MicroRNA-218-5p inhibits cell growth and metastasis in cervical cancer via LYN/NF-κB signaling pathway.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30524205", "kind": "science-record", "revision": 7, "content_hash": "sha256:7728bc69f59a73014c8d5a4eb8b869caafc9d4067a1f561626eff2b3f5dc0bd2", "created_at": "2026-11-01T15:40:39Z", "updated_at": "2026-11-01T22:00:11Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "MicroRNA-218-5p inhibits cell growth and metastasis in cervical cancer via LYN/NF-κB signaling pathway.", "doi": "10.1186/s12935-018-0673-1", "pmid": "30524205", "authors": ["Yunsheng Xu", "Qin He", "Yiyi Lu", "Fengxing Tao", "Liang Zhao", "Rongying Ou"], "journal": "Cancer cell international", "year": 2018, "abstract": "BACKGROUND: We are committed to investigate miR-218-5 effects on the progression of cervical cancer (CC) cell and find out the molecular mechanism.\nMETHODS: GSE9750 was obtained from GEO database and R Limma package was applied to filter out dysregulated genes. The pathways were enriched by GSEA software, ClusterProfiler and enrichplot packages to predict the function of DEGs. The binding sites of LYN were detected by miRanda and TargetScan. The miR2Disease database was used to find miRNAs related with CC. The expression of miR-218-5p and LYN were quantified by qRT-PCR and that of LYN protein was measured by western blot. The targeted relationships between miR-218-5p and LYN were verified by dual-luciferase reporter assay. Colony formation assays, wound healing, transwell invasion assay and flow cytometer analysis were performed to investigate the roles that miR-218-5p and LYN played in migration, invasion and death of cervical carcinoma. Xenografts established in nude mice were used to assess tumor growth in vivo.\nRESULTS: The highly expressed mRNA LYN was selected by microarray analysis in GSE9750. NF-κB signaling pathway was enriched base on GSEA results. The expression of miR-218-5p was lower but LYN was higher in CC primary tumors compared with normal control. In addition, miR-218-5p could regulate the expression of LYN in HeLa cells negatively. Overexpression of LYN could promote cell migration and invasion, but inhibit cell death in vitro, and also promote tumor formation in vivo via activating NF-κB signaling pathway which could be reversed by miR-218-5p.\nCONCLUSIONS: MiR-218-5p suppressed the progression of CC via LYN/NF-κB signaling pathway.", "claims": [{"id": "claim-method", "statement": "Significant DEGs were searched by Empirical Bayes method, P < 0.05 and |logFC| > 1.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30524205", "locator": "sections[3] \"Microarray analysis\" paragraph 2", "quote": "Significant DEGs were searched by Empirical Bayes method, P < 0.05 and |logFC| > 1."}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSE9750 was obtained from GEO database; The miR2Disease database was used to find miRNAs related with cervical cancer.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30524205", "locator": "sections[30] \"ack\" paragraph 1", "quote": "GSE9750 was obtained from GEO database; The miR2Disease database was used to find miRNAs related with cervical cancer."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30524205"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE9750"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE9750"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30524205", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12935-018-0673-1", "sha256": "sha256:587430c563b78deea30272f46b4f57be24472ce905f846e2e582f25b204c1fbb", "bytes": 35241, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12935-018-0673-1", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6278036", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE9750", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE9750", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE9750", "version": null, "note": "GSE9750 was obtained from GEO database; The miR2Disease database was used to find miRNAs related with cervical cancer.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE9750 was obtained from GEO database; The miR2Disease database was used to find miRNAs related with cervical cancer.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM246087", "GSM246088", "GSM246089", "GSM246090", "GSM246119", "GSM246120", "GSM246121", "GSM246122", "GSM246123", "GSM246422", "GSM246423", "GSM246484", "GSM246485", "GSM246486", "GSM246487", "GSM246488", "GSM246489", "GSM246490", "GSM246491", "GSM247162", "GSM247163", "GSM247164", "GSM247165", "GSM247166", "GSM247168", "GSM247169", "GSM247171", "GSM247173", "GSM247174", "GSM247175", "GSM247188", "GSM247189", "GSM247190", "GSM247650", "GSM247651", "GSM247652", "GSM247653", "GSM247654", "GSM247655", "GSM247656", "GSM247657", "GSM247658", "GSM247659", "GSM247660", "GSM247661", "GSM247662", "GSM247663", "GSM247856", "GSM247857", "GSM247859", "GSM247860", "GSM247862", "GSM247864", "GSM247865", "GSM247866", "GSM247876", "GSM247877", "GSM247878", "GSM247879", "GSM247881", "GSM247882", "GSM247883", "GSM247884", "GSM247885", "GSM247886", "GSM247887"], "sample_count": 66, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Identification of gene expression profiles in cervical cancer ", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30524205:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5b63e7e06f4d968deb85a87a0c390b99830f6e9a6de3e6b6adbfc34e8f86f74c", "bytes": 501, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#Tab1", "version": null, "note": "Clinicopathologic characteristics of cervical cancer patients", "structure": {"pmcid": "PMC6278036", "section_index": 5, "section_title": "Tissue specimens", "row_count": 18, "column_count": 2}, "table": {"label": "Table 1", "caption": "Clinicopathologic characteristics of cervical cancer patients", "rows": [["Characteristics", "No. of samples (n = 5)"], ["Age (years)"], ["< 50", "3"], ["≥ 50", "2"], ["FIGO stage"], ["I/IA/IB/IC", "0"], ["II/IIA/IIB", "5"], ["III/IIIA/IIIB/IV", "0"], ["Tumor size (cm)"], ["< 4", "2"], ["≥ 4", "3"], ["Grade"], ["1", "0"], ["2", "5"], ["3", "0"], ["HPV status"], ["16", "5"], ["18", "0"]], "row_count": 18, "column_count": 2, "numeric_cells": 22, "header_rows": 1, "locator": "section[5]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:30524205:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8044aa1cc5b1c439d04e3f6ed9571191696ce194596f09d1292ed008d65a2a83", "bytes": 995, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#Tab2", "version": null, "note": "Primer sequences for qRT-PCR", "structure": {"pmcid": "PMC6278036", "section_index": 8, "section_title": "Real-time quantitative analysis", "row_count": 11, "column_count": 2}, "table": {"label": "Table 2", "caption": "Primer sequences for qRT-PCR", "rows": [["Gene", "Primer sequence"], ["β-actin", "F: 5′- AGCGAGCATCCCCCAAAGTT -3′R: 5′- GGGCACGAAGGCTCATCATT -3′"], ["LYN", "F: 5′- TGTGAGAGATCCAACGTCCA -3′R: 5′- AAACTGCCCTTGGCCATGTA -3′"], ["MiR-218-5p", "F: 5′- CGAGTGCATTTGTGCTTGATCTA -3′R: 5′- TAATGGTCGAACGCCTAACGTC -3′"], ["U6", "F: 5′- CTCGCTTCGGCAGCACA -3′R: 5′- AACGCTTCACGAATTTGCGT -3′"], ["si-LYN", "Sense: 5′- GCAUGGAGAAUGGUGGAAA -3′Antisense: 5′- UUUCCACCAUUCUCCAUGC -3′"], ["si-LYN control", "Sense: 5′- GCAAGAGUAGGGUGUGAAA -3′Antisense: 5′- UUUCACACCCUACUCUUGC -3′"], ["MiR-218-5p mimics", "5′- UUGUGCUUGAUCUAACCAUGU -3′"], ["MiR-218-5p mimics control", "5′- UCACAACCUCCUAGAAAGAGUAGA -3′"], ["MiR-218-5p inhibitor", "5′- AACACGAACUAGAUUGGUACA -3′"], ["MiR-218-5p inhibitor control", "5′- UUGUACUACACAAAAGUACUG -3′"]], "row_count": 11, "column_count": 2, "numeric_cells": 15, "header_rows": 1, "locator": "section[8]/table-wrap[1]#Tab2"}}], "gaps": ["asset:data:geo:GSE9750 not downloaded", "asset:data:geo:GSE9750 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.7, "band": "medium", "quote": "Limma"}}, {"id": "method-2", "family": null, "specific": null, "label": "Empirical Bayes method", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Significant DEGs were searched by Empirical Bayes method, P < 0.05 and |logFC| > 1."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE9750"], "resolved_accessions": ["GSE9750"], "statements": ["GSE9750 was obtained from GEO database; The miR2Disease database was used to find miRNAs related with cervical cancer."], "basis": "The paper names GSE9750 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:30524205", "data:geo:GSE9750", "asset:table:pmid:30524205:1", "asset:table:pmid:30524205:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE9750"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:12:57Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 29955, "completion_tokens": 823, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30524205", "type": "paper", "label": "pmid:30524205"}, {"id": "source:pmid:30524205", "type": "manuscript", "label": "PMID 30524205 full text"}, {"id": "data:geo:GSE9750", "type": "dataset", "label": "GEO GSE9750"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30524205", "type": "paper", "label": "pmid:30524205"}, {"id": "source:pmid:30524205", "type": "manuscript", "label": "PMID 30524205 full text"}, {"id": "data:geo:GSE9750", "type": "dataset", "label": "GEO GSE9750"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30524205", "type": "extraction", "used": ["source:pmid:30524205"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE9750", "type": "accession_resolution", "used": ["data:geo:GSE9750"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30524205", "parent_hash": "sha256:cf106b841971b1453d183d9686fed2f47b9a65c3670ef3125ebf3a25e72ff20f", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE9750 licence not read", "asset:data:geo:GSE9750 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["-PCR and that of LYN protein was measured by western blot. The targeted relationships between miR-218-"], "order_basis": "paper_text_order:675", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["al carcinoma. Xenografts established in nude mice were used to assess tumor growth in vivo. RESULTS", "n nude mice were used to assess tumor growth in vivo. RESULTS: The highly expressed mRNA LYN was", "h in vitro, and also promote tumor formation in vivo via activating NF-κB signaling pathway which"], "order_basis": "paper_text_order:1043", "id": "assay:2"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["he highly expressed mRNA LYN was selected by microarray analysis in GSE9750. NF-κB signaling pathway"], "order_basis": "paper_text_order:1145", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["8-5p could regulate the expression of LYN in HeLa cells negatively. Overexpression of LYN coul", ".1 mg/l (final concentration 0.4 mM). And CC cell lines were maintained in Modified Eagle’s Medium with 10% FBS (Inv", "normal cell line—End1/E6E7 and CC cell lines—HeLa, SiHa, C33A and HT-3 were obtained from the"], "order_basis": "paper_text_order:1409", "id": "assay:4"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["Limma"], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}