Identification of a transcription factor-microRNA network in esophageal adenocarcinoma through bioinformatics analysis and validation through qRT-PCR.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:31114367", "kind": "science-record", "revision": 7, "content_hash": "sha256:329da14d40788e06192618467922720b99faaa01b4bc036aaea4fc658920587e", "created_at": "2026-11-01T15:40:45Z", "updated_at": "2026-11-01T21:22:12Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of a transcription factor-microRNA network in esophageal adenocarcinoma through bioinformatics analysis and validation through qRT-PCR.", "doi": "10.2147/CMAR.S201274", "pmid": "31114367", "authors": ["Di Chen", "Tong Lu", "Junying Tan", "Kun Zhao", "Yuli Li", "Wenjie Zhao", "Hao Li", "Qiuyue Wang", "Yuanyong Wang", "Liangzhou Wei"], "journal": "Cancer management and research", "year": 2019, "abstract": "Purpose: The rapidly rising incidence of esophageal adenocarcinoma (EAC), which is usually diagnosed late with a poor prognosis, has become a growing problem. This study investigated the potential transcription factor (TF)-related molecular mechanisms of EAC by using bioinformatics analysis and qRT-PCR validation. Methods: Expression profile datasets for mRNAs (GSE92396, GSE13898, GSE26886 and GSE1420) and miRNAs (GSE16456) were downloaded from the GEO database. Overlapping differentially expressed genes (DEGs) and differentially expressed miRNAs (DEMs) were identified through integrative analysis. Then, a TF-miRNA-mRNA network was constructed based on bioinformatics data from the TRRUST, TRED and miRTarBase database. Furthermore, overall survival analysis for the mRNAs and miRNAs in the TF-miRNA-mRNA network was performed with data from TCGA, and qRT-PCR was used to validate the results. Results: A total of 294 overlapping DEGs were identified in EAC tissues compared to normal tissues, including 181 downregulated and 113 upregulated genes. Then, 16 TFs that could target the DEGs and were related to cancer were predicted based on public databases, and 41 DEGs that could be targeted were identified as key genes. Additionally, 12 DEMs were predicted through miRTarBase to be associated with the key genes, and TP53-(miR-125b)-ID2 and JUN-(miR-30a)-IL1A from the TF-miRNA-mRNA network were identified to potentially play significant roles in EAC. Furthermore, CCL20, IL1A, ABCC3, hsa-miR-23b, and hsa-miR-191, which are involved in the TF-miRNA-mRNA network, were found to be significantly associated with patient survival in EAC. Finally, the expression of a miRNA-mRNA pair (hsa-miR-30a-5p and IL1A) was revealed to be correlated with prognosis. Conclusion: In this study, a TF-miRNA-mRNA network was constructed to analyze the potential molecular mechanisms of EAC. Key genes and miRNAs associated with patient survival were identified, which may reveal promising approaches for EAC diagnosis and therapy.", "claims": [{"id": "claim-method", "statement": "To verify the results obtained thus far, data for 89 EAC tissue samples and the clinical data of the patients were downloaded from TCGA, and the prognostic value of the key genes and miRNAs was identified by Kaplan-Meier analysis. The survival package in R software was used for survival analysis.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31114367", "locator": "sections[8] \"Survival analysis validation\" paragraph 2", "quote": "To verify the results obtained thus far, data for 89 EAC tissue samples and the clinical data of the patients were downloaded from TCGA, and the prognostic value of the key genes and miRNAs was identified by Kaplan-Meier analysis. The survival package in R software was used for survival analysis."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31114367", "locator": "sections[11] \"Microarray datasets from the GEO\" paragraph 2", "quote": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues"}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:31114367"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE13898"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE13898"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:31114367", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/CMAR.S201274", "sha256": "sha256:b7b2008719763f98a3ae2c299629001d4dd1248eb92077b2219b8bad0460317b", "bytes": 32490, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/CMAR.S201274", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6489589", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE13898", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE13898", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE13898", "version": null, "note": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM349960", "GSM349961", "GSM349962", "GSM349963", "GSM349964", "GSM349965", "GSM349966", "GSM349967", "GSM349968", "GSM349969", "GSM349970", "GSM349971", "GSM349972", "GSM349973", "GSM349974", "GSM349975", "GSM349976", "GSM349977", "GSM349978", "GSM349979", "GSM349980", "GSM349981", "GSM349982", "GSM349983", "GSM349984", "GSM349985", "GSM349986", "GSM349987", "GSM349988", "GSM349989", "GSM349990", "GSM349991", "GSM349992", "GSM349993", "GSM349994", "GSM349995", "GSM349996", "GSM349997", "GSM349998", "GSM349999", "GSM350000", "GSM350001", "GSM350002", "GSM350003", "GSM350004", "GSM350005", "GSM350006", "GSM350007", "GSM350008", "GSM350009", "GSM350010", "GSM350011", "GSM350012", "GSM350013", "GSM350014", "GSM350015", "GSM350016", "GSM350017", "GSM350018", "GSM350019", "GSM350020", "GSM350021", "GSM350022", "GSM350023", "GSM350024", "GSM350025", "GSM350026", "GSM350027", "GSM350028", "GSM350029", "GSM350030", "GSM350031", "GSM350032", "GSM350033", "GSM350034", "GSM350035", "GSM350036", "GSM350037", "GSM350038", "GSM350039", "GSM350040", "GSM350041", "GSM350042", "GSM350043", "GSM350044", "GSM350045", "GSM350046", "GSM350047", "GSM350048", "GSM350049", "GSM350050", "GSM350051", "GSM350052", "GSM350053", "GSM350054", "GSM350055", "GSM350056", "GSM350057", "GSM350058", "GSM350059", "GSM350060", "GSM350061", "GSM350062", "GSM350063", "GSM350064", "GSM350065", "GSM350066", "GSM350067", "GSM350068", "GSM350069", "GSM350070", "GSM350071", "GSM350072", "GSM350073", "GSM350074", "GSM350075", "GSM350076", "GSM350077"], "sample_count": 118, "group_sizes": null, "group_sizes_basis": null, "platform": "6102", "taxon": "Homo sapiens", "title": "Robust prognostic biomarkers for EAC identified by systems-level characterization of tumor transcriptome", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE1420", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE1420", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE1420", "version": null, "note": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM23385", "GSM23386", "GSM23387", "GSM23388", "GSM23389", "GSM23390", "GSM23391", "GSM23392", "GSM23395", "GSM23396", "GSM23397", "GSM23398", "GSM23399", "GSM23400", "GSM23401", "GSM23402", "GSM23413", "GSM23417", "GSM23419", "GSM23422", "GSM23424", "GSM23425", "GSM23426", "GSM23427"], "sample_count": 24, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Barrett's esophagus, Barrett's-associated adenocarcinomas and normal esophageal epithelium", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE16456", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE16456", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE16456", "version": null, "note": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM413658", "GSM413659", "GSM413660", "GSM413661", "GSM413662", "GSM413663", "GSM413664", "GSM413665", "GSM413666", "GSM413667", "GSM413668", "GSM413669", "GSM413670", "GSM413671", "GSM413672", "GSM413673", "GSM413674", "GSM413675", "GSM413676", "GSM413677", "GSM413678", "GSM413679", "GSM413680", "GSM413681", "GSM413682", "GSM413683", "GSM413684", "GSM413685", "GSM413686", "GSM413687", "GSM413688", "GSM413689"], "sample_count": 32, "group_sizes": null, "group_sizes_basis": null, "platform": "6955", "taxon": "Homo sapiens", "title": "MicroRNA expression signatures in Barrett's esophagus and esophageal adenocarcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE26886", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE26886", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE26886", "version": null, "note": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM661721", "GSM661722", "GSM661723", "GSM661724", "GSM661725", "GSM661726", "GSM661727", "GSM661728", "GSM661729", "GSM661730", "GSM661731", "GSM661732", "GSM661733", "GSM661734", "GSM661735", "GSM661736", "GSM661737", "GSM661738", "GSM661739", "GSM661740", "GSM661741", "GSM661742", "GSM661743", "GSM661744", "GSM661745", "GSM661746", "GSM661747", "GSM661748", "GSM661749", "GSM661750", "GSM661751", "GSM661752", "GSM661753", "GSM661754", "GSM661755", "GSM661756", "GSM661757", "GSM661758", "GSM661759", "GSM661760", "GSM661761", "GSM661762", "GSM661763", "GSM661764", "GSM661765", "GSM661766", "GSM661767", "GSM661768", "GSM661769", "GSM661770", "GSM661771", "GSM661772", "GSM661773", "GSM661774", "GSM661775", "GSM661776", "GSM661777", "GSM661778", "GSM661779", "GSM661780", "GSM661781", "GSM661782", "GSM661783", "GSM661784", "GSM661785", "GSM661786", "GSM661787", "GSM661788", "GSM661789"], "sample_count": 69, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression profiling of Barrett's esophagus, adenocarcinoma, esophageal squamous epithelium and squamous cell carcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE92396", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE92396", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE92396", "version": null, "note": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM2428973", "GSM2428974", "GSM2428975", "GSM2428976", "GSM2428977", "GSM2428978", "GSM2428979", "GSM2428980", "GSM2428981", "GSM2428982", "GSM2428983", "GSM2428984", "GSM2428985", "GSM2428986", "GSM2428987", "GSM2428988", "GSM2428989", "GSM2428990", "GSM2428991", "GSM2428992", "GSM2428993", "GSM2428994"], "sample_count": 22, "group_sizes": null, "group_sizes_basis": null, "platform": "6244", "taxon": "Homo sapiens", "title": "Esophageal adenocarcinoma gene expression profiling", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:31114367:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9e536dd30bd1a67e85247feadcc2ec7bc41381fb1168987548a7c723e0eaa653", "bytes": 617, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#T0001", "version": null, "note": "Primer sequences of qRT-PCR", "structure": {"pmcid": "PMC6489589", "section_index": 9, "section_title": "Total RNA extraction and qRT-PCR validation", "row_count": 7, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primer sequences of qRT-PCR", "rows": [["Primer", "Forward primer (5′–3′)", "Reverse primer (5′–3′)"], ["IL1A", "AGATGCCTGAGATACCCAAAACC", "CCAAGCACACCCAGTAGTCT"], ["ABCC3", "TGGGGTGAAGTTTCGTACTGG", "CACGTTTGACTGAGTTGGTGATA"], ["CCL20", "TGCTGTACCAAGAGTTTGCTC", "CGCACACAGACAACTTTTTCTTT"], ["Hsa-miR-23b", "CACAAAGGCATCTCTACGCCCATC", "TGTAGCTGCCTCGCCAGAGGC"], ["Hsa-miR-191", "CTGGACAGCGGGCAACGGAAT", "GCAGGAGAGCAGGGGACGAAAT"], ["Hsa-U6", "TGCGGGTGCTCGCTTCGGCAGC", "CCAGTGCAGGGTCCGAGGT"]], "row_count": 7, "column_count": 3, "numeric_cells": 5, "header_rows": 1, "locator": "section[9]/table-wrap[1]#T0001"}}, {"id": "asset:table:pmid:31114367:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7bdeb49559c8a42c78f71e3c847424c7ee99159a2c7ae2c6c465ae342f6cf0c1", "bytes": 853, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#T0002", "version": null, "note": "Information of expression profiling microarray datasets", "structure": {"pmcid": "PMC6489589", "section_index": 11, "section_title": "Microarray datasets from the GEO", "row_count": 7, "column_count": 7}, "table": {"label": "Table 2", "caption": "Information of expression profiling microarray datasets", "rows": [["Accession number", "Platform", "Organism", "Experimenttype", "Status", "Numbers of samples"], ["EAC", "NE"], ["GSE16456", "GPL6955", "Homo sapiens", "Non-coding RNA profiling by array", "Public on December 31, 2009", "6", "16"], ["GSE1420", "GPL96", "Homo sapiens", "Expression profiling by array", "Public on November 18, 2004", "8", "8"], ["GSE13898", "GPL6102", "Homo sapiens", "Expression profiling by array", "Public on January 04, 2011", "64", "28"], ["GSE92396", "GPL6244", "Homo sapiens", "Expression profiling by array", "Public on December 15, 2016", "12", "9"], ["GSE26886", "GPL570", "Homo sapiens", "Expression profiling by array", "Public on October 18, 2013", "21", "19"]], "row_count": 7, "column_count": 7, "numeric_cells": 25, "header_rows": 2, "locator": "section[11]/table-wrap[1]#T0002"}}, {"id": "asset:table:pmid:31114367:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2f638b3495ab3c016478c2389f9c4e642240dfaffa527c014bd08716e35fdcb8", "bytes": 415, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#T0003", "version": null, "note": "Regulatory relationships among TFs, key genes, and miRNAs", "structure": {"pmcid": "PMC6489589", "section_index": 13, "section_title": "Construction of the TF-miRNA-mRNA network", "row_count": 4, "column_count": 5}, "table": {"label": "Table 3", "caption": "Regulatory relationships among TFs, key genes, and miRNAs", "rows": [["Relationship", "Number of pairs/sets", "Number of TFs", "Number of key genes", "Number of miRNAs"], ["TF-key gene", "97", "16", "41", "-"], ["miRNA-key gene", "12", "-", "7", "12"], ["TF-miRNA-key gene", "2", "2", "2", "2"]], "row_count": 4, "column_count": 5, "numeric_cells": 10, "header_rows": 1, "locator": "section[13]/table-wrap[1]#T0003"}}, {"id": "asset:table:pmid:31114367:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5b537b2eda1bb613850cee3380dc5320484edd67dce2875b09b16fd1225c6ffc", "bytes": 1538, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T0004", "version": null, "note": "GO terms of key genes", "structure": {"pmcid": "PMC6489589", "section_index": 14, "section_title": "Functional and pathway analysis of key genes", "row_count": 21, "column_count": 4}, "table": {"label": "Table 4", "caption": "GO terms of key genes", "rows": [["", "GO terms", "Number of enriched genes", "P-value"], ["Biological process", "GO:0006954-inflammatory response", "9", "2.56E-06"], ["", "GO:0022617-extracellular matrix disassembly", "5", "3.13E-05"], ["", "GO:0043123-positive regulation of I-kappaB kinase/NF-kappaB signaling", "5", "5.69 E-04"], ["", "GO:0008544-epidermis development", "4", "1.08 E-03"], ["", "GO:0001649-osteoblast differentiation", "4", "1.93 E-03"], ["", "GO:0008285-negative regulation of cell proliferation", "6", "2.37 E-03"], ["", "GO:0043066-negative regulation of apoptotic process", "6", "4.30 E-03"], ["", "GO:0031424-keratinization", "3", "5.82 E-03"], ["", "GO:0018149-peptide cross-linking", "3", "6.30 E-03"], ["", "GO:0002248~connective tissue replacement involved in inflammatory response wound healing", "2", "9.50 E-03"], ["", "GO:0030574-collagen catabolic process", "3", "1.02 E-02"], ["Cellular component", "GO:0005615-extracellular space", "17", "8.33E-09"], ["", "GO:0005576-extracellular region", "18", "1.38E-08"], ["", "GO:0070062-extracellular exosome", "21", "3.26E-07"], ["", "GO:0005578-proteinaceous extracellular matrix", "6", "2.86E-04"], ["", "GO:0001533-cornified envelope", "3", "4.57E-03"], ["Molecular function", "GO:0005125-cytokine activity", "6", "5.03E-05"], ["", "GO:0008083-growth factor activity", "5", "5.17E-04"], ["", "GO:0005515-protein binding", "31", "1.24E-03"], ["", "GO:0004175-endopeptidase activity", "3", "6.90E-03"]], "row_count": 21, "column_count": 4, "numeric_cells": 60, "header_rows": 1, "locator": "section[14]/table-wrap[1]#T0004"}}, {"id": "asset:table:pmid:31114367:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ee60491e2865b7a94f4acb2de27ed85995440e6a81081e2e4319b270ec25292d", "bytes": 515, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#T0005", "version": null, "note": "KEGG pathways of key genes", "structure": {"pmcid": "PMC6489589", "section_index": 14, "section_title": "Functional and pathway analysis of key genes", "row_count": 6, "column_count": 3}, "table": {"label": "Table 5", "caption": "KEGG pathways of key genes", "rows": [["KEGG terms", "Number of enriched genes", "P-value"], ["hsa04668:TNF signaling pathway", "5", "5.44 E-04"], ["hsa05323:Rheumatoid arthritis", "4", "3.80 E-03"], ["hsa04060:Cytokine-cytokine receptor interaction", "5", "1.07 E-02"], ["hsa05202:Transcriptional misregulation in cancer", "4", "2.18 E-02"], ["hsa05200:Pathways in cancer", "5", "4.51 E-02"]], "row_count": 6, "column_count": 3, "numeric_cells": 15, "header_rows": 1, "locator": "section[14]/table-wrap[2]#T0005"}}], "gaps": ["asset:data:geo:GSE13898 not downloaded", "asset:data:geo:GSE13898 licence not read", "asset:data:geo:GSE1420 not downloaded", "asset:data:geo:GSE1420 licence not read", "asset:data:geo:GSE16456 not downloaded", "asset:data:geo:GSE16456 licence not read", "asset:data:geo:GSE26886 not downloaded", "asset:data:geo:GSE26886 licence not read", "asset:data:geo:GSE92396 not downloaded", "asset:data:geo:GSE92396 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "To verify the results obtained thus far, data for 89 EAC tissue samples and the clinical data of the patients were downloaded from TCGA, and the prognostic value of the key genes and miRNAs was identified by Kaplan-Meier analysis. The survival package in R software was used for survival analysis."}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE92396", "GSE13898", "GSE26886", "GSE1420", "GSE16456"], "resolved_accessions": ["GSE92396", "GSE13898", "GSE26886", "GSE1420", "GSE16456"], "statements": ["The GSE92396 dataset included a total of 9 normal tissues and 12 EAC tissues"], "basis": "The paper names GSE92396, GSE13898, GSE26886, GSE1420, GSE16456 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:31114367", "data:geo:GSE13898", "asset:table:pmid:31114367:1", "asset:table:pmid:31114367:2", "asset:table:pmid:31114367:3", "asset:table:pmid:31114367:4", "asset:table:pmid:31114367:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE13898"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:14:45Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 27061, "completion_tokens": 1785, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:31114367", "type": "paper", "label": "pmid:31114367"}, {"id": "source:pmid:31114367", "type": "manuscript", "label": "PMID 31114367 full text"}, {"id": "data:geo:GSE13898", "type": "dataset", "label": "GEO GSE13898"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:31114367", "type": "paper", "label": "pmid:31114367"}, {"id": "source:pmid:31114367", "type": "manuscript", "label": "PMID 31114367 full text"}, {"id": "data:geo:GSE13898", "type": "dataset", "label": "GEO GSE13898"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-31114367", "type": "extraction", "used": ["source:pmid:31114367"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE13898", "type": "accession_resolution", "used": ["data:geo:GSE13898"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:31114367", "parent_hash": "sha256:0bec132e02f323140da2d514047b984f7eb2aeaeedd9c9735439f9c487148d68", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE13898 licence not read", "asset:data:geo:GSE13898 not downloaded", "asset:data:geo:GSE1420 licence not read", "asset:data:geo:GSE1420 not downloaded", "asset:data:geo:GSE16456 licence not read", "asset:data:geo:GSE16456 not downloaded", "asset:data:geo:GSE26886 licence not read", "asset:data:geo:GSE26886 not downloaded", "asset:data:geo:GSE92396 licence not read", "asset:data:geo:GSE92396 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["To verify the results obtained thus far, data for 89 EAC tissue samples and the clinical data of the patients were downloaded from TCGA, and the prognostic value of the key genes and miRNAs was identified by Kaplan-Meier analysis. The survival package in R software was used for survival analysis."], "order_basis": "analysis_only", "id": "assay:1"}]}