Expression profiling of long noncoding RNAs in neonatal and adult mouse testis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:26217809", "kind": "science-record", "revision": 6, "content_hash": "sha256:f4213361bd5ce32f90ee1f04b988d0e956c4af4bbf1316787e322f2f32c70d96", "created_at": "2026-11-01T15:40:09Z", "updated_at": "2026-11-01T21:20:03Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Expression profiling of long noncoding RNAs in neonatal and adult mouse testis.", "doi": "10.1016/j.dib.2015.06.004", "pmid": "26217809", "authors": ["Jin Sun", "Ji Wu"], "journal": "Data in brief", "year": 2015, "abstract": "In recent years, advancements in genome-wide analyses of the mammalian transcriptome have revealed that long noncoding RNAs (lncRNAs) is pervasively transcribed in the genome and an increasing number of studies have demonstrated lncRNAs as a new class of regulatory molecules are involved in mammalian development (Carninci et al. (2005); Fatica and Bozzoni (2014)), but very few studies have been conducted on the potential roles of lncRNAs in mammalian testis development. To get insights into the expression patterns of lncRNA during mouse testis development, we investigated the lncRNAs expression profiles of neonatal and adult mouse testes using microarray platform and related results have been published (Sun et al., PLoS One 8 (2013) e75750.). Here, we describe in detail the experimental system, methods and validation for the generation of the microarray data associated with our recent publication (Sun et al., PLoS One 8 (2013) e75750.). Data have been deposited to the Gene Expression Omnibus (GEO) database repository with the dataset identifier GSE43442.", "claims": [{"id": "claim-method", "statement": "Differentially expressed lncRNAs and mRNAs were screened through performing a Volcano plot filtering between the two samples. The threshold is Fold Change >=5.0 and p-value<=0.05 (Student’s t-test).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:26217809", "locator": "sections[7] \"Data analysis\" paragraph 2", "quote": "Differentially expressed lncRNAs and mRNAs were screened through performing a Volcano plot filtering between the two samples. The threshold is Fold Change >=5.0 and p-value<=0.05 (Student’s t-test)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Raw and processed microarray data have been deposited to the Gene Expression Omnibus (GEO) database in the National Center for Biotechnology Information (NCBI), and can be accessed by the GEO accession number, GSE43442.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:26217809", "locator": "sections[7] \"Data analysis\" paragraph 2", "quote": "Raw and processed microarray data have been deposited to the Gene Expression Omnibus (GEO) database in the National Center for Biotechnology Information (NCBI), and can be accessed by the GEO accession number, GSE43442."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "The study found 3,025 lncRNAs and 5,964 mRNAs differentially expressed between neonatal and adult mouse testes using a threshold of fold change ≥5.0 and Student’s t-test with p≤0.05; the raw and processed source data are available through GEO accession GSE43442.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:26217809"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE43442"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE43442"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:26217809", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1016/j.dib.2015.06.004", "sha256": "sha256:6ca58906ef9b1017fd940e6a72b1e833f33c11a491d671071e63108ff946216b", "bytes": 10031, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1016/j.dib.2015.06.004", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC4510543", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE43442", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE43442", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE43442", "version": null, "note": "Raw and processed microarray data have been deposited to the Gene Expression Omnibus (GEO) database in the National Center for Biotechnology Information (NCBI), and can be accessed by the GEO accession number, GSE43442.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw and processed microarray data have been deposited to the Gene Expression Omnibus (GEO) database in the National Center for Biotechnology Information (NCBI), and can be accessed by the GEO accession number, GSE43442.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1062457", "GSM1062458", "GSM1062459", "GSM1062460", "GSM1062461", "GSM1062462"], "sample_count": 6, "group_sizes": null, "group_sizes_basis": null, "platform": "15692", "taxon": "Mus musculus", "title": "Profiling of long noncoding RNAs and mRNAs in neonatal and adult mouse testis", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:26217809:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b1f27fdcbc7bf472d1aa029f8ecde8c4076fb04ba50d3656e087c7bc2e0c469f", "bytes": 705, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[1]/table-wrap[1]#t0015", "version": null, "note": null, "structure": {"pmcid": "PMC4510543", "section_index": 1, "section_title": "Specifications", "row_count": 8, "column_count": 2}, "table": {"label": null, "caption": null, "rows": [["Organism/cell line/tissue", "Mus musculus"], ["Sex", "Male"], ["Sequencer or array type", "Arraystar Mouse Stringent LncRNA microarray"], ["Data format", "Raw data: TXT files, normalized data: SOFT, MINIML, and TXT TXT files"], ["Experimental factors", "Neonatal (6-day-old) and adult (8-week-old) C57/BL6 mouse testis"], ["Experimental features", "Microarray comparison was preformed to identify genes differentially expressed in neonatal (6-day-old) and adult (8-week-old) mouse testis"], ["Consent", "N/A"], ["Sample source location", "C57/BL6 mouse, Shanghai, China"]], "row_count": 8, "column_count": 2, "numeric_cells": 3, "header_rows": 1, "locator": "section[1]/table-wrap[1]#t0015"}}, {"id": "asset:table:pmid:26217809:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:59c22a2f72a15c52d0e9f38127a3d3be16db3378191322f3a1df44674f22c9b2", "bytes": 718, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#t0005", "version": null, "note": "Validation of microarray results by qRT-PCR [3].", "structure": {"pmcid": "PMC4510543", "section_index": 8, "section_title": "Validation of microarray data", "row_count": 10, "column_count": 5}, "table": {"label": "Table 1", "caption": "Validation of microarray results by qRT-PCR [3].", "rows": [["LncRNA ID", "Microarray", "qRT-PCR"], ["Fold change a", "p Value b", "Fold change a", "p Value b"], ["AK011865", "−14.700", "0.004", "−4.018", "0.010"], ["AK006530", "3,718.218", "5.11E−04", "172,187.456", "0.027"], ["AK053216", "−9.943", "0.008", "−5.362", "0.023"], ["AK018942", "14,097.462", "2.86E−04", "26,493.007", "0.142"], ["AK006015", "45.452", "2.10E−04", "68.228", "0.032"], ["AK004447", "−40.531", "0.002", "−3.540", "0.038"], ["AK033245", "−17.668", "0.012", "−7.105", "0.047"], ["AK140218", "6.516", "0.002", "7.806", "0.043"]], "row_count": 10, "column_count": 5, "numeric_cells": 40, "header_rows": 2, "locator": "section[8]/table-wrap[1]#t0005"}}, {"id": "asset:table:pmid:26217809:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b6ca48e5406b1b2baad1ef90452ca79f6e18c492b0f10103593710e10de05856", "bytes": 929, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[2]#t0010", "version": null, "note": "List of primers used in the validation of microarray results by qRT-PCR.", "structure": {"pmcid": "PMC4510543", "section_index": 8, "section_title": "Validation of microarray data", "row_count": 11, "column_count": 4}, "table": {"label": "Table 2", "caption": "List of primers used in the validation of microarray results by qRT-PCR.", "rows": [["Gene symbol", "Sequence (5′–3′)", "Amplicon length (bp)"], ["Forward", "Reverse"], ["AK011865", "CCACTTCAAATGGGGAGGGT", "GTGATTTGGGACACTGGAGAGAC", "182"], ["AK006530", "CAAGTGCCTGGGATTGTGGATAC", "CAGCCCACTGTCCAGGTCATCTC", "211"], ["AK053216", "GCCCAAGCGGTCACTCAGTATCA", "AGTGGTTCAAGTTACTGCCGCTG", "287"], ["AK018942", "GCCTTTCCCAAATGTCTGTTCCT", "TCAGGTTCAGGGAGTGCTTCTTT", "245"], ["AK006015", "GCCACACCACCATCCACTATT", "GGAGGCGAAACCAGGTAGATT", "161"], ["AK004447", "TGTAGCATCAAACATTCACGGA", "GACAGAAGGACACAGGGCAAAC", "196"], ["AK033245", "CAAACCCGCAGTTCTTCTCCTT", "AGTGCCAGCCCGAGTTGTTC", "205"], ["AK140218", "TTTACAAAAGGGAAAACTGAGGC", "TAGGCTGATAAAGGGCTCAAAGTT", "196"], ["GAPDH", "GTCGTGGAGTCTACTGGTGTC", "GAGCCCTTCCACAATGCCAAA", "240"]], "row_count": 11, "column_count": 4, "numeric_cells": 18, "header_rows": 2, "locator": "section[8]/table-wrap[2]#t0010"}}], "gaps": ["asset:data:geo:GSE43442 not downloaded", "asset:data:geo:GSE43442 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": null, "specific": null, "label": "Student’s t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differentially expressed lncRNAs and mRNAs were screened through performing a Volcano plot filtering between the two samples. The threshold is Fold Change >=5.0 and p-value<=0.05 (Student’s t-test)."}}], "targets": [{"id": "target-published-estimate", "claim_id": "claim-target-result", "operation": null, "expected_value": 0.05, "unit": "p-value", "tolerance": null, "state": "complete", "note": "The threshold the paper applied to its own result, as the paper states it. A run that reproduces the effect is judged against this threshold."}], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "method", "blocked_on": "method:not_determinable", "axes": {"method": {"tier": "R4", "expressible": false, "required_operations": [], "missing_operations": [], "basis": "The reader quoted the method the paper names (Student’s t-test), but the corpus's method extractor could not map it onto a DSL operation, so the method is published but not expressible."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE43442"], "resolved_accessions": ["GSE43442"], "statements": ["Raw and processed microarray data have been deposited to the Gene Expression Omnibus (GEO) database in the National Center for Biotechnology Information (NCBI), and can be accessed by the GEO accession number, GSE43442."], "basis": "The paper names GSE43442 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:26217809", "data:geo:GSE43442", "asset:table:pmid:26217809:1", "asset:table:pmid:26217809:2", "asset:table:pmid:26217809:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE43442"]}, "gaps": ["method:not_determinable"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:20Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 8, "usage": {"prompt_tokens": 24241, "completion_tokens": 3298, "cached_tokens": 1552}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:26217809", "type": "paper", "label": "pmid:26217809"}, {"id": "source:pmid:26217809", "type": "manuscript", "label": "PMID 26217809 full text"}, {"id": "data:geo:GSE43442", "type": "dataset", "label": "GEO GSE43442"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:26217809", "type": "paper", "label": "pmid:26217809"}, {"id": "source:pmid:26217809", "type": "manuscript", "label": "PMID 26217809 full text"}, {"id": "data:geo:GSE43442", "type": "dataset", "label": "GEO GSE43442"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-26217809", "type": "extraction", "used": ["source:pmid:26217809"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE43442", "type": "accession_resolution", "used": ["data:geo:GSE43442"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:26217809", "parent_hash": "sha256:ae8ff4eda002bc20c9d85300b6d96be773534d684c69d727e39e30e45baacf78", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE43442 licence not read", "asset:data:geo:GSE43442 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["of long noncoding RNAs in neonatal and adult mouse testis.", "nto the expression patterns of lncRNA during mouse testis development, we investigated the lncR", "As expression profiles of neonatal and adult mouse testes using microarray platform and related", "ological replicates for microarray analysis. Mice were sacrificed by cervical dislocation. Whole testes were s"], "order_basis": "paper_text_order:21", "id": "assay:1"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["les of neonatal and adult mouse testes using microarray platform and related results have been publi", "ods and validation for the generation of the microarray data associated with our recent publication", "s to provide three biological replicates for microarray analysis. Mice were sacrificed by cervical d"], "order_basis": "paper_text_order:687", "id": "assay:2"}]}