Long noncoding RNA MALAT1 enhances the docetaxel resistance of prostate cancer cells via miR-145-5p-mediated regulation of AKAP12.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:29633510", "kind": "science-record", "revision": 9, "content_hash": "sha256:be32ce57daf7628455dd5574a106986a6e6bfb6597b101777f2f8e49c6868dc1", "created_at": "2026-11-01T15:40:33Z", "updated_at": "2026-11-01T22:43:20Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Long noncoding RNA MALAT1 enhances the docetaxel resistance of prostate cancer cells via miR-145-5p-mediated regulation of AKAP12.", "doi": "10.1111/jcmm.13604", "pmid": "29633510", "authors": ["Dong Xue", "Hao Lu", "Han-Yan Xu", "Cui-Xing Zhou", "Xiao-Zhou He"], "journal": "Journal of cellular and molecular medicine", "year": 2018, "abstract": "Our present work was aimed to study on the regulatory role of MALAT1/miR-145-5p/AKAP12 axis on docetaxel (DTX) sensitivity of prostate cancer (PCa) cells. The microarray data (GSE33455) to identify differentially expressed lncRNAs and mRNAs in DTX-resistant PCa cell lines (DU-145-DTX and PC-3-DTX) was retrieved from the Gene Expression Omnibus (GEO) database. QRT-PCR analysis was performed to measure MALAT1 expression in DTX-sensitive and DTX-resistant tissues/cells. The human DTX-resistant cell lines DU145-PTX and PC3-DTX were established as in vitro cell models, and the expression of MALAT1, miR-145-5p and AKAP12 was manipulated in DTX-sensitive and DTX-resistant cells. Cell viability was examined using MTT assay and colony formation methods. Cell apoptosis was assessed by TUNEL staining. Cell migration and invasion was determined by scratch test (wound healing) and Transwell assay, respectively. Dual-luciferase assay was applied to analyse the target relationship between lncRNA MALAT1 and miR-145-5p, as well as between miR-145-5p and AKAP12. Tumour xenograft study was undertaken to confirm the correlation of MALAT1/miR-145-5p/AKAP12 axis and DTX sensitivity of PCa cells in vivo. In this study, we firstly notified that the MALAT1 expression levels were up-regulated in clinical DTX-resistant PCa samples. Overexpressed MALAT1 promoted cell proliferation, migration and invasion but decreased cell apoptosis rate of PCa cells in spite of DTX treatment. We identified miR-145-5p as a target of MALAT1. MiR-145-5p overexpression in PC3-DTX led to inhibited cell proliferation, migration and invasion as well as reduced chemoresistance to DTX, which was attenuated by MALAT1. Moreover, we determined that AKAP12 was a target of miR-145-5p, which significantly induced chemoresistance of PCa cells to DTX. Besides, it was proved that MALAT1 promoted tumour cell proliferation and enhanced DTX-chemoresistance in vivo. There was an lncRNA MALAT1/miR-145-5p/AKAP12 axis involved in DTX resistance of PCa cells and provided a new thought for PCa therapy.", "claims": [{"id": "claim-method", "statement": "The differences between 2 groups were analysed through Student's t test, multigroups’ difference was analysed by analysis of variance (ANOVA).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29633510", "locator": "sections[18] \"Statistical analysis\" paragraph 2", "quote": "The differences between 2 groups were analysed through Student's t test, multigroups’ difference was analysed by analysis of variance (ANOVA)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The microarray dataset (GSE33455) of differentially expressed lncRNAs and mRNAs in DTX‐resistant PCa cell lines (DU145‐DTX and PC3‐DTX) was retrieved in the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:29633510", "locator": "sections[5] \"Bioinformatics analysis\" paragraph 2", "quote": "The microarray dataset (GSE33455) of differentially expressed lncRNAs and mRNAs in DTX‐resistant PCa cell lines (DU145‐DTX and PC3‐DTX) was retrieved in the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/)."}], "state": "complete"}, {"id": "claim-target-result", "statement": "Headline result: MALAT1 promotes docetaxel resistance in prostate cancer through a MALAT1/miR-145-5p/AKAP12 axis. Statistical method: two-group differences were analyzed with Student's t test, multigroup differences with ANOVA, using GraphPad Prism 6.0, with P < .05 considered significant. Source-data route: differential lncRNA and mRNA expression was retrieved from GEO under accession GSE33455 and analyzed using the R project; patient survival follow-up data were obtained from TCGA.", "kind": "qualitative", "target": null, "evidence": [{"asset": "source:pmid:29633510", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "There was an lncRNA MALAT1/miR‐145‐5p/AKAP12 axis involved in DTX resistance of PCa cells and provided a new thought for PCa therapy."}, {"asset": "source:pmid:29633510", "locator": "sections[0] \"Abstract\" paragraph 1", "quote": "The microarray data (GSE33455) to identify differentially expressed lncRNAs and mRNAs in DTX‐resistant PCa cell lines (DU‐145‐DTX and PC‐3‐DTX) was retrieved from the Gene Expression Omnibus (GEO) database."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": "Headline result: MALAT1 promotes docetaxel resistance in prostate cancer through a MALAT1/miR-145-5p/AKAP12 axis. Statistical method: two-group differences were analyzed with Student's t test, multigroup differences with ANOVA, using GraphPad Prism 6.0, with P < .05 considered significant. Source-data route: differential lncRNA and mRNA expression was retrieved from GEO under accession GSE33455 and analyzed using the R project; patient survival follow-up data were obtained from TCGA.", "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:29633510"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33455"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33455"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:29633510", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/jcmm.13604", "sha256": "sha256:8330f704ade90409b3405f787ae0a571f70ffe84e41d1609ca806a0df77058a4", "bytes": 44952, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/jcmm.13604", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC5980122", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE33455", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE33455", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE33455", "version": null, "note": "The microarray dataset (GSE33455) of differentially expressed lncRNAs and mRNAs in DTX‐resistant PCa cell lines (DU145‐DTX and PC3‐DTX) was retrieved in the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The microarray dataset (GSE33455) of differentially expressed lncRNAs and mRNAs in DTX‐resistant PCa cell lines (DU145‐DTX and PC3‐DTX) was retrieved in the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM827130", "GSM827131", "GSM827132", "GSM827133", "GSM827134", "GSM827135", "GSM827136", "GSM827137", "GSM827138", "GSM827139", "GSM827140", "GSM827141"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data from docetaxel-resistant prostate cancer cell lines", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:29633510:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:70e5af4779cd12d8ca9bc6f418bbb0f25c2981858071877fd145e17a13b592ef", "bytes": 914, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#jcmm13604-tbl-0001", "version": null, "note": "Primer sequences for qRT‐PCR", "structure": {"pmcid": "PMC5980122", "section_index": 7, "section_title": "qRT‐PCR", "row_count": 13, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primer sequences for qRT‐PCR", "rows": [["Compound", "Primer name", "Sequence"], ["MALAT1", "Forward", "5′‐GGGTGTTTACGTAGACCAGAACC‐3′"], ["Reverse", "5′‐CTTCCAAAAGCCTTCTGCCTTAG‐3′"], ["NEAT1", "Forward", "5′‐AGCTGCGTCTATTGAATTGGTAAAGTAA‐3′"], ["Reverse", "5′‐GACAGAAAGATCCCAACGATAAAAATAA‐3′"], ["miR‐145", "Forward", "5′‐ GTCCAGTTTTCCCAGGAATC‐3′"], ["Reverse", "5′‐AGAACAG‐TATTTCCAGGAAT‐3′"], ["AKAP12", "Forward", "5′‐ GGAATTCGATGGGCGCCGGGAGCTCCAC‐3′"], ["Reverse", "5′‐ CCGCTCGAGGTCATCTTCGTTGGCCCCTG‐3′"], ["U6", "Forward", "5′‐CTCGCTTCGGCAGCACATA‐3′"], ["Reverse", "5′‐AACGATTCACGAATTTGCGT‐3′"], ["GAPDH", "Forward", "5′‐GAAGGTGAAGGTCGGAGTC‐3′"], ["Reverse", "5′‐GAAGATGGTGATGGGATTTC‐3′"]], "row_count": 13, "column_count": 3, "numeric_cells": 14, "header_rows": 1, "locator": "section[7]/table-wrap[1]#jcmm13604-tbl-0001"}}], "gaps": ["asset:data:geo:GSE33455 not downloaded", "asset:data:geo:GSE33455 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The differences between 2 groups were analysed through Student's t test, multigroups’ difference was analysed by analysis of variance (ANOVA)."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE33455"], "resolved_accessions": ["GSE33455"], "statements": ["The microarray dataset (GSE33455) of differentially expressed lncRNAs and mRNAs in DTX‐resistant PCa cell lines (DU145‐DTX and PC3‐DTX) was retrieved in the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/)."], "basis": "The paper names GSE33455 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:29633510", "data:geo:GSE33455", "asset:table:pmid:29633510:1"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE33455"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:34:10Z", "independence": "same_provider"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 8, "usage": {"prompt_tokens": 100612, "completion_tokens": 3218, "cached_tokens": 2080}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:29633510", "type": "paper", "label": "pmid:29633510"}, {"id": "source:pmid:29633510", "type": "manuscript", "label": "PMID 29633510 full text"}, {"id": "data:geo:GSE33455", "type": "dataset", "label": "GEO GSE33455"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:29633510", "type": "paper", "label": "pmid:29633510"}, {"id": "source:pmid:29633510", "type": "manuscript", "label": "PMID 29633510 full text"}, {"id": "data:geo:GSE33455", "type": "dataset", "label": "GEO GSE33455"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-29633510", "type": "extraction", "used": ["source:pmid:29633510"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE33455", "type": "accession_resolution", "used": ["data:geo:GSE33455"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:29633510", "parent_hash": "sha256:023abf9c01fbae3ff40666be37be5101b3a3528239b83ea6013145e27a836abc", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE33455 licence not read", "asset:data:geo:GSE33455 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["sitivity of prostate cancer (PCa) cells. The microarray data (GSE33455) to identify differentially e"], "order_basis": "paper_text_order:245", "id": "assay:1"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["MTT assay and colony formation methods. Cell apoptosis was assessed by TUNEL staining. Cell migrati", "n, migration and invasion but decreased cell apoptosis rate of PCa cells in spite of DTX treatment.", "ant cells. Cell viability was examined using MTT assay and colony formation methods. Cell apo"], "order_basis": "paper_text_order:801", "id": "assay:2"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["AKAP12 axis and DTX sensitivity of PCa cells in vivo. In this study, we firstly notified that the", "oliferation and enhanced DTX-chemoresistance in vivo. There was an lncRNA MALAT1/miR-145-5p/AKAP1"], "order_basis": "paper_text_order:1278", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The differences between 2 groups were analysed through Student's t test, multigroups’ difference was analysed by analysis of variance (ANOVA)."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}