Proteomics of methyl jasmonate induced defense response in maize leaves against Asian corn borer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:25885025", "kind": "science-record", "revision": 8, "content_hash": "sha256:803ddfdc27fe08fc889b19ea74546bc8830c9f7b398fa515f33196b536ca4949", "created_at": "2026-11-01T15:40:08Z", "updated_at": "2026-11-01T22:42:13Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Proteomics of methyl jasmonate induced defense response in maize leaves against Asian corn borer.", "doi": "10.1186/s12864-015-1363-1", "pmid": "25885025", "authors": ["Yi Tong Zhang", "Yu Liang Zhang", "Si Xue Chen", "Guo Hua Yin", "Ze Zhong Yang", "Samantha Lee", "Chun Guang Liu", "Dan Dan Zhao", "Yu Kun Ma", "Fu Qiang Song", "Joan W Bennett", "Feng Shan Yang"], "journal": "BMC genomics", "year": 2015, "abstract": "BACKGROUND: Jasmonic acid (JA) and methyl jasmonate (MeJA) regulate plant development, resistance to stress, and insect attack by inducing specific gene expression. However, little is known about the mechanism of plant defense against herbivore attack at a protein level. Using a high-resolution 2-D gel, we identified 62 MeJA-responsive proteins and measured protein expression level changes.\nRESULTS: Among these 62 proteins, 43 proteins levels were increased while 11 proteins were decreased. We also found eight proteins uniquely expressed in response to MeJA treatment. Data are available via ProteomeXchange with identifier PXD001793. The proteins identified in this study have important biological functions including photosynthesis and energy related proteins (38.4%), protein folding, degradation and regulated proteins (15.0%), stress and defense regulated proteins (11.7%), and redox-responsive proteins (8.3%). The expression levels of four important genes were determined by qRT-PCR analysis. The expression levels of these proteins did not correlate well with their translation levels. To test the defense functions of the differentially expressed proteins, expression vectors of four protein coding genes were constructed to express in-fusion proteins in E. coli. The expressed proteins were used to feed Ostrinia furnacalis, the Asian corn borer (ACB). Our results demonstrated that the recombinant proteins of pathogenesis-related protein 1 (PR1) and thioredoxin M-type, chloroplastic precursor (TRXM) showed the significant inhibition on the development of larvae and pupae.\nCONCLUSIONS: We found MeJA could not only induce plant defense mechanisms to insects, it also enhanced toxic protein production that potentially can be used for bio-control of ACB.", "claims": [{"id": "claim-method", "statement": "The normalized volumes of the spots from replicate gels were subjected to student’s ANOVA test (P < 0.05) and only statistically significant data were considered. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium [19] via the PRIDE partner repository with the dataset identifier PXD001793.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:25885025", "locator": "sections[27] \"Protein extraction, 2-D gel, image and nanoESI MS/MS analysis\" paragraph 4", "quote": "The normalized volumes of the spots from replicate gels were subjected to student’s ANOVA test (P < 0.05) and only statistically significant data were considered."}, {"asset": "source:pmid:25885025", "locator": "sections[3] \"Plant proteins under MeJA treatment\" paragraph 2", "quote": "The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium [19] via the PRIDE partner repository with the dataset identifier PXD001793."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Data are available via ProteomeXchange with identifier PXD001793.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:25885025", "locator": "sections[0] \"Abstract\" paragraph 2", "quote": "Data are available via ProteomeXchange with identifier PXD001793."}], "state": "complete"}, {"id": "claim-target-result", "statement": "The study analyzed all data with SPSS 17.0 and made the mass-spectrometry proteomics data available through ProteomeXchange via the PRIDE partner repository under the dataset identifier PXD001793.", "kind": "qualitative", "target": null, "evidence": [{"asset": "source:pmid:25885025", "locator": "sections[30] \"Data analysis\" paragraph 2", "quote": "All the data were analyzed by SPSS17.0 statistical software (SPSS Inc., Chicago, IL, USA)."}, {"asset": "source:pmid:25885025", "locator": "sections[3] \"Plant proteins under MeJA treatment\" paragraph 2", "quote": "The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium [19] via the PRIDE partner repository with the dataset identifier PXD001793."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "The study analyzed all data with SPSS 17.0 and made the mass-spectrometry proteomics data available through ProteomeXchange via the PRIDE partner repository under the dataset identifier PXD001793.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:25885025"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD001793"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD001793"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:25885025", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12864-015-1363-1", "sha256": "sha256:3ffc500621aead7d3edb46dff580a344b012ac4ed1699d0c2527c633761587b7", "bytes": 49433, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12864-015-1363-1", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC4375847", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:PXD001793", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PXD001793", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PXD001793", "version": null, "note": "Data are available via ProteomeXchange with identifier PXD001793.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data are available via ProteomeXchange with identifier PXD001793.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": "Proteome response in maize to methyl jasmonate", "resolution_checked_at": "2026-10-31T18:35:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:25885025:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0892a31b3de96c427a2f01503bb6abb775f5af1c4d210c927f55be52ce73c8cf", "bytes": 969, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#Tab1", "version": null, "note": "Effects of different concentrations MeJA treatment on the developmental duration of different instar Asian corn borer larvae", "structure": {"pmcid": "PMC4375847", "section_index": 4, "section_title": "The effects of feeding ACB larvae and adults with MeJA-treated maize", "row_count": 7, "column_count": 7}, "table": {"label": "Table 1", "caption": "Effects of different concentrations MeJA treatment on the developmental duration of different instar Asian corn borer larvae", "rows": [["MeJA (μM)", "Developmental duration of different stages of larvae (Days)"], ["1 st instar", "2 nd instar", "3 rd instar", "4 th instar", "5 th instar", "Total duration"], ["Control", "4.17 ± 0.08a", "3.78 ± 0.11b", "3.96 ± 0.03c", "1.99 ± 0.05b", "4.25 ± 0.14b", "18.15 ± 0.34c"], ["50", "4.33 ± 0.33a", "3.89 ± 0.11b", "3.97 ± 0.12c", "1.93 ± 0.23b", "4.50 ± 0.29b", "18.62 ± 0.85c"], ["100", "4.27 ± 0.15a", "3.97 ± 0.03b", "4.33 ± 0.09bc", "2.17 ± 0.09b", "4.87 ± 0.09a", "19.60 ± 0.31bc"], ["225", "4.83 ± 0.17a", "4.67 ± 0.17a", "4.83 ± 0.12a", "3.50 ± 0.25a", "5.72 ± 0.43a", "23.56 ± 0.24a"], ["450", "4.33 ± 0.33a", "4.33 ± 0.33a", "4.07 ± 0.07c", "3.29 ± 0.20a", "4.56 ± 0.29b", "20.58 ± 0.20b"]], "row_count": 7, "column_count": 7, "numeric_cells": 39, "header_rows": 2, "locator": "section[4]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:25885025:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:05c528206ccd6f5e4442e4fb0dff062a0b9608b23f445c7659e5e6da3636d3cc", "bytes": 644, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[2]#Tab2", "version": null, "note": "Effects of different concentrations of MeJA on the life span and fecundity of adult Asian corn borers", "structure": {"pmcid": "PMC4375847", "section_index": 4, "section_title": "The effects of feeding ACB larvae and adults with MeJA-treated maize", "row_count": 6, "column_count": 4}, "table": {"label": "Table 2", "caption": "Effects of different concentrations of MeJA on the life span and fecundity of adult Asian corn borers", "rows": [["MeJA (μM)", "Adult life span (days)", "No. of eggs laid per female per day", "Adult fecundity"], ["Control", "9.00 ± 0.58a", "22.20 ± 0.81a", "110.78 ± 0.83a"], ["50", "8.77 ± 0.15ab", "20.97 ± 0.55a", "100.72 ± 0.70b"], ["100", "8.07 ± 0.12abc", "19.27 ± 0.27b", "77.5 ± 0.46c"], ["225", "7.67 ± 0.28c", "18.60 ± 0.16b", "70.89 ± 1.83d"], ["450", "7.80 ± 0.06bc", "19.14 ± 0.21b", "74.76 ± 1.11c"]], "row_count": 6, "column_count": 4, "numeric_cells": 19, "header_rows": 1, "locator": "section[4]/table-wrap[2]#Tab2"}}, {"id": "asset:table:pmid:25885025:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8662c0c4fafd2816de5a66179c97320debcf65aa3a5dbb9380a1f5adb1730b1a", "bytes": 475, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[3]#Tab3", "version": null, "note": "Effects of 225 μM of MeJA on the life table parameters of Asian corn borer", "structure": {"pmcid": "PMC4375847", "section_index": 4, "section_title": "The effects of feeding ACB larvae and adults with MeJA-treated maize", "row_count": 3, "column_count": 6}, "table": {"label": "Table 3", "caption": "Effects of 225 μM of MeJA on the life table parameters of Asian corn borer", "rows": [["Treatment", "Net reproductive rate", "Mean generation time", "Intrinsic rate of increase", "Finite rate of increase", "Double population time (days)"], ["Control", "14.81", "37.18", "0.0725", "1.0752", "9.56"], ["MeJA", "6.57", "37.47", "0.0502", "1.0515", "13.80"]], "row_count": 3, "column_count": 6, "numeric_cells": 10, "header_rows": 1, "locator": "section[4]/table-wrap[3]#Tab3"}}, {"id": "asset:table:pmid:25885025:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ec381c9cfe23cf05e89083fb3eed338c6163caa19c746e7d8f04b0e1377ec236", "bytes": 1050, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#Tab4", "version": null, "note": "Primers of four defense genes", "structure": {"pmcid": "PMC4375847", "section_index": 6, "section_title": "Quantitative RT-PCR analysis of four defense genes", "row_count": 11, "column_count": 4}, "table": {"label": "Table 4", "caption": "Primers of four defense genes", "rows": [["Genes", "Expressed level", "Primers for qRT-PCR", "Primers for expression vectors"], ["Actin", "-", "S- 5′ CGGCAGCCTCCATACCAA 3′", "-"], ["A - 5′ GCCAAGAACAGCTCCTCA 3′", "-"], ["bgl", "Up", "S- 5′ TCGCCACAAAGCAGTAAGC 3′", "S- 5′gcGAGCTCATGGCTCCACTTCTCGCCGCAG3′"], ["A- 5′ ACCAAAGATGAAGTCAGAGGG 3′", "A - 5′cgCTCGAGAGCTGGCGTAATAATCTTCTTG3′"], ["TRXM", "Up", "S- 5′ TTGGTGATGGCGTGCGAGAC 3′", "S- 5′gcGGATCCATGGCCATGGAGACGTGCTT3′"], ["A- 5′ TGGATGCCGTAGGCGTCGT 3′", "A - 5′cgAAGCTTTGAGCTACCGATGTACTTGT3′"], ["PR1", "Up", "S- 5′ TCGCACATCAAGGTGGAGC 3′", "S- 5′gcGGATCCATGGCCTCCGTCAACAGCT3′"], ["A- 5′ ATGGTTTAGTTGTAGGCGTCGG 3′", "A - 5′cgAAGCTTGTTGTAGGCGTCGGGGTT3′"], ["RAB15", "Down", "S- 5′ GAGAATGCCTTCGCCTCCTAC 3′", "S- 5′ gcGGATCCATGGCGGCGGCTGATGTGGAGT3′"], ["A- 5′ GTCGAGCTCCTTGCCGTT 3′", "A - 5′cgAAGCTTGTCCCTCCAGCCGCCGCCG3′"]], "row_count": 11, "column_count": 4, "numeric_cells": 19, "header_rows": 1, "locator": "section[6]/table-wrap[1]#Tab4"}}], "gaps": ["asset:data:geo:PXD001793 not downloaded", "asset:data:geo:PXD001793 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "reordered", "quote": "The normalized volumes of the spots from replicate gels were subjected to student’s ANOVA test (P < 0.05) and only statistically significant data were considered. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium [19] via the PRIDE partner repository with the dataset identifier PXD001793."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["PXD001793"], "resolved_accessions": ["PXD001793"], "statements": ["Data are available via ProteomeXchange with identifier PXD001793."], "basis": "The paper names PXD001793 in ProteomeXchange Consortium via the PRIDE partner repository and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:25885025", "data:geo:PXD001793", "asset:table:pmid:25885025:1", "asset:table:pmid:25885025:2", "asset:table:pmid:25885025:3", "asset:table:pmid:25885025:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:PXD001793"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:23:47Z", "independence": "same_provider"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 8, "usage": {"prompt_tokens": 100403, "completion_tokens": 5666, "cached_tokens": 1824}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:25885025", "type": "paper", "label": "pmid:25885025"}, {"id": "source:pmid:25885025", "type": "manuscript", "label": "PMID 25885025 full text"}, {"id": "data:geo:PXD001793", "type": "dataset", "label": "GEO PXD001793"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:25885025", "type": "paper", "label": "pmid:25885025"}, {"id": "source:pmid:25885025", "type": "manuscript", "label": "PMID 25885025 full text"}, {"id": "data:geo:PXD001793", "type": "dataset", "label": "GEO PXD001793"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-25885025", "type": "extraction", "used": ["source:pmid:25885025"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-PXD001793", "type": "accession_resolution", "used": ["data:geo:PXD001793"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:25885025", "parent_hash": "sha256:f254f9997690bac35ef0e887295d4e1451075d16f5c547facb9f878e0e4cd4d1", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:PXD001793 licence not read", "asset:data:geo:PXD001793 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The normalized volumes of the spots from replicate gels were subjected to student’s ANOVA test (P < 0.05) and only statistically significant data were considered. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium [19] via the PRIDE partner repository with the dataset identifier PXD001793."], "order_basis": "analysis_only", "id": "assay:1"}]}