Gene expression changes of single skeletal muscle fibers in response to modulation of the mitochondrial calcium uniporter (MCU).

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:26484227", "kind": "science-record", "revision": 8, "content_hash": "sha256:29b6b2f5d033847f5105c5e3d5041a14ef9dc08360b4dec3b242345faed22843", "created_at": "2026-11-01T15:40:12Z", "updated_at": "2026-11-01T22:42:24Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Gene expression changes of single skeletal muscle fibers in response to modulation of the mitochondrial calcium uniporter (MCU).", "doi": "10.1016/j.gdata.2015.05.023", "pmid": "26484227", "authors": ["Francesco Chemello", "Cristina Mammucari", "Gaia Gherardi", "Rosario Rizzuto", "Gerolamo Lanfranchi", "Stefano Cagnin"], "journal": "Genomics data", "year": 2015, "abstract": "The mitochondrial calcium uniporter (MCU) gene codifies for the inner mitochondrial membrane (IMM) channel responsible for mitochondrial Ca(2 +) uptake. Cytosolic Ca(2 +) transients are involved in sarcomere contraction through cycles of release and storage in the sarcoplasmic reticulum. In addition cytosolic Ca(2 +) regulates various signaling cascades that eventually lead to gene expression reprogramming. Mitochondria are strategically placed in close contact with the ER/SR, thus cytosolic Ca(2 +) transients elicit large increases in the [Ca(2 +)] of the mitochondrial matrix ([Ca(2 +)]mt). Mitochondrial Ca(2 +) uptake regulates energy production and cell survival. In addition, we recently showed that MCU-dependent mitochondrial Ca(2 +) uptake controls skeletal muscle trophism. In the same report, we dissected the effects of MCU-dependent mitochondrial Ca(2 +) uptake on gene expression through microarray gene expression analysis upon modulation of MCU expression by in vivo AAV infection. Analyses were performed on single skeletal muscle fibers at two time points (7 and 14 days post-AAV injection). Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931).", "claims": [{"id": "claim-method", "statement": "To identify the differentially expressed probes in at least one condition, one way ANOVA analysis was performed using a threshold p-value ≤ 0.01.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:26484227", "locator": "sections[5] \"Materials and methods\" paragraph 9", "quote": "To identify the differentially expressed probes in at least one condition, one way ANOVA analysis was performed using a threshold p-value ≤ 0.01."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:26484227", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931)."}], "state": "complete"}, {"id": "claim-target-result", "statement": "MCU-dependent mitochondrial Ca2 + uptake controls skeletal muscle trophism; differential expression was identified using one-way ANOVA with a threshold p-value ≤ 0.01, and the raw and normalized source data are available in GEO under accession GSE60931.", "kind": "qualitative", "target": null, "evidence": [{"asset": "source:pmid:26484227", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "In addition, we recently showed that MCU-dependent mitochondrial Ca2 + uptake controls skeletal muscle trophism."}, {"asset": "source:pmid:26484227", "locator": "sections[5] \"Materials and methods\" paragraph 9", "quote": "To identify the differentially expressed probes in at least one condition, one way ANOVA analysis was performed using a threshold p-value ≤ 0.01."}, {"asset": "source:pmid:26484227", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931)."}, {"asset": "source:pmid:26484227", "locator": "sections[5] \"Materials and methods\" paragraph 9", "quote": "Raw data are available in the GEO database (accession number GSE60931)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "MCU-dependent mitochondrial Ca2 + uptake controls skeletal muscle trophism; differential expression was identified using one-way ANOVA with a threshold p-value ≤ 0.01, and the raw and normalized source data are available in GEO under accession GSE60931.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:26484227"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE60931"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE60931"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:26484227", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1016/j.gdata.2015.05.023", "sha256": "sha256:4f00286eeb1136a14898b3413735ddfb03869d7992fa2b48a5fd54745f993ba9", "bytes": 13430, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1016/j.gdata.2015.05.023", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC4583640", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE60931", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE60931", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE60931", "version": null, "note": "Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1493832", "GSM1493833", "GSM1493834", "GSM1493835", "GSM1493836", "GSM1493837", "GSM1493838", "GSM1493839", "GSM1493840", "GSM1493841", "GSM1493842", "GSM1493843", "GSM1493844", "GSM1493845", "GSM1493846", "GSM1493847", "GSM1493848", "GSM1493849", "GSM1493850", "GSM1493851", "GSM1493852", "GSM1493853", "GSM1493854", "GSM1493855", "GSM1493856", "GSM1493857", "GSM1493858", "GSM1493859", "GSM1493860", "GSM1493861"], "sample_count": 30, "group_sizes": null, "group_sizes_basis": null, "platform": "13912", "taxon": "Mus musculus", "title": "The Mitochondrial Calcium Uniporter controls skeletal muscle mass in vivo", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:26484227:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:57de22fae6a76c8a26fd665c04acab567695bcf52b4868a4dbdc917e21efe0f2", "bytes": 514, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#t0005", "version": null, "note": "Primers used for qRT-PCR.", "structure": {"pmcid": "PMC4583640", "section_index": 5, "section_title": "Materials and methods", "row_count": 7, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers used for qRT-PCR.", "rows": [["Primer name", "Sequence", "Description"], ["MCU_endo_FOR", "AAAGGAGCCAAAAAGTCACG", "Endogenous MCU"], ["MCU_endo_REV", "AACGGCGTGAGTTACAAACA"], ["MCU_eso_FOR", "AATTGCTCAGGCAGAAATGGA", "Exogenous MCU from AAV-MCU"], ["MCU_eso_REV", "CTTATCGTCGTCATCCTTGTAATC"], ["Txn1_FOR", "TCCAATGTGGTGTTCCTTGA", "Reference gene"], ["Txn1_REV", "GGCTTCAAGCTTTTCCTTGTT"]], "row_count": 7, "column_count": 3, "numeric_cells": 0, "header_rows": 1, "locator": "section[5]/table-wrap[1]#t0005"}}], "gaps": ["asset:data:geo:GSE60931 not downloaded", "asset:data:geo:GSE60931 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "To identify the differentially expressed probes in at least one condition, one way ANOVA analysis was performed using a threshold p-value ≤ 0.01."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE60931"], "resolved_accessions": ["GSE60931"], "statements": ["Raw and normalized data are available on the GEO database (http://www.ncbi.nlm.nih.gov/geo/) (GSE60931)."], "basis": "The paper names GSE60931 in GEO database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:26484227", "data:geo:GSE60931", "asset:table:pmid:26484227:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE60931"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:25:41Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 8, "usage": {"prompt_tokens": 30403, "completion_tokens": 2628, "cached_tokens": 1304}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:26484227", "type": "paper", "label": "pmid:26484227"}, {"id": "source:pmid:26484227", "type": "manuscript", "label": "PMID 26484227 full text"}, {"id": "data:geo:GSE60931", "type": "dataset", "label": "GEO GSE60931"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:26484227", "type": "paper", "label": "pmid:26484227"}, {"id": "source:pmid:26484227", "type": "manuscript", "label": "PMID 26484227 full text"}, {"id": "data:geo:GSE60931", "type": "dataset", "label": "GEO GSE60931"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-26484227", "type": "extraction", "used": ["source:pmid:26484227"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE60931", "type": "accession_resolution", "used": ["data:geo:GSE60931"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:26484227", "parent_hash": "sha256:38092c5f43454a4b46c9d722519fb0be16b28e8cc168463af5f9550c14e1642a", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE60931 licence not read", "asset:data:geo:GSE60931 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["al Ca(2 +) uptake on gene expression through microarray gene expression analysis upon modulation of", "iagen) were used (Fig. 1). Before performing microarray experiments about 1/5 of the purified RNA wa", "] and cDNA produced was labeled and used for microarray hybridization [9]. After microarray scanning", "used for microarray hybridization [9]. After microarray scanning data were normalized and analyzed ["], "order_basis": "paper_text_order:992", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["nalysis upon modulation of MCU expression by in vivo AAV infection. Analyses were performed on si", "[1]. Materials and methods Adult 2 month old mice were used for the experiments. Untreated and aden", "xperiments were performed using SurePrint G3 Mouse Gene Expression 8 × 60K microarrays (Agilent"], "order_basis": "paper_text_order:1065", "id": "assay:2"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["es) using the SYBR Green technology of GoTaq qPCR Master Mix (Promega). qRT-PCR confirmed the", "qRT-PCR experiments were performed in a 7500 Real-time PCR System (Life Technologies) using the SYBR Gr"], "order_basis": "paper_text_order:4768", "id": "assay:3"}, {"role": "data_generation", "definition_id": "amplicon_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["s. Briefly, RNA was reverse transcribed in a cDNA library, and then the library was exponentially ampl"], "order_basis": "paper_text_order:5420", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["To identify the differentially expressed probes in at least one condition, one way ANOVA analysis was performed using a threshold p-value ≤ 0.01."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}