Identification of proteins responding to pathogen-infection in the red alga Pyropia yezoensis using iTRAQ quantitative proteomics.

{"sci_version": "1.0", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30482156", "kind": "science-record", "revision": 3, "content_hash": "sha256:4d4583ef5d6190df94fc5e7c73e4ac4b271646b5ad611c0abcee563dc953f684", "created_at": "2026-11-01T15:40:39Z", "updated_at": "2026-11-01T18:50:06Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of proteins responding to pathogen-infection in the red alga Pyropia yezoensis using iTRAQ quantitative proteomics.", "doi": "10.1186/s12864-018-5229-1", "pmid": "30482156", "authors": ["Sohrab Khan", "Yunxiang Mao", "Dong Gao", "Sadaf Riaz", "Zeeshan Niaz", "Lei Tang", "Sohaib Khan", "Dongmei Wang"], "journal": "BMC genomics", "year": 2018, "abstract": "BACKGROUND: Pyropia yezoensis is an important marine crop which, due to its high protein content, is widely used as a seafood in China. Unfortunately, red rot disease, caused by Pythium porphyrae, seriously damages P. yezoensis farms every year in China, Japan, and Korea. Proteomic methods are often used to study the interactions between hosts and pathogens. Therefore, an iTRAQ-based proteomic analysis was used to identify pathogen-responsive proteins following the artificial infection of P. yezoensis with P. porphyrae spores.\nRESULTS: A total of 762 differentially expressed proteins were identified, of which 378 were up-regulated and 384 were down-regulated following infection. A large amount of these proteins were involved in disease stress, carbohydrate metabolism, cell signaling, chaperone activity, photosynthesis, and energy metabolism, as annotated in the KEGG database. Overall, the data showed that P. yezoensis resists infection by inhibiting photosynthesis, and energy and carbohydrate metabolism pathways, as supported by changes in the expression levels of related proteins. The expression data are available via ProteomeXchange with the identifier PXD009363.\nCONCLUSIONS: The current data provide an overall summary of the red algae responses to pathogen infection. This study improves our understanding of infection resistance in P. yezoensis, and may help in increasing the breeding of P. porphyrae-infection tolerant macroalgae.", "claims": [{"id": "claim-data-access", "statement": "Data are available via the ProteomeXchange with the identifier PXD009363.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30482156", "locator": "sections[28] \"ack\" paragraph 1", "quote": "Data are available via the ProteomeXchange with the identifier PXD009363."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30482156"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD009363"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD009363"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30482156", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12864-018-5229-1", "sha256": "sha256:48bb4f754fe4a0791796bf709c5af45083bfee19d561cb2d1121d40b2e04572f", "bytes": 35631, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12864-018-5229-1", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6260746", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:PXD009363", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PXD009363", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PXD009363", "version": null, "note": "Data are available via the ProteomeXchange with the identifier PXD009363.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data are available via the ProteomeXchange with the identifier PXD009363.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": "Identification of protein response to infection in Pyropia yezoensis", "resolution_checked_at": "2026-10-31T18:35:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30482156:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5ca11b37c47fb752a3c39587c359a25726bd51fb95085797ea355855d719e3b5", "bytes": 320, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#Tab1", "version": null, "note": "Statistics for the proteins identified by iTRAQ", "structure": {"pmcid": "PMC6260746", "section_index": 3, "section_title": "Overview of proteomic data", "row_count": 2, "column_count": 5}, "table": {"label": "Table 1", "caption": "Statistics for the proteins identified by iTRAQ", "rows": [["Total spectra", "Spectra (PS)", "Peptides", "Unique peptides", "Protein groups"], ["380,141", "57,994", "24,448", "23,937", "4011"]], "row_count": 2, "column_count": 5, "numeric_cells": 5, "header_rows": 1, "locator": "section[3]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:30482156:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:66ac2cba55dd388372e225966f98d68b5ba2f5d0329fccaa825e18c054768e55", "bytes": 964, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#Tab2", "version": null, "note": "Genes and primers used in this study for RT-qPCR expression analysis", "structure": {"pmcid": "PMC6260746", "section_index": 5, "section_title": "Transcript profiling of selected genes via RT-qPCR", "row_count": 8, "column_count": 4}, "table": {"label": "Table 2", "caption": "Genes and primers used in this study for RT-qPCR expression analysis", "rows": [["Gene Id", "Annotation", "Primers, forward/reverse (5′-3′)", "Product (bp)"], ["py08174.t1", "Catalase", "CTTCTCCACCGTCATCCACTCCGCCGACTAGGTCCCATACACCG", "118"], ["py11399.t1", "Multi-drug resistant protein", "CTTCCAGCAGATGCTCACAACCTAGTAGCCAAAGCCAATCGGGA", "111"], ["py04674.t1", "Heat shock proteinHSP-20", "GCTCGCCTACGGCTCCTTCTCTTCCACCTTGACCTTGGGCACAG", "129"], ["py09687.t1", "Mitogen activated protein kinase (MAPK 15–1)", "GTACGTGGCTATCAAGGGCATTTCAAGATACATCAGGTCGGGGT", "120"], ["py11267.t1", "nifU-like protein", "GAGGGAGTGCTCAACGAGGTGCGAGCCCTCCATCTTGAGTCGCA", "116"], ["FJ407185.1", "Elongation factor-alpha", "TTTCCAAGGTGCTCCTCTCCATCCGTCTCTTCATAGCGACTGCGGTT", "116"], ["Fj232910.1", "Ubiquitin conjugating enzyme", "GCTTTCTGTCTGGACGAGGTCTTCACAAGGATGCGGAT", "181"]], "row_count": 8, "column_count": 4, "numeric_cells": 17, "header_rows": 1, "locator": "section[5]/table-wrap[1]#Tab2"}}], "gaps": ["asset:data:geo:PXD009363 not downloaded", "asset:data:geo:PXD009363 licence not read"]}, "analysis": {"state": "absent", "methods": [], "targets": [], "gaps": ["method", "operations"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "method", "blocked_on": "method:not_determinable", "axes": {"method": {"tier": "R4", "expressible": false, "required_operations": [], "missing_operations": [], "basis": "The reader quoted the method the paper names (not named), but the corpus's method extractor could not map it onto a DSL operation, so the method is published but not expressible."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["PXD009363"], "resolved_accessions": ["PXD009363"], "statements": ["Data are available via the ProteomeXchange with the identifier PXD009363."], "basis": "The paper names PXD009363 in ProteomeXchange (PRIDE) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:30482156", "data:geo:PXD009363", "asset:table:pmid:30482156:1", "asset:table:pmid:30482156:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:PXD009363"]}, "gaps": ["method:not_determinable"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:38:41Z", "independence": "single_reader"}, "evidence_check": {"method": null, "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 26569, "completion_tokens": 995, "cached_tokens": 793}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30482156", "type": "paper", "label": "pmid:30482156"}, {"id": "source:pmid:30482156", "type": "manuscript", "label": "PMID 30482156 full text"}, {"id": "data:geo:PXD009363", "type": "dataset", "label": "GEO PXD009363"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30482156", "type": "paper", "label": "pmid:30482156"}, {"id": "source:pmid:30482156", "type": "manuscript", "label": "PMID 30482156 full text"}, {"id": "data:geo:PXD009363", "type": "dataset", "label": "GEO PXD009363"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30482156", "type": "extraction", "used": ["source:pmid:30482156"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-PXD009363", "type": "accession_resolution", "used": ["data:geo:PXD009363"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30482156", "parent_hash": "sha256:0fb34a7f87faf75e8b40418a25b131625e4a97a42496fd207da167b9f2c4c454", "fork_of": null, "generation": 2}, "gaps": ["asset:data:geo:PXD009363 licence not read", "asset:data:geo:PXD009363 not downloaded", "execution.not_run", "method", "operations", "review.human_critique", "review.independent_reader", "review.machine_critique"]}