Long non-coding RNA MALAT1 protects preterm infants with bronchopulmonary dysplasia by inhibiting cell apoptosis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:29237426", "kind": "science-record", "revision": 6, "content_hash": "sha256:087060bbd89449c3e6c0063ad0bc172fcc5eee245f708f21183325dc842a5c40", "created_at": "2026-11-01T15:40:30Z", "updated_at": "2026-11-01T21:21:11Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Long non-coding RNA MALAT1 protects preterm infants with bronchopulmonary dysplasia by inhibiting cell apoptosis.", "doi": "10.1186/s12890-017-0524-1", "pmid": "29237426", "authors": ["Cheng Cai", "Jiajun Qiu", "Gang Qiu", "Yihuan Chen", "Zhijun Song", "Juan Li", "Xiaohui Gong"], "journal": "BMC pulmonary medicine", "year": 2017, "abstract": "BACKGROUND: Bronchopulmonary dysplasia (BPD) is a neonatal chronic lung disease characterized by impaired pulmonary alveolar development in preterm infants. Until now, little is known about the molecular and cellular basis of BPD. There is increasing evidence that lncRNAs regulate cell proliferation and apoptosis during lung organogenesis. The potential role of lncRNAs in the pathogenesis of BPD is unclear. This study aims to clarify the role of MALAT1 during the process of BPD in preterm infants and illustrate the protective effect of MALAT1 involved in preterm infants.\nMETHODS: We assessed the expression of MALAT1 in BPD mice lung tissues by reanalyzing dataset GSE25286 (Mouse GEO Genome 4302 Array) from gene expression database gene expression omnibus (GEO), and verified MALAT1 expression in BPD patients by realtime q-PCR. Then the role of MALAT1 in regulating cell biology was examined by profiling dataset GSE43830. The expression of CDC6, a known antiapoptopic gene was verified in BPD patients and the alveolar epithelial cell line A549 cells in which MALAT1 was knocked down. Cell apoptosis was determined by FACS using PI/Annexin-V staining.\nRESULTS: The expression of MALAT1 was significantly evaluated in lung tissues of BPD mice at day 14 and day 29 compared to WT (P < 0.05). In consistent with mRNA array profiling analysis, MALAT1 expression level in blood samples from preterm infants with BPD was significantly increased. Bioinformative data analysis of MALAT1 knockdown in WI-38 cells showed various differentially expressed genes were found enriched in apoptosis related pathway. Down-regulation of antiapoptopic gene, CDC6 expression was further verified by q-PCR result. PI/Annexin-V apoptisis assay results showed that MALAT1 knocked down in the alveolar epithelial cell line (A549) promotes cell apoptosis.\nCONCLUSIONS: In our study, we found that up-regulation of lncRNA MALAT1 could protect preterm infants with BPD by inhibiting cell apoptosis. These data provide novel insights into MALAT1 regulation which may be relevant to cell fate and shed light on BPD prevention and treatment.", "claims": [{"id": "claim-data-access", "statement": "The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29237426", "locator": "sections[20] \"Availability of data and materials\" paragraph 2", "quote": "The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request."}], "state": "complete"}, {"id": "claim-target-result", "statement": "The paper used Student’s t-test for statistical analysis and obtained its source data from GEO datasets GSE25286 and GSE43830, patient peripheral blood samples, and cultured A549 cells. Its headline result was that MALAT1 up-regulation may protect preterm infants with BPD by inhibiting apoptosis.", "kind": "quantitative", "target": {"value": 0.05, "unit": "p-value", "tolerance": null, "source": "The expression of MALAT1 was significantly evaluated in lung tissues of BPD mice at day 14 and day 29 compared to WT (P < 0.05)."}, "evidence": [{"asset": "source:pmid:29237426", "locator": "sections[8] \"Statistics\" paragraph 2", "quote": "Experimental data were analyzed with the Student’s t-test."}, {"asset": "source:pmid:29237426", "locator": "sections[3] \"GEO bioinformatics\" paragraph 2", "quote": "Gene chip datasets which this study used in the bioinformatics analysis were both downloaded from GEO (Gene Expression Omnibus)."}, {"asset": "source:pmid:29237426", "locator": "sections[3] \"GEO bioinformatics\" paragraph 2", "quote": "Dataset GSE25286 was based on lung tissue from wild type (WT) (n = 4) and BPD Mice (n = 6) with two time points (Day 14 and Day 29) [9]."}, {"asset": "source:pmid:29237426", "locator": "sections[3] \"GEO bioinformatics\" paragraph 2", "quote": "Dataset GSE43830 used WI38 cell (human diploid lung fibroblasts) in which MALAT1 was knocked down as materials, comparing their gene expressions with normal WI38 cell (knocked down samples: 4, control samples: 2) [10]."}, {"asset": "source:pmid:29237426", "locator": "sections[4] \"Subjects and sample collection\" paragraph 2", "quote": "Human peripheral blood samples were obtained from these patients and written informed consent was obtained from the guardians of the patients."}, {"asset": "source:pmid:29237426", "locator": "sections[0] \"Abstract\" paragraph 3", "quote": "The expression of MALAT1 was significantly evaluated in lung tissues of BPD mice at day 14 and day 29 compared to WT (P < 0.05)."}, {"asset": "source:pmid:29237426", "locator": "sections[0] \"Abstract\" paragraph 4", "quote": "In our study, we found that up-regulation of lncRNA MALAT1 could protect preterm infants with BPD by inhibiting cell apoptosis."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": "The paper used Student’s t-test for statistical analysis and obtained its source data from GEO datasets GSE25286 and GSE43830, patient peripheral blood samples, and cultured A549 cells. Its headline result was that MALAT1 up-regulation may protect preterm infants with BPD by inhibiting apoptosis.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:29237426"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE25286"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE25286"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:29237426", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12890-017-0524-1", "sha256": "sha256:cb5f8c937c8a52fba0e743f01dd84353ecba846de3b25e743bfcbe28663ed11a", "bytes": 29343, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12890-017-0524-1", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC5729463", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE25286", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE25286", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE25286", "version": null, "note": "The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM622146", "GSM622147", "GSM622148", "GSM622149", "GSM622150", "GSM622151", "GSM622152", "GSM622153", "GSM622154", "GSM622155"], "sample_count": 10, "group_sizes": null, "group_sizes_basis": null, "platform": "1261", "taxon": "Mus musculus", "title": "mRNA expression profile in a murine model of hyperoxia-induced bronchopulmonary dysplasia", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE43830", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE43830", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE43830", "version": null, "note": "The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1071836", "GSM1071837", "GSM1071838", "GSM1071839", "GSM1071840", "GSM1071841"], "sample_count": 6, "group_sizes": null, "group_sizes_basis": null, "platform": "5188", "taxon": "Homo sapiens", "title": "Long Noncoding RNA MALAT1 Controls Cell Cycle Progression by Regulating the Expression of Oncogenic Transcription Factor B-MYB", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:29237426:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0563f68e25d49848b0f6e3dc5de86a19ce95a72b112b6996b19a41667b3d5add", "bytes": 571, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#Tab1", "version": null, "note": "Primers of MALAT1, CDC6 and β-Actin", "structure": {"pmcid": "PMC5729463", "section_index": 5, "section_title": "Total RNA isolation and Realtime q-PCR verification", "row_count": 9, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers of MALAT1, CDC6 and β-Actin", "rows": [["Gene name", "Primer", "Sequence(5′-3′)"], ["MALAT1", "Forward", "CTATGCTGTTGGCACGACA"], ["", "Reverse", "TCCTGAGGTGACTGTGAACC"], ["β-Actin", "Forward", "TCTGTGTGGATTGGTGGCTCTA"], ["", "Reverse", "CTGCTTGCTGATCCACATCTGCTCCTCGTGTAA"], ["CDC6", "Forward", "AAGCCCTG"], ["", "Reverse", "TCAAATACCAATCTTCGTCCC"], ["β-Actin(H)", "Forward", "’GTGGCCGAGGACTTTGATTG"], ["", "Reverse", "CCTGTAACAACGCATCTCATATT"]], "row_count": 9, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[5]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:29237426:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:015b3a58df5a6044c3bf83830b3e44bc1613a5534b61ddbbb369a4d083574bc2", "bytes": 461, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#Tab2", "version": null, "note": "Probe Cluster of MALAT1 which differential expressed between BPD Mice and WT", "structure": {"pmcid": "PMC5729463", "section_index": 10, "section_title": "LncRNA MALAT1 is significantly up-regulated in the lung tissue of BPD mice", "row_count": 2, "column_count": 7}, "table": {"label": "Table 2", "caption": "Probe Cluster of MALAT1 which differential expressed between BPD Mice and WT", "rows": [["Probe Cluster ID", "Gene Symbol", "BPD Avg Signal(log2)", "WT Avg Signal(log2)", "Fold Change", "ANOVA p-value", "FDR p-value"], ["1436202_at1452378_at", "MALAT1MALAT1", "10.489.12", "9.268.02", "2.332.14", "0.0000280.006168", "0.0007880.022612"]], "row_count": 2, "column_count": 7, "numeric_cells": 6, "header_rows": 1, "locator": "section[10]/table-wrap[1]#Tab2"}}], "gaps": ["asset:data:geo:GSE25286 not downloaded", "asset:data:geo:GSE25286 licence not read", "asset:data:geo:GSE43830 not downloaded", "asset:data:geo:GSE43830 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": null, "specific": null, "label": "Student’s t-test; source datasets are available from the corresponding author on reasonable request", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "reordered", "quote": "“Experimental data were analyzed with the Student’s t-test.” “The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.”"}}], "targets": [{"id": "target-published-estimate", "claim_id": "claim-target-result", "operation": null, "expected_value": 0.05, "unit": "p-value", "tolerance": null, "state": "complete", "note": "The threshold the paper applied to its own result, as the paper states it. A run that reproduces the effect is judged against this threshold."}], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "method", "blocked_on": "method:not_determinable", "axes": {"method": {"tier": "R4", "expressible": false, "required_operations": [], "missing_operations": [], "basis": "The reader quoted the method the paper names (Student’s t-test; source datasets are available from the corresponding author on reasonable request), but the corpus's method extractor could not map it onto a DSL operation, so the method is published but not expressible."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE25286", "GSE43830"], "resolved_accessions": ["GSE25286", "GSE43830"], "statements": ["The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request."], "basis": "The paper names GSE25286, GSE43830 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:29237426", "data:geo:GSE25286", "asset:table:pmid:29237426:1", "asset:table:pmid:29237426:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE25286"]}, "gaps": ["method:not_determinable"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:32:58Z", "independence": "same_provider"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 8, "usage": {"prompt_tokens": 64584, "completion_tokens": 2751, "cached_tokens": 2072}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:29237426", "type": "paper", "label": "pmid:29237426"}, {"id": "source:pmid:29237426", "type": "manuscript", "label": "PMID 29237426 full text"}, {"id": "data:geo:GSE25286", "type": "dataset", "label": "GEO GSE25286"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:29237426", "type": "paper", "label": "pmid:29237426"}, {"id": "source:pmid:29237426", "type": "manuscript", "label": "PMID 29237426 full text"}, {"id": "data:geo:GSE25286", "type": "dataset", "label": "GEO GSE25286"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-29237426", "type": "extraction", "used": ["source:pmid:29237426"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE25286", "type": "accession_resolution", "used": ["data:geo:GSE25286"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:29237426", "parent_hash": "sha256:62a0589edff8533c1d1c216476047b9977911ecf89cffb50be96cb9cb69099ec", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE25286 licence not read", "asset:data:geo:GSE25286 not downloaded", "asset:data:geo:GSE43830 licence not read", "asset:data:geo:GSE43830 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ronchopulmonary dysplasia by inhibiting cell apoptosis.", "that lncRNAs regulate cell proliferation and apoptosis during lung organogenesis. The potential rol", "cells in which MALAT1 was knocked down. Cell apoptosis was determined by FACS using PI/Annexin-V st", "ially expressed genes were found enriched in apoptosis related pathway. Down-regulation of antiapop"], "order_basis": "paper_text_order:58", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["tients and the alveolar epithelial cell line A549 cells in which MALAT1 was knocked down. Cell", "d down in the alveolar epithelial cell line (A549) promotes cell apoptosis. CONCLUSIONS: In ou", "the guardians of the patients. Cell culture A549 cells (Human Type II alveolar epithelial cel"], "order_basis": "paper_text_order:1120", "id": "assay:2"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ocked down. Cell apoptosis was determined by FACS using PI/Annexin-V staining. RESULTS: The ex"], "order_basis": "paper_text_order:1198", "id": "assay:3"}, {"role": "data_generation", "definition_id": "clinical_cohort", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ofiling analysis, MALAT1 expression level in blood samples from preterm infants with BPD was significantly i", "y q-PCR verification of MALAT1 in peripheral blood samples from BPD patients. To our notice, the expression"], "order_basis": "paper_text_order:1447", "id": "assay:4"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.85, "evidence": ["ased. Bioinformative data analysis of MALAT1 knockdown in WI-38 cells showed various differentially"], "order_basis": "paper_text_order:1559", "id": "assay:5"}]}