Identification of an eight-gene signature for survival prediction for patients with hepatocellular carcinoma based on integrated bioinformatics analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:30918751", "kind": "science-record", "revision": 6, "content_hash": "sha256:5416f6fb0624eaa2167542ebd60be4acc4f65e21cb87cba65717184c71e4083d", "created_at": "2026-11-01T15:40:43Z", "updated_at": "2026-11-01T21:22:05Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of an eight-gene signature for survival prediction for patients with hepatocellular carcinoma based on integrated bioinformatics analysis.", "doi": "10.7717/peerj.6548", "pmid": "30918751", "authors": ["Guo-Jie Qiao", "Liang Chen", "Jin-Cai Wu", "Zhou-Ri Li"], "journal": "PeerJ", "year": 2019, "abstract": "BACKGROUND: Hepatocellular carcinoma (HCC) remains one of the leading causes of cancer-related death worldwide. Despite recent advances in imaging techniques and therapeutic intervention for HCC, the low overall 5-year survival rate of HCC patients remains unsatisfactory. This study aims to find a gene signature to predict clinical outcomes in HCC.\nMETHODS: Bioinformatics analysis including Cox's regression analysis, Kaplan-Meier (KM) and receiver operating characteristic curve (ROC) analysis and the random survival forest algorithm were performed to mine the expression profiles of 553 hepatocellular carcinoma (HCC) patients from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) public database.\nRESULTS: We selected a signature comprising eight protein-coding genes (DCAF13, FAM163A, GPR18, LRP10, PVRIG, S100A9, SGCB, and TNNI3K) in the training dataset (AUC = 0.77 at five years, n = 332). The signature stratified patients into high- and low-risk groups with significantly different survival in the training dataset (median 2.20 vs. 8.93 years, log-rank test P < 0.001) and in the test dataset (median 2.68 vs. 4.24 years, log-rank test P = 0.004, n = 221, GSE14520). Further multivariate Cox regression analysis showed that the signature was an independent prognostic factor for patients with HCC. Compared with TNM stage and another reported three-gene model, the signature displayed improved survival prediction power in entire dataset (AUC signature = 0.66 vs. AUC TNM = 0.64 vs. AUC gene model = 0.60, n = 553). Stratification analysis shows that it can be used as an auxiliary marker for many traditional staging models.\nCONCLUSIONS: We constructed an eight-gene signature that can be a novel prognostic marker to predict the survival of HCC patients.", "claims": [{"id": "claim-method", "statement": "Then, univariate Cox and multivariate Cox regression analyses were performed in the training dataset and showed that the PCG signature was an independent prognostic factor after adjusting for other clinical features, including sex, age and pTNM (high-risk group vs. low-risk group, HR = 7.23, 95% CI [4.19–12.47], P < 0.001, n = 332, Table 3).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30918751", "locator": "sections[13] \"The PCG signature is an independent prognostic factor\" paragraph 2", "quote": "Then, univariate Cox and multivariate Cox regression analyses were performed in the training dataset and showed that the PCG signature was an independent prognostic factor after adjusting for other clinical features, including sex, age and pTNM (high-risk group vs. low-risk group, HR = 7.23, 95% CI [4.19–12.47], P < 0.001, n = 332, Table 3)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The following information was supplied regarding data availability:\nThe dataset with mRNA expression profiling and clinical information was taken from GEO: GSE14520.\nThe dataset including gene expression profile and associated corresponding clinical information of patients analysed in this study was downloaded from The Cancer Genome Atlas (TCGA, http://cancergenome.nih.gov/):\nLiver cancer data: https://xenabrowser.net/datapages/?cohort=GDC%20TCGA%20Liver%20Cancer%20(LIHC)\nFPKM: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.htseq_fpkm.tsv.gz\nClinical data, survival data: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.survival.tsv.gz\nPhenotype: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.GDC_phenotype.tsv.gz.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:30918751", "locator": "sections[30] \"Data Availability Statement\" paragraphs 1-8", "quote": "The following information was supplied regarding data availability:\nThe dataset with mRNA expression profiling and clinical information was taken from GEO: GSE14520.\nThe dataset including gene expression profile and associated corresponding clinical information of patients analysed in this study was downloaded from The Cancer Genome Atlas (TCGA, http://cancergenome.nih.gov/):\nLiver cancer data: https://xenabrowser.net/datapages/?cohort=GDC%20TCGA%20Liver%20Cancer%20(LIHC)\nFPKM: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.htseq_fpkm.tsv.gz\nClinical data, survival data: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.survival.tsv.gz\nPhenotype: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.GDC_phenotype.tsv.gz."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:30918751"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE14520"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE14520"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:30918751", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.7717/peerj.6548", "sha256": "sha256:d38d3b4abf3d1fe9a177bf5ac4cfe0a4cf53721ff22f8c25a1c98b27eafda34d", "bytes": 42591, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.7717/peerj.6548", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6431139", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE14520", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE14520", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE14520", "version": null, "note": "The following information was supplied regarding data availability:\nThe dataset with mRNA expression profiling and clinical information was taken from GEO: GSE14520.\nThe dataset including gene expression profile and associated corresponding clinical information of patients analysed in this study was downloaded from The Cancer Genome Atlas (TCGA, http://cancergenome.nih.gov/):\nLiver cancer data: https://xenabrowser.net/datapages/?cohort=GDC%20TCGA%20Liver%20Cancer%20(LIHC)\nFPKM: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.htseq_fpkm.tsv.gz\nClinical data, survival data: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.survival.tsv.gz\nPhenotype: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.GDC_phenotype.tsv.gz.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The following information was supplied regarding data availability:\nThe dataset with mRNA expression profiling and clinical information was taken from GEO: GSE14520.\nThe dataset including gene expression profile and associated corresponding clinical information of patients analysed in this study was downloaded from The Cancer Genome Atlas (TCGA, http://cancergenome.nih.gov/):\nLiver cancer data: https://xenabrowser.net/datapages/?cohort=GDC%20TCGA%20Liver%20Cancer%20(LIHC)\nFPKM: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.htseq_fpkm.tsv.gz\nClinical data, survival data: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.survival.tsv.gz\nPhenotype: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.GDC_phenotype.tsv.gz.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM362947", "GSM362948", "GSM362949", "GSM362950", "GSM362951", "GSM362952", "GSM362953", "GSM362954", "GSM362955", "GSM362956", "GSM362957", "GSM362958", "GSM362959", "GSM362960", "GSM362961", "GSM362962", "GSM362963", "GSM362964", "GSM362965", "GSM362966", "GSM362967", "GSM362968", "GSM362969", "GSM362970", "GSM362971", "GSM362972", "GSM362973", "GSM362974", "GSM362975", "GSM362976", "GSM362977", "GSM362978", "GSM362979", "GSM362980", "GSM362981", "GSM362982", "GSM362983", "GSM362984", "GSM362985", "GSM362986", "GSM362987", "GSM362988", "GSM362989", "GSM362990", "GSM362991", "GSM362992", "GSM362993", "GSM362994", "GSM362995", "GSM362996", "GSM362997", "GSM362998", "GSM362999", "GSM363000", "GSM363001", "GSM363002", "GSM363003", "GSM363004", "GSM363005", "GSM363006", "GSM363007", "GSM363008", "GSM363009", "GSM363010", "GSM363011", "GSM363012", "GSM363013", "GSM363014", "GSM363015", "GSM363016", "GSM363017", "GSM363018", "GSM363019", "GSM363020", "GSM363021", "GSM363022", "GSM363023", "GSM363024", "GSM363025", "GSM363026", "GSM363027", "GSM363028", "GSM363029", "GSM363030", "GSM363031", "GSM363032", "GSM363033", "GSM363034", "GSM363035", "GSM363036", "GSM363037", "GSM363038", "GSM363039", "GSM363040", "GSM363041", "GSM363042", "GSM363043", "GSM363044", "GSM363045", "GSM363046", "GSM363047", "GSM363048", "GSM363049", "GSM363050", "GSM363051", "GSM363052", "GSM363053", "GSM363054", "GSM363055", "GSM363056", "GSM363057", "GSM363058", "GSM363059", "GSM363060", "GSM363061", "GSM363062", "GSM363063", "GSM363064", "GSM363065", "GSM363066", "GSM363067", "GSM363068", "GSM363069", "GSM363070", "GSM363071", "GSM363072", "GSM363073", "GSM363074", "GSM363075", "GSM363076", "GSM363077", "GSM363078", "GSM363079", "GSM363080", "GSM363081", "GSM363082", "GSM363083", "GSM363084", "GSM363085", "GSM363086", "GSM363087", "GSM363088", "GSM363089", "GSM363090", "GSM363091", "GSM363092", "GSM363093", "GSM363094", "GSM363095", "GSM363096", "GSM363097", "GSM363098", "GSM363099", "GSM363100", "GSM363101", "GSM363102", "GSM363103", "GSM363104", "GSM363105", "GSM363106", "GSM363107", "GSM363108", "GSM363109", "GSM363110", "GSM363111", "GSM363112", "GSM363113", "GSM363114", "GSM363115", "GSM363116", "GSM363117", "GSM363118", "GSM363119", "GSM363120", "GSM363121", "GSM363122", "GSM363123", "GSM363124", "GSM363125", "GSM363126", "GSM363127", "GSM363128", "GSM363129", "GSM363130", "GSM363131", "GSM363132", "GSM363133", "GSM363134", "GSM363135", "GSM363136", "GSM363137", "GSM363138", "GSM363139", "GSM363140", "GSM363141", "GSM363142", "GSM363143", "GSM363144", "GSM363145", "GSM363146", "GSM363147", "GSM363148", "GSM363149", "GSM363150", "GSM363151", "GSM363152", "GSM363153", "GSM363154", "GSM363155", "GSM363156", "GSM363157", "GSM363158", "GSM363159", "GSM363160", "GSM363161", "GSM363162", "GSM363163", "GSM363164", "GSM363165", "GSM363166", "GSM363167", "GSM363168", "GSM363169", "GSM363170", "GSM363171", "GSM363172", "GSM363173", "GSM363174", "GSM363175", "GSM363176", "GSM363177", "GSM363178", "GSM363179", "GSM363180", "GSM363181", "GSM363182", "GSM363183", "GSM363184", "GSM363185", "GSM363186", "GSM363187", "GSM363188", "GSM363189", "GSM363190", "GSM363191", "GSM363192", "GSM363193", "GSM363194", "GSM363195", "GSM363196", "GSM363197", "GSM363198", "GSM363199", "GSM363200", "GSM363201", "GSM363202", "GSM363203", "GSM363204", "GSM363205", "GSM363206", "GSM363207", "GSM363208", "GSM363209", "GSM363210", "GSM363211", "GSM363212", "GSM363213", "GSM363214", "GSM363215", "GSM363216", "GSM363217", "GSM363218", "GSM363219", "GSM363220", "GSM363221", "GSM363222", "GSM363223", "GSM363224", "GSM363225", "GSM363226", "GSM363227", "GSM363228", "GSM363229", "GSM363230", "GSM363231", "GSM363232", "GSM363233", "GSM363234", "GSM363235", "GSM363236", "GSM363237", "GSM363238", "GSM363239", "GSM363240", "GSM363241", "GSM363242", "GSM363243", "GSM363244", "GSM363245", "GSM363246", "GSM363247", "GSM363248", "GSM363249", "GSM363250", "GSM363251", "GSM363252", "GSM363253", "GSM363254", "GSM363255", "GSM363256", "GSM363257", "GSM363258", "GSM363259", "GSM363260", "GSM363261", "GSM363262", "GSM363263", "GSM363264", "GSM363265", "GSM363266", "GSM363267", "GSM363268", "GSM363269", "GSM363270", "GSM363271", "GSM363272", "GSM363273", "GSM363274", "GSM363275", "GSM363276", "GSM363277", "GSM363278", "GSM363279", "GSM363280", "GSM363281", "GSM363282", "GSM363283", "GSM363284", "GSM363285", "GSM363286", "GSM363287", "GSM363288", "GSM363289", "GSM363290", "GSM363291", "GSM363292", "GSM363293", "GSM363294", "GSM363295", "GSM363296", "GSM363297", "GSM363298", "GSM363299", "GSM363300", "GSM363301", "GSM363302", "GSM363303", "GSM363304", "GSM363305", "GSM363306", "GSM363307", "GSM363308", "GSM363309", "GSM363310", "GSM363311", "GSM363312", "GSM363313", "GSM363314", "GSM363315", "GSM363316", "GSM363317", "GSM363318", "GSM363319", "GSM363320", "GSM363321", "GSM363322", "GSM363323", "GSM363324", "GSM363325", "GSM363326", "GSM363327", "GSM363328", "GSM363329", "GSM363330", "GSM363331", "GSM363332", "GSM363333", "GSM363334", "GSM363335", "GSM363336", "GSM363337", "GSM363338", "GSM363339", "GSM363340", "GSM363341", "GSM363342", "GSM363343", "GSM363344", "GSM363345", "GSM363346", "GSM363347", "GSM363348", "GSM363349", "GSM363350", "GSM363351", "GSM363352", "GSM363353", "GSM363354", "GSM363355", "GSM363356", "GSM363357", "GSM363358", "GSM363359", "GSM363360", "GSM363361", "GSM363362", "GSM363363", "GSM363364", "GSM363365", "GSM363366", "GSM363367", "GSM363368", "GSM363369", "GSM363370", "GSM363371", "GSM363372", "GSM363373", "GSM363374", "GSM363375", "GSM363376", "GSM363378", "GSM363380", "GSM363381", "GSM363382", "GSM363384", "GSM363386", "GSM363388", "GSM363391", "GSM363393", "GSM363397", "GSM363400", "GSM363402", "GSM363404", "GSM363407", "GSM363417", "GSM363420", "GSM363421", "GSM363422", "GSM363423", "GSM363424", "GSM363425", "GSM363426", "GSM363427", "GSM363428", "GSM363429", "GSM363430", "GSM363431", "GSM363432", "GSM363433", "GSM363434", "GSM363435", "GSM363436", "GSM363437", "GSM363438", "GSM363439", "GSM363440", "GSM363441", "GSM363442", "GSM363443", "GSM363444", "GSM363445", "GSM363446", "GSM363447", "GSM363448", "GSM363449", "GSM363450", "GSM363451", "GSM712532", "GSM712533", "GSM712534", "GSM712535", "GSM712536", "GSM712537", "GSM712538", "GSM712539", "GSM712540", "GSM712541", "GSM712542"], "sample_count": 488, "group_sizes": null, "group_sizes_basis": null, "platform": "3921;571", "taxon": "Homo sapiens", "title": "Gene expression data of human hepatocellular carcinoma (HCC)", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:30918751:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:678ea1bc61e21b0ddf4fcbf5bf65c772d84e7462f5d99b8091b10d20466bb0a9", "bytes": 456, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#table-1", "version": null, "note": "Summary of patient demographics and clinical characteristics.", "structure": {"pmcid": "PMC6431139", "section_index": 8, "section_title": "Patient characteristics and expression profiles", "row_count": 10, "column_count": 3}, "table": {"label": "Table 1", "caption": "Summary of patient demographics and clinical characteristics.", "rows": [["Characteristic", "TCGA (n = 332)", "GSE14520(n = 221)"], ["Age (years)", "", ""], [">62", "170", "33"], ["≤62", "162", "188"], ["Sex", "", ""], ["female", "110", "30"], ["Male", "222", "191"], ["Vital status", "", ""], ["Living", "225", "136"], ["Dead", "107", "85"]], "row_count": 10, "column_count": 3, "numeric_cells": 16, "header_rows": 1, "locator": "section[8]/table-wrap[1]#table-1"}}, {"id": "asset:table:pmid:30918751:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ae26def894815163ddcf456c52dfa3331dfe7f9c44956b00f2f18163b1118ab4", "bytes": 1540, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#table-2", "version": null, "note": "Identities of PCGs in the prognostic signature and their univariable cox association with prognosis.", "structure": {"pmcid": "PMC6431139", "section_index": 10, "section_title": "Construction of the prognostic PCG signature in the training dataset", "row_count": 18, "column_count": 7}, "table": {"label": "Table 2", "caption": "Identities of PCGs in the prognostic signature and their univariable cox association with prognosis.", "rows": [["Database IDa", "Gene symbol", "Gene name", "Coefficientb", "Pb", "Gene expression level association with prognosis", "Primer (5′–3′)"], ["", "", "", "", "", "", "Forward(UP)/Reverse(down)"], ["ENSG00000164934", "DCAF13", "DDB1 and CUL4 associated factor 13", "0.389", "0.002", "high", "ACTGCACAGCTAAAGAACCG"], ["TCCCAGACTACTTCCAGTCAC"], ["ENSG00000143340", "FAM163A", "Family with sequence similarity 163 member A", "0.204", "0.002", "high", "TTTTACATACGGACGGCTGACA"], ["CTAATAGCCCTTGGATTGGTGAA"], ["ENSG00000197324", "LRP10", "LDL receptor related protein 10", "0.533", "<0.001", "high", "GCAGTGCTCTTAGAAGTGCAG"], ["CCTGATGGTGACAGTCTGTTC"], ["ENSG00000163069", "SGCB", "Sarcoglycan beta", "0.226", "0.001", "high", "AGCAAAGTTCCAATGGTCCTG"], ["TCATCAATCGGAATGTATCCAGC"], ["ENSG00000163220", "S100A9", "S100 calcium binding protein A9", "0.202", "<0.001", "high", "GGTCATAGAACACATCATGGAGG"], ["GGCCTGGCTTATGGTGGTG"], ["ENSG00000125245", "GPR18", "G protein-coupled receptor 18", "−0.311", "0.001", "low", "CAGTTGTACCACCAAGAAGAG"], ["GCACTAATAAAGGCAAGAAGC"], ["ENSG00000213413", "PVRIG", "PVR related immunoglobulin domain containing", "−0.345", "0.002", "low", "ACGTCCCTTATGCCACTATCA"], ["AGCGTAGAGTCCATTCTCAACA"], ["ENSG00000116783", "TNNI3K", "TNNI3 interacting kinase", "−0.48", "0.002", "low", "TCATAAACATCAACCACCAAG"], ["TTCATAAGCCCACATCAAACA"]], "row_count": 18, "column_count": 7, "numeric_cells": 35, "header_rows": 2, "locator": "section[10]/table-wrap[1]#table-2"}}, {"id": "asset:table:pmid:30918751:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d375e59cb5d50384756e05a268270e098a1267c54c1e3bfb6eb8a1cf7df18d85", "bytes": 1725, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#table-3", "version": null, "note": "Univariable and multivariable Cox regression analysis of the PCG signature and survival of HCC patients in the training and test group.", "structure": {"pmcid": "PMC6431139", "section_index": 13, "section_title": "The PCG signature is an independent prognostic factor", "row_count": 18, "column_count": 10}, "table": {"label": "Table 3", "caption": "Univariable and multivariable Cox regression analysis of the PCG signature and survival of HCC patients in the training and test group.", "rows": [["", "", "Univariable analysis", "Multivariable analysis"], ["Variables", "", "HR", "95% CI of HR", "P", "HR", "95% CI of HR", "P"], ["", "", "", "lower", "upper", "", "", "lower", "upper", ""], ["TCGA dataset (n = 332)", "", "", "", "", "", "", "", "", ""], ["Age", ">62 vs. ≤62", "1.45", "0.98", "2.13", "0.06", "1.23", "0.81", "1.85", "0.33"], ["Sex", "Male vs. Female", "0.75", "0.51", "1.1", "0.14", "0.76", "0.5", "1.15", "0.2"], ["pTNM stage", "I, II vs. III, IV", "1.49", "1.2", "1.86", "<0.001", "1.11", "0.71", "1.73", "0.66"], ["PCG-signature", "High risk vs. low risk", "7.19", "4.36", "11.86", "<0.001", "7.23", "4.19", "12.47", "<0.001"], ["GSE14520 set (n = 251)", "", "", "", "", "", "", "", "", ""], ["Age", ">62 vs. ≤62", "0.99", "0.97", "1.01", "0.40", "0.99", "0.97", "1.02", "0.56"], ["Sex", "Male vs.Female", "1.70", "0.82", "3.52", "0.15", "1.14", "0.54", "2.40", "0.73"], ["ALT", ">500 U.L vs. ≤500 U.L", "1.08", "0.70", "1.66", "0.73", "0.71", "0.45", "1.12", "0.14"], ["AFP", ">300 ng/ml vs. ≤300 ng/ml", "1.63", "1.06", "2.50", "0.03", "0.69", "0.35", "1.37", "0.29"], ["Cirrhosis", "Yes vs. No", "4.62", "1.14", "18.80", "0.03", "4.80", "1.15", "20.09", "0.03"], ["BCLC stage", "B,C vs.0,A", "2.10", "1.66", "2.66", "<0.001", "1.63", "1.05", "2.53", "0.03"], ["CLIP stage", ">2 vs. ≤1", "1.91", "1.55", "2.36", "<0.001", "1.49", "0.98", "2.28", "0.06"], ["pTNM stage", "III, IV vs. I, II", "1.39", "1.23", "1.58", "<0.001", "1.01", "0.83", "1.24", "0.91"], ["PCG-signature", "High risk vs. low risk", "1.87", "1.21", "2.88", "<0.001", "1.69", "1.06", "2.70", "0.03"]], "row_count": 18, "column_count": 10, "numeric_cells": 114, "header_rows": 3, "locator": "section[13]/table-wrap[1]#table-3"}}, {"id": "asset:table:pmid:30918751:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:494025c54162a5924ff9cc96cc54f5432fe35e2938fbe036b2a423ce32ce2ddb", "bytes": 847, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#table-4", "version": null, "note": "Association of the PCG signature with clinicoPathological characteristics in TCGA HCC patients.", "structure": {"pmcid": "PMC6431139", "section_index": 14, "section_title": "Stratification analysis", "row_count": 24, "column_count": 4}, "table": {"label": "Table 4", "caption": "Association of the PCG signature with clinicoPathological characteristics in TCGA HCC patients.", "rows": [["Variables", "Training group", "P"], ["", "Low risk*", "High risk*", ""], ["Age", "", "", "0.38"], [">62", "90", "80", ""], ["≤62", "77", "85", ""], ["Sex", "", "", "1.00"], ["Female", "55", "55", ""], ["Male", "112", "110", ""], ["TNM staging", "", "", "<0.001"], ["I, II", "137", "104", ""], ["III, IV", "23", "45", ""], ["UNKNOWN", "12", "11", ""], ["Pathologic M", "", "", "0.21"], ["M0", "123", "117", ""], ["M1", "0", "3", ""], ["UNKNOWN", "44", "45", ""], ["Pathologic N", "", "", "0.12"], ["N0", "173", "54", ""], ["N1", "3", "0", ""], ["UNKNOWN", "46", "56", ""], ["Pathologic T", "", "", "<0.001"], ["T1-2", "141", "117", ""], ["T3-4", "24", "48", ""], ["UNKNOWN", "2", "0", ""]], "row_count": 24, "column_count": 4, "numeric_cells": 42, "header_rows": 2, "locator": "section[14]/table-wrap[1]#table-4"}}, {"id": "asset:table:pmid:30918751:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0c3aef3242e7ea1c5a893c2666999eec217cd0bb1ecff8cffd490895a5a605b2", "bytes": 1151, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#table-5", "version": null, "note": "Association of the PCG signature with clinicoPathological characteristics in GSE14520 HCC patients.", "structure": {"pmcid": "PMC6431139", "section_index": 14, "section_title": "Stratification analysis", "row_count": 36, "column_count": 4}, "table": {"label": "Table 5", "caption": "Association of the PCG signature with clinicoPathological characteristics in GSE14520 HCC patients.", "rows": [["Variables", "Test group", "P"], ["", "Low risk*", "High risk*", ""], ["Age", "", "", "0.29"], [">62", "92", "96", ""], ["≤62", "20", "13", ""], ["Sex", "", "", "0.09"], ["Female", "20", "10", ""], ["Male", "92", "99", ""], ["TNM staging", "", "", "<0.001"], ["I, II", "97", "73", ""], ["III, IV", "14", "35", ""], ["UNKNOWN", "2", "0", ""], ["Tumor Size", "", "", "<0.001"], [">5 cm", "25", "55", ""], ["≤5 cm", "86", "54", ""], ["UNKNOWN", "1", "0", ""], ["BCLC staging", "", "", "0.02"], ["0&A", "94", "74", ""], ["B&C", "17", "34", ""], ["UNKNOWN", "1", "1", ""], ["CLIP staging", "", "", "0.08"], [">2", "3", "10", ""], ["≤2", "108", "98", ""], ["UNKNOWN", "1", "1", ""], ["HBV viral status", "", "", "0.90"], ["AVR-CC", "27", "29", ""], ["CC", "81", "75", ""], ["N", "3", "3", ""], ["UNKNOWN", "1", "2", ""], ["AFP (300 ng.ml)", "", "", "0.03"], [">300 ng", "41", "59", ""], ["≤300 ng", "69", "49", ""], ["UNKNOWN", "2", "1", ""], ["ALT (50 U.L)", "", "", "0.12"], [">50 U.L", "40", "51", ""], ["≤ 50 U.L", "72", "58", ""]], "row_count": 36, "column_count": 4, "numeric_cells": 72, "header_rows": 2, "locator": "section[14]/table-wrap[2]#table-5"}}], "gaps": ["asset:data:geo:GSE14520 not downloaded", "asset:data:geo:GSE14520 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Then, univariate Cox and multivariate Cox regression analyses were performed in the training dataset and showed that the PCG signature was an independent prognostic factor after adjusting for other clinical features, including sex, age and pTNM (high-risk group vs. low-risk group, HR = 7.23, 95% CI [4.19–12.47], P < 0.001, n = 332, Table 3)."}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "log-rank"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["cox_ph"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: cox_proportional_hazards."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE14520"], "resolved_accessions": ["GSE14520"], "statements": ["The following information was supplied regarding data availability:\nThe dataset with mRNA expression profiling and clinical information was taken from GEO: GSE14520.\nThe dataset including gene expression profile and associated corresponding clinical information of patients analysed in this study was downloaded from The Cancer Genome Atlas (TCGA, http://cancergenome.nih.gov/):\nLiver cancer data: https://xenabrowser.net/datapages/?cohort=GDC%20TCGA%20Liver%20Cancer%20(LIHC)\nFPKM: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.htseq_fpkm.tsv.gz\nClinical data, survival data: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.survival.tsv.gz\nPhenotype: https://gdc.xenahubs.net/download/TCGA-LIHC/Xena_Matrices/TCGA-LIHC.GDC_phenotype.tsv.gz."], "basis": "The paper names GSE14520 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["cox_ph"], "assets": ["source:pmid:30918751", "data:geo:GSE14520", "asset:table:pmid:30918751:1", "asset:table:pmid:30918751:2", "asset:table:pmid:30918751:3", "asset:table:pmid:30918751:4", "asset:table:pmid:30918751:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE14520"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:14:19Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 35714, "completion_tokens": 2733, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:30918751", "type": "paper", "label": "pmid:30918751"}, {"id": "source:pmid:30918751", "type": "manuscript", "label": "PMID 30918751 full text"}, {"id": "data:geo:GSE14520", "type": "dataset", "label": "GEO GSE14520"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:30918751", "type": "paper", "label": "pmid:30918751"}, {"id": "source:pmid:30918751", "type": "manuscript", "label": "PMID 30918751 full text"}, {"id": "data:geo:GSE14520", "type": "dataset", "label": "GEO GSE14520"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-30918751", "type": "extraction", "used": ["source:pmid:30918751"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE14520", "type": "accession_resolution", "used": ["data:geo:GSE14520"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:30918751", "parent_hash": "sha256:42da9dd142ebfdd627ea3e17633476bd2580565b9ffccd202b8dacd3fcf4f2f2", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE14520 licence not read", "asset:data:geo:GSE14520 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["cox_ph"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Then, univariate Cox and multivariate Cox regression analyses were performed in the training dataset and showed that the PCG signature was an independent prognostic factor after adjusting for other clinical features, including sex, age and pTNM (high-risk group vs. low-risk group, HR = 7.23, 95% CI [4.19–12.47], P < 0.001, n = 332, Table 3)."], "order_basis": "analysis_only", "id": "assay:1"}]}