Transcriptional Profile of Aedes aegypti Leucine-Rich Repeat Proteins in Response to Zika and Chikungunya Viruses.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30708982", "kind": "science-record", "revision": 8, "content_hash": "sha256:7ec256f2a3c2674d63b19786d16953578ad952773b6b66f8017c7adb41007d8e", "created_at": "2026-11-01T15:40:41Z", "updated_at": "2026-11-01T22:43:46Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Transcriptional Profile of Aedes aegypti Leucine-Rich Repeat Proteins in Response to Zika and Chikungunya Viruses.", "doi": "10.3390/ijms20030615", "pmid": "30708982", "authors": ["Liming Zhao", "Barry W Alto", "Dongyoung Shin"], "journal": "International journal of molecular sciences", "year": 2019, "abstract": "Aedes aegypti (L.) is the primary vector of chikungunya, dengue, yellow fever, and Zika viruses. The leucine-rich repeats (LRR)-containing domain is evolutionarily conserved in many proteins associated with innate immunity in invertebrates and vertebrates, as well as plants. We focused on the AaeLRIM1 and AaeAPL1 gene expressions in response to Zika virus (ZIKV) and chikungunya virus (CHIKV) infection using a time course study, as well as the developmental expressions in the eggs, larvae, pupae, and adults. RNA-seq analysis data provided 60 leucine-rich repeat related transcriptions in Ae. aegypti in response to Zika virus (Accession number: GSE118858, accessed on: August 22, 2018, GEO DataSets). RNA-seq analysis data showed that AaeLRIM1 (AAEL012086-RA) and AaeAPL1 (AAEL009520-RA) were significantly upregulated 2.5 and 3-fold during infection by ZIKV 7-days post infection (dpi) of an Ae. aegypti Key West strain compared to an Orlando strain. The qPCR data showed that LRR-containing proteins related genes, AaeLRIM1 and AaeAPL1, and five paralogues were expressed 100-fold lower than other nuclear genes, such as defensin, during all developmental stages examined. Together, these data provide insights into the transcription profiles of LRR proteins of Ae. aegypti during its development and in response to infection with emergent arboviruses.", "claims": [{"id": "claim-method", "statement": "So, we used a multivariate analysis of variance approach (MANOVA), which enabled us to simultaneously measure various treatment effects (e.g., developmental stage, infection with ZIKV and CHIKV) on the expression of multiple genes.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30708982", "locator": "sections[18] \"4.6. Statistical Analysis\" paragraph 2", "quote": "So, we used a multivariate analysis of variance approach (MANOVA), which enabled us to simultaneously measure various treatment effects (e.g., developmental stage, infection with ZIKV and CHIKV) on the expression of multiple genes."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The RNA-seq data have been deposited to NCBI (https://www.ncbi.nlm.nih.gov/gds/?term=GSE118858).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30708982", "locator": "sections[17] \"4.5. RNA-Seq Library Sequencing, Data Mining, and RNA-seq Analysis\" paragraph 2", "quote": "The RNA-seq data have been deposited to NCBI (https://www.ncbi.nlm.nih.gov/gds/?term=GSE118858)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30708982"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE118858"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE118858"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30708982", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3390/ijms20030615", "sha256": "sha256:c7b6bda1a74c4280e99da35e893ad221c6c028dde2309e4b1025aba5a1a91373", "bytes": 57630, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3390/ijms20030615", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6386990", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE118858", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE118858", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE118858", "version": null, "note": "The RNA-seq data have been deposited to NCBI (https://www.ncbi.nlm.nih.gov/gds/?term=GSE118858).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The RNA-seq data have been deposited to NCBI (https://www.ncbi.nlm.nih.gov/gds/?term=GSE118858).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3349302", "GSM3349303", "GSM3349304", "GSM3349305", "GSM3349306", "GSM3349307", "GSM3349308", "GSM3349309", "GSM3349310", "GSM3349311", "GSM3349312", "GSM3349313", "GSM3349314", "GSM3349315", "GSM3349316", "GSM3349317", "GSM3349318", "GSM3349319", "GSM3349320", "GSM3349321", "GSM3349322", "GSM3349323", "GSM3349324", "GSM3349325"], "sample_count": 24, "group_sizes": null, "group_sizes_basis": null, "platform": "22030", "taxon": "Aedes aegypti", "title": "The effect of permethrin resistance on Aedes aegypti transcriptome following ingestion of Zika virus infected blood", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30708982:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a96a7258db4d22b75c42b7074520819b29ffe23a2311b242396c6a8ba6f7b713", "bytes": 4181, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#ijms-20-00615-t001", "version": null, "note": "(A) Female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly upregulated in the Zika infection in the Key West strain compared with the Orlando strain Aedes aegypti 7-days post infection (Log2FC, Log2 fold change); (B) female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly upregulated/downregulated in the control (uninfected blood-feeding only) in the Key West strain compared with the Orlando strain Aedes aegypti 7-days post injection; (C) female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly dysregulated in the Key West strain Aedes aegypti 7-days post infection with ZIKV compared with control (uninfected blood-feeding only) in the Key West strain; (D) female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly dysregulated in the Orlando strain Aedes aegypti 7-days post infection with ZIKV compared with control (uninfected blood-feeding only) in the Orlando strain.", "structure": {"pmcid": "PMC6386990", "section_index": 3, "section_title": "2.1. Leucine-Rich Repeat Proteins Changes in Transcriptome of the Ae. aegypti Female Adult in Response to ZIKV Infection", "row_count": 40, "column_count": 4}, "table": {"label": "Table 1", "caption": "(A) Female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly upregulated in the Zika infection in the Key West strain compared with the Orlando strain Aedes aegypti 7-days post infection (Log2FC, Log2 fold change); (B) female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly upregulated/downregulated in the control (uninfected blood-feeding only) in the Key West strain compared with the Orlando strain Aedes aegypti 7-days post injection; (C) female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly dysregulated in the Key West strain Aedes aegypti 7-days post infection with ZIKV compared with control (uninfected blood-feeding only) in the Key West strain; (D) female Aedes aegypti transcriptomic RNA-seq data show leucine-rich repeat proteins related genes significantly dysregulated in the Orlando strain Aedes aegypti 7-days post infection with ZIKV compared with control (uninfected blood-feeding only) in the Orlando strain.", "rows": [["Transcript ID", "Log2FC", "p-adj", "Gene Description"], ["(A)"], ["AAEL001401-RA", "3.2722", "2.3 × 10−27", "leucine-rich immune protein (Short)"], ["AAEL001402-RA", "3.2947", "3.3 × 10−33", "leucine-rich immune protein (Short)"], ["AAEL001414-RA", "3.3721", "2.1 × 10−36", "leucine-rich immune protein (Short)"], ["AAEL001417-RA", "3.9484", "2.1 × 10−5", "leucine-rich immune protein (Short)"], ["AAEL001420-RA", "3.4335", "1.6 × 10−73", "leucine-rich immune protein (Short)"], ["AAEL001649-RA", "-0.2792", "4.6 × 10−3", "leucine aminopeptidase"], ["AAEL002295-RA", "2.4545", "1.9 × 10−44", "leucine-rich transmembrane protein"], ["AAEL002615-RA", "2.2527", "4.9 × 10−12", "leucine-rich transmembrane protein"], ["AAEL003262-RA", "1.8141", "3.9 × 10−5", "leucine-rich transmembrane protein"], ["AAEL003408-RA", "1.3747", "5.3 × 10−6", "leucine-rich transmembrane protein"], ["AAEL003713-RA", "1.397", "7.2 × 10−4", "leucine-rich transmembrane protein"], ["AAEL003720-RA", "1.1688", "5.6 × 10−5", "leucine-rich transmembrane protein"], ["AAEL005762-RA", "2.2277", "2.7 × 10−5", "leucine-rich transmembrane protein"], ["AAEL006975-RA", "1.7989", "8.7 × 10−5", "leucine aminopeptidase"], ["AAEL007103-RA", "3.2536", "7.5 × 10−11", "leucine-rich immune protein (TM)"], ["AAEL009520-RA 1", "3.0383", "4.5 × 10−25", "leucine-rich immune protein (Long)"], ["AAEL010125-RA", "3.2598", "7.0 × 10−8", "leucine-rich immune protein (Coil-less)"], ["AAEL010128-RA", "4.8149", "2.4 × 10−7", "leucine-rich immune protein (Long)"], ["AAEL010656-RA", "2.7658", "3.8 × 10−7", "leucine-rich immune protein (Short)"], ["AAEL012086-RA", "2.4679", "1.7 × 10−12", "leucine-rich immune protein (Long)"], ["AAEL012092-RA", "2.1252", "2.6 × 10−28", "leucine-rich repeat protein"], ["AAEL012093-RA", "2.2739", "1.9 × 10−10", "leucine-rich transmembrane protein"], ["AAEL012255-RA", "4.2146", "1.9 × 10−4", "leucine-rich immune protein (Short)"], ["(B)"], ["AAEL000243-RA", "5.2443", "1.8 × 10−26", "leucine-rich transmembrane protein"], ["AAEL009894-RA", "−0.9167", "2.9 × 10−4", "leucine-rich immune protein (Coil-less)"], ["AAEL010286-RA", "3.0287", "1.5 × 10−5", "leucine-rich transmembrane protein"], ["(C)"], ["AAEL000243-RA", "−6.6469", "7.6 × 10−44", "leucine-rich transmembrane protein"], ["AAEL003408-RA", "2.1477", "1.8 × 10−4", "leucine-rich transmembrane protein"], ["AAEL009894-RA", "0.8665", "9.7 × 10−8", "leucine-rich immune protein (Coil-less)"], ["AAEL010286-RA", "−3.3918", "5.0 × 10−9", "leucine-rich transmembrane protein"], ["(D)"], ["AAEL009520-RA 2", "−2.2074", "2.8 × 10−4", "leucine-rich immune protein (Long)"], ["AAEL010128-RA", "−5.3692", "2.8 × 10−6", "leucine-rich immune protein (Long)"], ["AAEL001402-RA", "−3.3551", "6.1 × 10−8", "leucine-rich immune protein (Short)"], ["AAEL010656-RA", "−2.5623", "4.4 × 10−3", "leucine-rich immune protein (Short)"], ["AAEL012255-RA", "−4.1624", "3.1 × 10−5", "leucine-rich immune protein (Short)"]], "row_count": 40, "column_count": 4, "numeric_cells": 105, "header_rows": 1, "locator": "section[3]/table-wrap[1]#ijms-20-00615-t001"}}, {"id": "asset:table:pmid:30708982:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:435188e5a870018a182acb545da342105b64b852f73466a05e25191242a0da00", "bytes": 1135, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#ijms-20-00615-t002", "version": null, "note": "(A) MANOVA results for strain and stage effects of the AaeLRIM1 and AaeAPL1 RNA profile in immature stages of Ae. aegypti. (B) MANOVA results for strain, sex, and age effects of the AaeLRIM1 and AaeAPL1 RNA profile in adult stages of Ae. aegypti.", "structure": {"pmcid": "PMC6386990", "section_index": 6, "section_title": "2.3.1. AaeLRIM1 and AaeAPL1 RNA Profile in Immature Stages of Ae. aegypti", "row_count": 14, "column_count": 6}, "table": {"label": "Table 2", "caption": "(A) MANOVA results for strain and stage effects of the AaeLRIM1 and AaeAPL1 RNA profile in immature stages of Ae. aegypti. (B) MANOVA results for strain, sex, and age effects of the AaeLRIM1 and AaeAPL1 RNA profile in adult stages of Ae. aegypti.", "rows": [["Treatment", "Pillai’s Trace", "df (Numerator and Denominator)", "p-value", "Standardized Canonical Coefficients"], ["AaeLR1M1", "AaeAPL1"], ["(A)"], ["Strain", "0.99", "2, 11", "<0.0001", "12.12", "−10.76"], ["Stage", "1.99", "4, 24", "<0.0001", "16.28", "8.35"], ["Strain × Stage", "1.89", "4, 24", "<0.0001", "11.09", "−11.57"], ["(B)"], ["Strain", "0.99", "2, 39", "<0.0001", "47.84", "−7.90"], ["Sex", "1.00", "2, 39", "<0.0001", "49.46", "−4.80"], ["Age", "1.98", "8, 80", "<0.0001", "49.48", "−3.43"], ["Strain × Sex", "1.00", "2, 39", "<0.0001", "48.66", "−1.11"], ["Strain × Age", "1.93", "8, 80", "<0.0001", "46.59", "−9.05"], ["Sex × Age", "1.99", "8, 80", "<0.0001", "49.49", "−4.55"], ["Strain × Sex x Age", "1.98", "8, 80", "<0.0001", "49.52", "−4.06"]], "row_count": 14, "column_count": 6, "numeric_cells": 50, "header_rows": 2, "locator": "section[6]/table-wrap[1]#ijms-20-00615-t002"}}, {"id": "asset:table:pmid:30708982:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:31c71846673974fd6da5cd67fd1ffea0a633ca872c43661e855af02dcf8bb7d1", "bytes": 942, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#ijms-20-00615-t003", "version": null, "note": "(A) Zika virus titers (log10 pfu/mL) in infectious blood meals and mosquitoes for Key West and Orlando strains of Aedes aegypti. (B) Chikungunya virus titers (log10 pfu/mL) in infectious blood meals and mosquitoes for Key West and Orlando strains of Aedes aegypti.", "structure": {"pmcid": "PMC6386990", "section_index": 8, "section_title": "2.4. Infection in Ae. aegypti Exposed to CHIKV and ZIKV", "row_count": 7, "column_count": 6}, "table": {"label": "Table 3", "caption": "(A) Zika virus titers (log10 pfu/mL) in infectious blood meals and mosquitoes for Key West and Orlando strains of Aedes aegypti. (B) Chikungunya virus titers (log10 pfu/mL) in infectious blood meals and mosquitoes for Key West and Orlando strains of Aedes aegypti.", "rows": [["Strains", "Initial Dose in Bloodmeal", "Freshly Fed (3 h)", "3 Days (72 h) Post Infection", "7 Days (168 h) Post Infection", "10 Days (240 h) Post Infection"], ["(A)"], ["Key West", "6.4 ± 0.09", "4.30 ± 0.0", "3.96 ± 0.26", "4.11 ± 1.78", "6.57 ± 0.05"], ["Orlando", "6.4 ± 0.08", "4.17 ± 0.39", "3.66 ± 0.27", "3.58 ± 1.23", "4.49 ± 0.34"], ["(B)"], ["Key West", "8.0 ± 0.09", "5.23 ± 0.10", "4.7 ± 0.81", "5.4 ± 0.46", "5.20 ± 0.49"], ["Orlando", "8.3 ± 0.08", "4.56 ± 1.16", "5.04 ± 0.71", "5.81 ± 0.48", "5.53 ± 0.33"]], "row_count": 7, "column_count": 6, "numeric_cells": 24, "header_rows": 1, "locator": "section[8]/table-wrap[1]#ijms-20-00615-t003"}}, {"id": "asset:table:pmid:30708982:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fdc03ca6f3c3a96eb9154279adcb59d16aa2771a2a7e539070160ae23ba30b7e", "bytes": 1160, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#ijms-20-00615-t004", "version": null, "note": "(A) MANOVA results for strain and time effects of the AaeLRIM1 and AaeAPL1 RNA profile in response to Zika virus infection of Ae. aegypti. (B) MANOVA results for strain and time effects of paralogues of the AaeAPL1 RNA profile in response to Zika virus infection of Ae. aegypti.", "structure": {"pmcid": "PMC6386990", "section_index": 9, "section_title": "2.5. AaeLRIM1 and AaeAPL1 Transcriptional Induction of ZIKV Infections in Orally Infected Ae. aegypti Females", "row_count": 5, "column_count": 17}, "table": {"label": "Table 4", "caption": "(A) MANOVA results for strain and time effects of the AaeLRIM1 and AaeAPL1 RNA profile in response to Zika virus infection of Ae. aegypti. (B) MANOVA results for strain and time effects of paralogues of the AaeAPL1 RNA profile in response to Zika virus infection of Ae. aegypti.", "rows": [["(A)", "Treatment", "Pillai’s Trace", "df (Numerator and Denominator", "p-value", "Standardized Canonical Coefficients", "(B)", "Treatment", "Pillai’s Trace", "df (Num., Denom.)", "p-value", "Standardized Canonical Coefficients"], ["AaeLR1M1", "AaeAPL1", "AaeLR1M3", "AaeLRIM4", "AaeLRIM15", "AaeLRIM16", "AaeLRIM17"], ["", "Strain", "0.86", "2, 31", "<0.0001", "8.06", "−1.16", "", "Strain", "0.96", "5, 28", "<0.0001", "2.78", "0.14", "−4.04", "11.14", "2.86"], ["", "Time", "1.94", "14, 64", "<0.0001", "8.07", "−1.01", "", "Time", "3.19", "35, 160", "<0.0001", "−0.05", "5.94", "4.41", "−1.81", "8.07"], ["", "Strain × Time", "1.86", "14, 64", "<0.0001", "2.45", "5.84", "", "Strain × Time", "3.50", "35, 160", "<0.0001", "2.92", "2.25", "−6.76", "11.38", "1.44"]], "row_count": 5, "column_count": 17, "numeric_cells": 42, "header_rows": 2, "locator": "section[9]/table-wrap[1]#ijms-20-00615-t004"}}, {"id": "asset:table:pmid:30708982:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f21548f55d797850dff01f75c89c5174dbe833b8766dfae1dd653a54672e6f16", "bytes": 1188, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#ijms-20-00615-t005", "version": null, "note": "(A) MANOVA results for strain and time effects of AaeLRIM1 and AaeAPL1 RNA profile in response to chikungunya virus infection of Ae. aegypti. (B) MANOVA results for strain and time effects of paralogues of AaeAPL1 RNA profile in response to chikungunya virus infection of Ae. aegypti.", "structure": {"pmcid": "PMC6386990", "section_index": 10, "section_title": "2.6. AaeLRIM1 and AaeAPL1 Transcriptional Induction of CHIKV Infections in Orally Infected Ae. aegypti Females", "row_count": 5, "column_count": 17}, "table": {"label": "Table 5", "caption": "(A) MANOVA results for strain and time effects of AaeLRIM1 and AaeAPL1 RNA profile in response to chikungunya virus infection of Ae. aegypti. (B) MANOVA results for strain and time effects of paralogues of AaeAPL1 RNA profile in response to chikungunya virus infection of Ae. aegypti.", "rows": [["(A)", "Treatment", "Pillai’s Trace", "df (Numerator and Denominator)", "p-value", "Standardized Canonical Coefficients", "(B)", "Treatment", "Pillai’s Trace", "df (Numerator and Denominator)", "p-value", "Standardized Canonical Coefficients"], ["AaeLR1M1", "AaeAPL1", "AaeLR1M3", "AaeLRIM4", "AaeLRIM15", "AaeLRIM16", "AaeLRIM17"], ["", "Strain", "0.60", "2, 27", "<0.0001", "5.90", "1.23", "", "Strain", "0.99", "5, 24", "<0.0001", "25.13", "−0.51", "−0.28", "10.46", "−0.58"], ["", "Time", "1.77", "12, 56", "<0.0001", "4.59", "2.61", "", "Time", "2.70", "30, 140", "<0.0001", "25.50", "−0.99", "0.22", "11.01", "−1.32"], ["", "Strain × Time", "1.79", "12, 56", "<0.0001", "6.20", "0.79", "", "Strain × Time", "2.31", "30, 140", "<0.0001", "24.57", "−0.32", "0.46", "10.82", "−1.08"]], "row_count": 5, "column_count": 17, "numeric_cells": 42, "header_rows": 2, "locator": "section[10]/table-wrap[1]#ijms-20-00615-t005"}}, {"id": "asset:table:pmid:30708982:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9d44085365260500ec7b2ac4eec64a27fb44d2c01bae270c9c409a2ddbaf700d", "bytes": 1422, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#ijms-20-00615-t006", "version": null, "note": "Primers from Aedes aegypti for qPCR reaction.", "structure": {"pmcid": "PMC6386990", "section_index": 16, "section_title": "4.4. cDNA Synthesis and qPCR Amplification", "row_count": 17, "column_count": 5}, "table": {"label": "Table 6", "caption": "Primers from Aedes aegypti for qPCR reaction.", "rows": [["Gene ID", "Accession", "Gene Name", "Primer Name", "Primer Sequence (5′–3′)"], ["AAEL012086", "XM_001662191.2", "AaeLRIM1", "AaeLRIM1-086-1011F", "TGACAACCGGGTTAAGGAAG"], ["", "", "", "AaeLRIM1-086-1198R", "TGGCCAAATCATTGTTCTCA"], ["AAEL024406 1", "XM_021843329.1", "AaeAPL1", "AaeAPL1-406-115F", "TCAACCCAGCCTCCAGATAC"], ["", "", "", "AaeAPL1-406-275R", "TCAGCAGTTTCACCACTTGC"], ["AAEL010132", "XM_001660603.2", "AaeLRIM3", "AaeLRIM3-132-166F", "TGTAGCCCGCAATAATCACA"], ["", "", "", "AaeLRIM3-132-405R", "CTGAAGTGCTCCGTTGAACA"], ["AAEL010128", "XM_001660601.2", "AaeLRIM4", "AaeLRIM4-128-612F", "TGTAGCCCGCAATAATCACA"], ["", "", "", "AaeLRIM4-128-830R", "GCCAGATTAAGCTCCACGAG"], ["AAEL007103", "XM_001658083.2", "AaeLRIM15", "AaeLRIM15-103-1522F", "ATGGTATTGCGTGGAGGAAG"], ["", "", "", "AaeLRIM15-103-1676R", "ATCCTATCAACCGCCCTTCT"], ["AAEL008658", "XM_021855914.1", "AaeLRIM16", "AaeLRIM16-658-299F", "ACACCTTCGAGAAAGCGAAA"], ["", "", "", "AaeLRIM16-658-541R", "TCAACATGGGCAAATGAGAA"], ["AAEL010125", "XM_001660604.2", "AaeLRIM17", "AaeLRIM17-125-555F", "GCAGTACAATTCGCTGACCA"], ["", "", "", "AaeLRIM17-125-718R", "CCTTAAGCCGATTGAAGCTG"], ["AAEL011197", "XM_001655125.2", "AaeActin", "AaeActin-197-152F", "AGGACTCGTACGTCGGTGAC"], ["", "", "", "AaeActin-197-590R", "CGTTCAGTCAGGATCTTC"]], "row_count": 17, "column_count": 5, "numeric_cells": 36, "header_rows": 1, "locator": "section[16]/table-wrap[1]#ijms-20-00615-t006"}}, {"id": "asset:table:pmid:30708982:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:848cebd11a8deadea129ab7ce5b4682a84aea06b9c3f54edacddffe816e5d137", "bytes": 345, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#array1", "version": null, "note": null, "structure": {"pmcid": "PMC6386990", "section_index": 20, "section_title": "Abbreviations", "row_count": 5, "column_count": 2}, "table": {"label": null, "caption": null, "rows": [["ZIKV", "Zika Virus"], ["CHIKV", "Chikungunya Virus"], ["LRR", "Leucine-Rich Repeats"], ["LRIM1", "Leucine-Rich Repeat Immune Protein 1"], ["APL1", "Anopheles Plasmodium-responsive Leucine-rich Repeat 1"]], "row_count": 5, "column_count": 2, "numeric_cells": 2, "header_rows": 0, "locator": "section[20]/table-wrap[1]#array1"}}], "gaps": ["asset:data:geo:GSE118858 not downloaded", "asset:data:geo:GSE118858 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "So, we used a multivariate analysis of variance approach (MANOVA), which enabled us to simultaneously measure various treatment effects (e.g., developmental stage, infection with ZIKV and CHIKV) on the expression of multiple genes."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE118858"], "resolved_accessions": ["GSE118858"], "statements": ["The RNA-seq data have been deposited to NCBI (https://www.ncbi.nlm.nih.gov/gds/?term=GSE118858)."], "basis": "The paper names GSE118858 in NCBI and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:30708982", "data:geo:GSE118858", "asset:table:pmid:30708982:1", "asset:table:pmid:30708982:2", "asset:table:pmid:30708982:3", "asset:table:pmid:30708982:4", "asset:table:pmid:30708982:5", "asset:table:pmid:30708982:6", "asset:table:pmid:30708982:7"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE118858"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:13:35Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 48077, "completion_tokens": 987, "cached_tokens": 16136}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30708982", "type": "paper", "label": "pmid:30708982"}, {"id": "source:pmid:30708982", "type": "manuscript", "label": "PMID 30708982 full text"}, {"id": "data:geo:GSE118858", "type": "dataset", "label": "GEO GSE118858"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30708982", "type": "paper", "label": "pmid:30708982"}, {"id": "source:pmid:30708982", "type": "manuscript", "label": "PMID 30708982 full text"}, {"id": "data:geo:GSE118858", "type": "dataset", "label": "GEO GSE118858"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30708982", "type": "extraction", "used": ["source:pmid:30708982"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE118858", "type": "accession_resolution", "used": ["data:geo:GSE118858"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30708982", "parent_hash": "sha256:35ac8c7b0c807b0af2867c3202f29348bea4c85128260c985d7136bb75e07f8a", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE118858 licence not read", "asset:data:geo:GSE118858 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ions in the eggs, larvae, pupae, and adults. RNA-seq analysis data provided 60 leucine-rich repea", "accessed on: August 22, 2018, GEO DataSets). RNA-seq analysis data showed that AaeLRIM1 (AAEL0120", "e S1A–D: Female Aedes aegypti transcriptomic RNA-seq data show Leucine-Rich Repeat Proteins 7-day", "/3/615/s1. Table S1A–D: Female Aedes aegypti transcriptomic RNA-seq data show Leucine-Rich Repeat Protei"], "order_basis": "paper_text_order:583", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["st strain compared to an Orlando strain. The qPCR data showed that LRR-containing proteins rel"], "order_basis": "paper_text_order:1031", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["So, we used a multivariate analysis of variance approach (MANOVA), which enabled us to simultaneously measure various treatment effects (e.g., developmental stage, infection with ZIKV and CHIKV) on the expression of multiple genes."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}