΔCt) method"], "minimax_alt": ["dot blot assay", "Gene-specific m6A-PCR", "clonogenic assay", "Transwell assay", "co-immunoprecipitation assay", "quantitative real-time PCR (qPCR)"], "decisive": false}, "analysis_methods": {"minimax": ["differential gene expression analysis", "limma software suite in R (v3.5.1)", "Bayesian t-test statistics", "absolute log2 fold change ≥1 and false discovery rate-adjusted p-value < 0.05", "KEGG pathway analysis using R's ClusterProfiler toolkit", "expression-correlation analysis using the GEPIA platform", "SRAMP m6A site prediction"], "minimax_alt": ["differential gene expression analysis using the limma software suite in R (v3.5.1)", "Bayesian t-test statistics with thresholds of absolute log2 fold change ≥1 and false discovery rate-adjusted p-value < 0.05", "ggplot2 volcano plots and pheatmap clustered heatmaps", "SRAMP m6A site prediction", "KEGG pathway analysis using R’s ClusterProfiler toolkit", "GEPIA interactive expression profiling and expression-correlation assessment", "comparative Ct (2−ΔΔCt) method with GAPDH normalization"], "decisive": false}}, "agreement_basis": {"policy": "decisive_fields", "decisive_fields": ["work_type", "number_stated", "parent_value", "unit"]}, "blinded": true}, "human_critique": {"status": "not_run", "reviewer": null, "signed_at": null, "conflict_checked": false, "commentary": null}, "stages": [{"key": "target_materials", "status": "pending", "reason": null, "evidence": null}, {"key": "independent_readings", "status": "passed", "reason": "The independent readings are incomplete or disagree; the source evidence must resolve the difference.", "evidence": {"provider_errors": []}}, {"key": "source_resolution", "status": "pending", "reason": null, "evidence": null}, {"key": "protocol_reconstruction", "status": "pending", "reason": null, "evidence": null}, {"key": "control_execution", "status": "pending", "reason": null, "evidence": null}, {"key": "control_comparison", "status": "pending", "reason": null, "evidence": null}, {"key": "publication", "status": "pending", "reason": null, "evidence": null}], "gaps": ["review.human_critique", "review.machine_critique.passed"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "package:e7367f4963367e2f83954f53a66090f768f9eda7cb56105ed81126a6c40d95cb", "type": "sep_package", "label": "SEP v1 package for pmid:40746896"}], "activities": [{"id": "activity:conversion:pmid:40746896", "type": "conversion", "used": ["package:e7367f4963367e2f83954f53a66090f768f9eda7cb56105ed81126a6c40d95cb"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:minimax", "type": "model", "label": "minimax"}, {"id": "agent:minimax_alt", "type": "model", "label": "minimax_alt"}, {"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}], "source_run_id": "run-20261023T122449232913", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:40746896", "parent_hash": "sha256:cddbad5ce6934159d95e5bd550a873f6d55e85c3d59933eb037d70f0aaf73d16", "fork_of": null, "generation": 2}, "gaps": ["abstract", "asset:source:pmid:40746896 not verified", "authors", "capability", "corpus_record_absent", "execution.not_run", "method", "review.human_critique", "review.machine_critique.passed", "step:obtain_source_data blocked on data:not_downloaded", "step:run_analysis blocked on no owned computational capability is bound to this experiment", "step:run_analysis input 'materials:the source data behind the published result in pmid:40746896' does not resolve to a declared asset", "targets"]},"meta":{"api_version":"v1","automation_ladder_snapshot":"ba34b49490d9bfaf","automation_ladder_caveats":["Method extraction is rule-based and has no hand-judged accuracy sample. Evidence bands order textual support; method agreement intervals are null (n=0), never probabilities. Work-type validation does not validate methods.","Operation coverage describes only explicitly named methods. It does not prove a complete protocol, compatible parameters, successful compilation or re-execution. Unrecognised or ambiguous methods require review.","Data reachability is a textual accession or public-data statement. No dataset was downloaded or checked for access, completeness or licence.","Capabilities are planning states seeded from the dated equipment register. No bench ownership, completed quote or partner booking is inferred. Procurement counts are dependencies, not guaranteed replications or financial returns.","Tier and blocker counts are deterministic assessments of this corpus, not measured agreement. R3 is reserved for procurement; unresolved methods and data require human work (R4). The most restrictive axis wins, with capability, method, data as tie-breaks. Resolving one blocker can leave another at the same tier."],"engine":"corpus_engine","engine_provider":"rule_based_v1+lex99e1195c7d6f","run_id":"run-20261023T122449232913","source":"esearch","source_detail":"PubMed mirror biomed_pubmed (read-only)","run_status":"complete","imported_at":"2026-11-03T20:16:52+00:00","generated_at":"2026-11-04T02:48:25+00:00","total_papers":5529,"total_assays_tracked":29,"automatable_assay_families":6,"validated":true,"caveat_count":9,"blocking_caveats":5,"caveats":[{"code":"low_evidence_dominates","basis":["4,152 of 5,529 classifications (75.1%) matched no cue evidence and sit at the 0.05 floor.","34 of 230 data_only calls (14.8%) are in that group."],"claim":"Work type and confidence bands","gloss":"Most records were classified from their title and framing alone, with assay-cue coverage at zero.","detail":"Most classifications in this run rest on no matched evidence at all. At the evidence floor the work type comes from title framing and a fixed prior, not from anything in the paper, so the published work-type split should be read as a rough triage signal rather than a measured distribution. The impact is bounded but not removed: since 2026-10-23 the engine excludes floor-confidence records from the shortlist entirely and publishes them separately as held out, so the recommendation is unaffected even though the census is.","status":"unverified","severity":"high"},{"code":"runtime_is_modelled","basis":["Runtime is summed from published per-assay hour figures. Timing awaits the first executed replication.","4,407 of 5,529 records (79.7%) model to 0.00 hours because no assay was matched, which the ranking then reads as \"cheapest\".","0 of 10 shortlisted records carry a 0.00-hour estimate."],"claim":"Estimated replication runtime","gloss":"The hour figures are estimates built from assay mentions; timing awaits the first executed replication.","detail":"The hour figures are a cost model derived from the bench steps implied by each matched assay family. The first executed replication will supply measured timing. Records without an assay match currently receive a zero-hour model value.","status":"unverified","severity":"high"},{"code":"signal_score_without_citations","basis":["5,529 of 5,529 records (100.0%) have no citation count from the source metadata."],"claim":"Signal score","gloss":"The signal score uses publication-type weight because the mirror supplied zero citation counts.","detail":"The source supplied no citation counts for any record in this run, so the signal score is publication-type weight only. The citation term of the ranking is inert here, and the shortlist is ordered by publication type alone.","status":"unverified","severity":"high"},{"code":"abstract_absent","basis":["1,667 of 5,529 records (30.2%) carry no abstract at all."],"claim":"Evidence base for classification","gloss":"Some records contain a title and publication type only, defining the available classification evidence.","detail":"Where the mirror contains a title and publication types only, those fields define the classifier evidence. A methods section is required for fuller automated and human review.","status":"unverified","severity":"medium"},{"code":"classifier_agreement_measured","basis":["Published two-way decision agreement 77.7% (310 of 399 decidable records) from a stratified hand-check of 438 real records.","Three-way diagnostic agreement 73.9% (288 of 390 decidable records).","data_only agreement 75.2% (100 of 133 decidable).","48 record(s) could not be decided from title and abstract and were excluded from the denominator.","56 analysis-only records were published under another work type, so the data_only share is not an upper bound."],"claim":"Published automatable decision","gloss":"This figure has been checked against a human reading the same papers, so we know how often it is right.","detail":"The published automatable / not-automatable distribution comes from a rule-based classifier that was hand-checked against a fixed ground-truth definition. The agreement rates below are measured, not estimated. The three-way work type remains a diagnostic and is reported separately.","status":"measured","severity":"high"},{"code":"llm_comparison_not_measured","basis":["rule_based_v1+lex99e1195c7d6f produced 5,529 of 5,529 classifications.","Measured on 438 labelled records; these are RULE-BASED figures, not model results."],"claim":"Rule-based versus LLM agreement","gloss":"Every number here is the rule engine’s own. Model comparison begins when a working API credential is connected and measured.","detail":"The published two-way decision agreed with a human reading on 310 of 399 decidable records (77.7%). The diagnostic three-way label agreed on 288 of 390 decidable records (73.9%). Every percentage in this run belongs to the rule engine. Model comparison begins when a working API credential is connected and measured.","status":"not_measured","severity":"high"},{"code":"confidence_is_a_band","basis":["low band: 135 of 210 hand-judged records were correct, 64.3% [57.6, 70.5] (95% CI).","medium band: 80 of 104 hand-judged records were correct, 76.9% [68.0, 84.0] (95% CI).","high band: 73 of 76 hand-judged records were correct, 96.0% [89.0, 98.7] (95% CI).","A fitted calibrated probability was built, measured and withdrawn: it overstated held-out accuracy and reorders nothing."],"claim":"Confidence band and evidence score","gloss":"The confidence band carries a measured accuracy interval; 0.85 represents relative rank strength.","detail":"Confidence on this run is a BAND plus its measured accuracy interval. The number stored alongside each record is a monotone evidence score that orders records; 0.85 represents relative rank strength. A fitted probability was withdrawn after it overstated held-out accuracy. Threshold on the band.","status":"measured","severity":"medium"},{"code":"three_way_split_is_diagnostic","basis":["The corpus is published at the two-way decision: automatable or not-automatable. The three-way split (data_only / physical / mixed) is published as a diagnostic with its measured reliability attached, not as a claim, because the rule engine's `mixed` call cannot be defended.","The engine called 22 record(s) mixed; 10 matched the human judgement (45.5%, 95% CI 26.9-65.3).","The engine's `mixed` call is right on 10/22 hand-judged records (45.5%, 95% CI 26.9%-65.3%); a constant `physical` guess scores 36.4%.","The engine's `mixed` call does not reliably beat a constant `physical` guess on the hand-judged records it labels mixed.","The sign of that difference flips between two independent samples, so the three-way refinement is not demonstrably informative.","The mixed stratum contributes a disproportionate share of errors relative to its size.","At title-only depth the physical/mixed split collapses: a title says that work was done, not whether it was also analysed."],"claim":"The published decision is two-way","gloss":"The three-way split is shown for diagnosis only. The published split is two ways.","detail":"Count and filter the corpus on automatable versus not-automatable. The data_only / physical / mixed split remains an internal engine diagnostic because the mixed call has lower measured reliability.","status":"measured","severity":"medium"},{"code":"automatable_flag_unproven","basis":["6 of 29 assay families are marked automatable now: meta_analysis, machine_learning, survival_analysis, pca, molecular_docking, differential_expression.","The flag is a rule over assay family and work type; validation begins with the first executed replication.","It inherits the 75.2% data_only agreement rate, because the flag requires the record to be analysis-only."],"claim":"Automatable now","gloss":"This flag marks assay families the rules classify as data-only. The first executed replication will validate it.","detail":"This flag marks families the rules consider replicable from data alone. Its validity depends on the analysis-only classification and will be measured through an executed replication.","status":"unverified","severity":"medium"}],"confidence_policy":"band_with_measured_interval","confidence_contract":{"policy":"band_with_measured_interval","summary":"Confidence is reported as a BAND with a measured accuracy interval. The raw evidence score supplies monotone ordering. A fitted point estimate was withdrawn after it overstated held-out accuracy.","evidence_score":"A monotone evidence score in [0,1] built from cue mass, axis separation and text coverage. Use it to order records. Interpret 0.85 as relative rank strength.","confidence_band":"low | medium | high. Consumers threshold on this value.","band_accuracy":"Wilson 95% interval on the measured agreement of the hand-judged records in this band.","calibrated_confidence":"WITHDRAWN. Reintroduction requires held-out evidence demonstrating reliable estimates across every bin."},"band_accuracy":{"low":{"n":210,"low":0.576,"band":"low","high":0.7046,"agree":135,"accuracy":0.6429},"high":{"n":76,"low":0.8903,"band":"high","high":0.9865,"agree":73,"accuracy":0.9605},"medium":{"n":104,"low":0.6795,"band":"medium","high":0.8397,"agree":80,"accuracy":0.7692}},"provider":"rule_based_v1+lex99e1195c7d6f","lexicon_id":"99e1195c7d6f","contract_published_at":"2026-10-23T12:25:29.022232+00:00","confidence_is_band":true,"confidence_is_probability":false,"decision_taxonomy":"two_way","decidable_fraction_two_way":0.8854,"decidable_fraction_two_way_low":0.8565,"decidable_fraction_two_way_high":0.9143,"decidable_fraction_three_way":0.8586,"decidable_fraction_three_way_low":0.8287,"decidable_fraction_three_way_high":0.8884,"decidable_population":5529,"validation_sample_size":438,"three_way_cost_fraction":0.0268,"three_way_cost_records":148,"decision_counts":{"automatable":230,"not_automatable":5299},"decision_split":{"automatable":{"count":230,"share":0.04159884246699222},"not_automatable":{"count":5299,"share":0.9584011575330078}},"diagnostic_work_type_counts":{"mixed":24,"physical":5275,"data_only":230}}}