In vivo gene expression profiling of human intestinal epithelial cells: analysis by laser microdissection of formalin fixed tissues.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:18457593", "kind": "science-record", "revision": 8, "content_hash": "sha256:a825b541ee3ef98586cfcbf1bd0ea98805ba108a6d3c770fbc258e3cfa1dcc5f", "created_at": "2026-11-01T15:14:33Z", "updated_at": "2026-11-01T21:58:03Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "In vivo gene expression profiling of human intestinal epithelial cells: analysis by laser microdissection of formalin fixed tissues.", "doi": "10.1186/1471-2164-9-209", "pmid": "18457593", "authors": ["Michael D George", "Jan Wehkamp", "Robert J Kays", "Christian M Leutenegger", "Sadiah Sabir", "Irina Grishina", "Satya Dandekar", "Charles L Bevins"], "journal": "BMC genomics", "year": 2008, "abstract": "BACKGROUND: The small intestinal epithelium mediates vital functions of nutrient absorption and host defense. The spatial organization of the epithelial cells along the crypt-villus axis segregates them into regions of specialized function. However, the differences in transcriptional programming and the molecular machinery that governs the migration, adhesion, and differentiation of intestinal epithelial cell lineages in humans remain under-explored. To increase our understanding of these mechanisms, we have evaluated gene expression patterns of ileal epithelial cells isolated by laser capture microdissection from either the villus epithelial or crypt cell regions of healthy human small intestinal mucosa. Expression profiles in villus and crypt epithelium were determined by DNA microarray, quantitative real-time PCR, and immunohistochemistry based methods. The expression levels of selected epithelial biomarkers were also compared between gastrointestinal tissues.\nRESULTS: Previously established biomarkers as well as a novel and distinct set of genes believed to be linked to epithelial cell motility, adhesion, and differentiation were found to be enriched in each of the two corresponding cell populations (GEO accession: GSE10629). Additionally, high baseline expression levels of innate antimicrobials, alpha defensin 5 (HD5) and regenerating islet-derived 3 alpha (Reg3A), were detected exclusively within the small bowel crypt, most notably in the ileum in comparison to other sites along the gastrointestinal tract.\nCONCLUSION: The elucidation of differential gene expression patterns between crypt and villus epithelial cell lineages in human ileal tissue provides novel insights into the molecular machinery that mediates their functions and spatial organization. Moreover, our findings establish an important framework of knowledge for future investigations of human gastrointestinal diseases.", "claims": [{"id": "claim-method", "statement": "Fold differences were calculated from comparison of the mean transcription levels among at least 3 biological replicate samples (patients) of each epithelial region, with 95% confidence (P-value ≤ 0.05) by standard student t-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:18457593", "locator": "sections[16] \"Microarray analysis\" paragraph 3", "quote": "Fold differences were calculated from comparison of the mean transcription levels among at least 3 biological replicate samples (patients) of each epithelial region, with 95% confidence (P-value ≤ 0.05) by standard student t-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The entire microarray data set is available for viewing at the Gene Expression Omnibus database (accession: GSE10629).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:18457593", "locator": "sections[3] \"Differential expression profiling of villus and crypt epithelial cell lineages\" paragraph 2", "quote": "The entire microarray data set is available for viewing at the Gene Expression Omnibus database (accession: GSE10629)."}], "state": "complete"}, {"id": "claim-target-result", "statement": "The elucidation of differential gene expression patterns between crypt and villus epithelial cell lineages in human ileal tissue provides novel insights into the molecular machinery that mediates their functions and spatial organization.", "kind": "quantitative", "target": {"value": 2.0, "unit": "fold change", "tolerance": null, "source": "Following RNA extraction, linear amplification, labeling, and hybridization to DNA microarrays, the genes for which the level of detected transcripts differed by at least 2-fold (student t-test, p ≤ 0.05) between the two cell pools were identified (highlighted in red in the M vs A plot shown in Figure 2A)."}, "evidence": [{"asset": "source:pmid:18457593", "locator": "sections[3] \"Differential expression profiling of villus and crypt epithelial cell lineages\" paragraph 2", "quote": "Following RNA extraction, linear amplification, labeling, and hybridization to DNA microarrays, the genes for which the level of detected transcripts differed by at least 2-fold (student t-test, p ≤ 0.05) between the two cell pools were identified (highlighted in red in the M vs A plot shown in Figure 2A)."}, {"asset": "source:pmid:18457593", "locator": "sections[3] \"Differential expression profiling of villus and crypt epithelial cell lineages\" paragraph 4", "quote": "Genes were identified through comparison of median expression levels in 3 independent paraformaldehyde-fixed ileal tissue samples from 3 different individuals."}, {"asset": "source:pmid:18457593", "locator": "sections[3] \"Differential expression profiling of villus and crypt epithelial cell lineages\" paragraph 2", "quote": "The entire microarray data set is available for viewing at the Gene Expression Omnibus database (accession: GSE10629)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": "The elucidation of differential gene expression patterns between crypt and villus epithelial cell lineages in human ileal tissue provides novel insights into the molecular machinery that mediates their functions and spatial organization.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:18457593"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE10629"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE10629"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:18457593", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/1471-2164-9-209", "sha256": "sha256:97170cf9e78508f06d2fd999ea6411108fb4f8d4bfacc0c5add69ae8700dfce6", "bytes": 51075, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/1471-2164-9-209", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC2394537", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE10629", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE10629", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE10629", "version": null, "note": "The entire microarray data set is available for viewing at the Gene Expression Omnibus database (accession: GSE10629).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The entire microarray data set is available for viewing at the Gene Expression Omnibus database (accession: GSE10629).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM267893", "GSM267894", "GSM267895", "GSM267896", "GSM267897", "GSM267898", "GSM267901"], "sample_count": 7, "group_sizes": null, "group_sizes_basis": null, "platform": "1352", "taxon": "Homo sapiens", "title": "Human ileum epithelium LCMD Project", "resolution_checked_at": "2026-11-01T15:14:33Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:18457593:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:60ad7cd91265c1e9078cc31772a44a3410340d635506a0a4dcb0ee3ead2a6fee", "bytes": 1063, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T1", "version": null, "note": "Oligonucleotide sequences used in quantitative real-time RT-PCR analysis.", "structure": {"pmcid": "PMC2394537", "section_index": 14, "section_title": "Quantitative real-time PCR", "row_count": 14, "column_count": 3}, "table": {"label": "Table 1", "caption": "Oligonucleotide sequences used in quantitative real-time RT-PCR analysis.", "rows": [["PCR Primer Pairs"], ["", "Sense", "Antisense"], [""], ["HD5", "5'GCCATCCTTGCTGCCATT 3'", "5'GCTTCTGGGTTGTAGCCTCATC 3'"], ["REG3A", "5'CGCTGTCCCAAAGGCTCCAAG 3'", "5'GCACAGACACCAGGTTTCCAGAGG 3'"], ["RELMB", "5'CAGTGTTCCTTAGACTCCGTTATGG 3'", "5'ACGGTCTGCCTTGGCTTTTG 3'"], ["EPS8L2", "5'CGGCTGGGCAAGAAGATGCG 3'", "5'GTGCTGGAAGGGGATGGGCG 3'"], ["MUC3B", "5' TGACGCTCAGCAAAACCGATAAC 3'", "5' AACAGGCTTCAGGACCAAGACAGC 3'"], ["PDXP", "5' ACTCATCAATGTTGGGTCCTGTGG 3'", "5' AGGGTCATCGTCACTTAGGCTTCC 3'"], ["APOA4", "5' AACTCACCCAGCAACTCAATGCC 3'", "5' CTCCTTCCCAATCTCCTCCTTCAG 3'"], ["SEMA3F", "5' GCTGGTCAGAGACGGCAGAAAAC 3'", "5' TGCTCCCTCCCTTTGTCCTGTAG 3'"], ["EPHB3", "5' AACGATGGGCAGTTCACGGTC 3'", "5' GCTGTTGACAAGGATGTTGCGAG 3'"], ["ALDOB", "5' TGCTATCAACCTTTGCCCTCTACC 3'", "5' CCCCAGAAGAACCCGTGTGAAC 3'"], ["BActin", "5' TGATGGTGGGCATGGGTCAG 3'", "5' CGTGCTCGATGGGGTACTTCAG 3'"]], "row_count": 14, "column_count": 3, "numeric_cells": 22, "header_rows": 1, "locator": "section[14]/table-wrap[1]#T1"}}], "gaps": ["asset:data:geo:GSE10629 not downloaded", "asset:data:geo:GSE10629 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Fold differences were calculated from comparison of the mean transcription levels among at least 3 biological replicate samples (patients) of each epithelial region, with 95% confidence (P-value ≤ 0.05) by standard student t-test."}}], "targets": [{"id": "target-published-estimate", "claim_id": "claim-target-result", "operation": "student_t", "expected_value": 2.0, "unit": "fold change", "tolerance": null, "state": "complete", "note": "The published estimate as the reader quoted it from the paper. No tolerance is published because the paper states none."}], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE10629"], "resolved_accessions": ["GSE10629"], "statements": ["The entire microarray data set is available for viewing at the Gene Expression Omnibus database (accession: GSE10629)."], "basis": "The paper names GSE10629 in Gene Expression Omnibus database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:18457593", "data:geo:GSE10629", "asset:table:pmid:18457593:1"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE10629"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:20:38Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 8, "usage": {"prompt_tokens": 97933, "completion_tokens": 3063, "cached_tokens": 73577}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:18457593", "type": "paper", "label": "pmid:18457593"}, {"id": "source:pmid:18457593", "type": "manuscript", "label": "PMID 18457593 full text"}, {"id": "data:geo:GSE10629", "type": "dataset", "label": "GEO GSE10629"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:18457593", "type": "paper", "label": "pmid:18457593"}, {"id": "source:pmid:18457593", "type": "manuscript", "label": "PMID 18457593 full text"}, {"id": "data:geo:GSE10629", "type": "dataset", "label": "GEO GSE10629"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-18457593", "type": "extraction", "used": ["source:pmid:18457593"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE10629", "type": "accession_resolution", "used": ["data:geo:GSE10629"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:18457593", "parent_hash": "sha256:6740b77d157cc3d402888a65e978edb3b9774905279f3e9d3fbd60555ea92add", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE10629 licence not read", "asset:data:geo:GSE10629 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["In vivo gene expression profiling of human intestina"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["and crypt epithelium were determined by DNA microarray, quantitative real-time PCR, and immunohisto", "Methods Biofunctional analysis of microarray data Assignment of genes to functional categ", "idation of biologically enriched themes, the microarray data was re-mined and analyzed with focus on", "d through annotation of gene lists using the Affymetrix NetAFFX web interface, the DAVID annotation"], "order_basis": "paper_text_order:878", "id": "assay:2"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["e determined by DNA microarray, quantitative real-time PCR, and immunohistochemistry based methods. The"], "order_basis": "paper_text_order:902", "id": "assay:3"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["microarray, quantitative real-time PCR, and immunohistochemistry based methods. The expression levels of sele"], "order_basis": "paper_text_order:922", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Fold differences were calculated from comparison of the mean transcription levels among at least 3 biological replicate samples (patients) of each epithelial region, with 95% confidence (P-value ≤ 0.05) by standard student t-test."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}