Small Nucleolar RNA 71A Promotes Lung Cancer Cell Proliferation, Migration and Invasion via MAPK/ERK Pathway.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:31258730", "kind": "science-record", "revision": 8, "content_hash": "sha256:be1599b602e1ff762a509798f95b5738ebed32474ba7a7f81366b004e33e6e01", "created_at": "2026-11-01T15:40:46Z", "updated_at": "2026-11-01T22:00:39Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Small Nucleolar RNA 71A Promotes Lung Cancer Cell Proliferation, Migration and Invasion via MAPK/ERK Pathway.", "doi": "10.7150/jca.31077", "pmid": "31258730", "authors": ["Guiliang Tang", "Zihang Zeng", "Wenjie Sun", "Shuying Li", "Chengcheng You", "Fang Tang", "Shan Peng", "Shijing Ma", "Yuan Luo", "Jieyu Xu", "Xiaoli Tian", "Nannan Zhang", "Yan Gong", "Conghua Xie"], "journal": "Journal of Cancer", "year": 2019, "abstract": "Objective: Increasing evidence suggested that dysregulated small nucleolar RNAs (snoRNAs) were involved in tumor development. The roles of snoRNA 71A (SNORA71A) in the progression of non-small cell lung cancer (NSCLC) remained unclear. Methods: Dataset GSE19188 from Gene Expression Omnibus (GEO) database was downloaded to detect the expression levels of SNORA71A in NSCLC tissues. The biological significance of SNORA71A was explored by loss-of-function analysis both in vitro and in vivo. Results: SNORA71A was overexpressed in NSCLC tissues compared with normal tissues, and upregulated SNORA71A was significantly associated with worse survival of NSCLC patients. Knockdown of SNORA71A suppressed proliferation of both A549 and PC9 cells, and induced G0/G1 phase arrest. Knockdown of SNORA71A also suppressed xenograft tumor growth in mice. In addition, knockdown of SNORA71A inhibited cell invasion and migration and suppressed epithelial-mesenchymal transition. Furthermore, downregulated SNORA71A decreased the phosphorylation of MEK and ERK1/2 in the MAPK/ERK signal pathway. Conclusion: SNORA71A functions as an oncogene in NSCLC and may serve as a therapeutic target and promising prognostic biomarker of NSCLC.", "claims": [{"id": "claim-method", "statement": "Unpaired 2 tail student's t-test was used for comparison between groups.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31258730", "locator": "sections[19] \"Statistical analysis\" paragraph 2", "quote": "Unpaired 2 tail student's t-test was used for comparison between groups."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Raw expression data of lung cancer were downloaded from the GEO database. Dataset GSE19188 18 was used to construct co-expression networks and identify our target gene SNORA71A in this study.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31258730", "locator": "sections[3] \"Data collection\" paragraph 2", "quote": "Raw expression data of lung cancer were downloaded from the GEO database. Dataset GSE19188 18 was used to construct co-expression networks and identify our target gene SNORA71A in this study."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:31258730"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE19188"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE19188"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:31258730", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.7150/jca.31077", "sha256": "sha256:46bb2b632ad5182f41716886efb3dba3135a1c9bcdc0decda9bfc0a08b411205", "bytes": 47975, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.7150/jca.31077", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6584411", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE19188", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE19188", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE19188", "version": null, "note": "Raw expression data of lung cancer were downloaded from the GEO database. Dataset GSE19188 18 was used to construct co-expression networks and identify our target gene SNORA71A in this study.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw expression data of lung cancer were downloaded from the GEO database. Dataset GSE19188 18 was used to construct co-expression networks and identify our target gene SNORA71A in this study.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM475656", "GSM475657", "GSM475658", "GSM475659", "GSM475660", "GSM475661", "GSM475662", "GSM475663", "GSM475664", "GSM475665", "GSM475666", "GSM475667", "GSM475668", "GSM475669", "GSM475670", "GSM475671", "GSM475672", "GSM475673", "GSM475674", "GSM475675", "GSM475676", "GSM475677", "GSM475678", "GSM475679", "GSM475680", "GSM475681", "GSM475682", "GSM475683", "GSM475684", "GSM475685", "GSM475686", "GSM475687", "GSM475688", "GSM475689", "GSM475690", "GSM475691", "GSM475692", "GSM475693", "GSM475694", "GSM475695", "GSM475696", "GSM475697", "GSM475698", "GSM475699", "GSM475700", "GSM475701", "GSM475702", "GSM475703", "GSM475704", "GSM475705", "GSM475706", "GSM475707", "GSM475708", "GSM475709", "GSM475710", "GSM475711", "GSM475712", "GSM475713", "GSM475714", "GSM475715", "GSM475716", "GSM475717", "GSM475718", "GSM475719", "GSM475720", "GSM475721", "GSM475722", "GSM475723", "GSM475724", "GSM475725", "GSM475726", "GSM475727", "GSM475728", "GSM475729", "GSM475730", "GSM475731", "GSM475732", "GSM475733", "GSM475734", "GSM475735", "GSM475736", "GSM475737", "GSM475738", "GSM475739", "GSM475740", "GSM475741", "GSM475742", "GSM475743", "GSM475744", "GSM475745", "GSM475746", "GSM475747", "GSM475748", "GSM475749", "GSM475750", "GSM475751", "GSM475752", "GSM475753", "GSM475754", "GSM475755", "GSM475756", "GSM475757", "GSM475758", "GSM475759", "GSM475760", "GSM475761", "GSM475762", "GSM475763", "GSM475764", "GSM475765", "GSM475766", "GSM475767", "GSM475768", "GSM475769", "GSM475770", "GSM475771", "GSM475772", "GSM475773", "GSM475774", "GSM475775", "GSM475776", "GSM475777", "GSM475778", "GSM475779", "GSM475780", "GSM475781", "GSM475782", "GSM475783", "GSM475784", "GSM475785", "GSM475786", "GSM475787", "GSM475788", "GSM475789", "GSM475790", "GSM475791", "GSM475792", "GSM475793", "GSM475794", "GSM475795", "GSM475796", "GSM475797", "GSM475798", "GSM475799", "GSM475800", "GSM475801", "GSM475802", "GSM475803", "GSM475804", "GSM475805", "GSM475806", "GSM475807", "GSM475808", "GSM475809", "GSM475810", "GSM475811"], "sample_count": 156, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data for early stage NSCLC", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:31258730:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9867e3ff1151b3912f30b8d516ccec203ed310b84287fb81903b52d6ffce642d", "bytes": 735, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#T1", "version": null, "note": "Primer sequences and siRNA sequences used in this study.", "structure": {"pmcid": "PMC6584411", "section_index": 9, "section_title": "RNA extraction and qRT-PCR", "row_count": 13, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer sequences and siRNA sequences used in this study.", "rows": [["Gene", "sequences or target sequence (5'→3')"], ["SNORA71A-F", "CCGAAAGTGATCATAGGCTGC"], ["SNORA71A-R", "TTCGGATGGGATAGGGTGGA"], ["SNHG17-F", "TGCTTGTAAGGCAGGGTCTC"], ["SNHG17-R", "TGCTTGTAAGGCAGGGTCTC"], ["β-actin-F", "TGGCACCCAGCACAATGAA"], ["β-actin-R", "CTAAGTCATAGTCCGCCTAGAAGCA"], ["U6-F", "GCTTCGGCAGCACATATACTAAAAT"], ["U6-R", "CGCTTCACGAATTTGCGTGTCAT"], ["SNORA71A-NC", "UUCUCCGAACGUGUCACGUTT (sense)"], ["", "ACGUGACACGUUCGGAGAATT (antisense)"], ["SNORA71A-siRNA", "CCUGCAUCCGAAAGUGAUCTT (sense)"], ["", "GAUCACUUUCGGAUGCAGGTT (antisense)"]], "row_count": 13, "column_count": 2, "numeric_cells": 7, "header_rows": 1, "locator": "section[9]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:31258730:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:cb138f2b5bee5d9716df1ad533cf122658f293faf2a65c5e3228b84a3f377c9a", "bytes": 1087, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#T2", "version": null, "note": "Antibodies used in this study.", "structure": {"pmcid": "PMC6584411", "section_index": 17, "section_title": "Western blot analysis", "row_count": 19, "column_count": 3}, "table": {"label": "Table 2", "caption": "Antibodies used in this study.", "rows": [["Antibody", "Company", "Dilution"], ["E-Cadherin (20874-1-AP)", "Proteintech", "1:1000"], ["N-Cadherin (22018-1-AP)", "Proteintech", "1:1000"], ["Vimentin (10366-1-AP)", "Proteintech", "1:1000"], ["MMP9 (10375-2-AP)", "Proteintech", "1:1000"], ["MMP2 (10373-2-AP)", "Proteintech", "1:1000"], ["CyclinD1 (#2978)", "Cell Signaling Technology (CST)", "1:1000"], ["CyclinE1 (11554-1-AP)", "Proteintech", "1:1000"], ["CDK6 (14052-1-AP)", "Proteintech", "1:1000"], ["CDK4 (11026-1-AP)", "Proteintech", "1:1000"], ["CDK2 (10122-1-AP)", "Proteintech", "1:1000"], ["P27 (25614-1-AP)", "Proteintech", "1:1000"], ["p-ERK1/2(#4370)", "Cell Signaling Technology (CST)", "1:1000"], ["ERK1/2 (16443-1-AP)", "Proteintech", "1:1000"], ["p-MEK (#9154)", "Cell Signaling Technology (CST)", "1:1000"], ["MEK (11049-1-AP)", "Proteintech", "1:1000"], ["Ki-67 (ab16667)", "Abcam", "1:200"], ["ZO-1 (21773-1-AP)", "Proteintech", "1:200"], ["GAPDH (10494-1-AP)", "Proteintech", "1:2500"]], "row_count": 19, "column_count": 3, "numeric_cells": 36, "header_rows": 1, "locator": "section[17]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:GSE19188 not downloaded", "asset:data:geo:GSE19188 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Unpaired 2 tail student's t-test was used for comparison between groups."}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE19188"], "resolved_accessions": ["GSE19188"], "statements": ["Raw expression data of lung cancer were downloaded from the GEO database. Dataset GSE19188 18 was used to construct co-expression networks and identify our target gene SNORA71A in this study."], "basis": "The paper names GSE19188 in GEO database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:31258730", "data:geo:GSE19188", "asset:table:pmid:31258730:1", "asset:table:pmid:31258730:2"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE19188"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:15:12Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 37985, "completion_tokens": 1102, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:31258730", "type": "paper", "label": "pmid:31258730"}, {"id": "source:pmid:31258730", "type": "manuscript", "label": "PMID 31258730 full text"}, {"id": "data:geo:GSE19188", "type": "dataset", "label": "GEO GSE19188"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:31258730", "type": "paper", "label": "pmid:31258730"}, {"id": "source:pmid:31258730", "type": "manuscript", "label": "PMID 31258730 full text"}, {"id": "data:geo:GSE19188", "type": "dataset", "label": "GEO GSE19188"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-31258730", "type": "extraction", "used": ["source:pmid:31258730"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE19188", "type": "accession_resolution", "used": ["data:geo:GSE19188"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:31258730", "parent_hash": "sha256:0372a9eae7e7a882d45d45ae596e025e2abaeddc7c8696e627b5c4d86662fe8e", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE19188 licence not read", "asset:data:geo:GSE19188 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["loss-of-function analysis both in vitro and in vivo. Results: SNORA71A was overexpressed in NSCL", "RA71A also suppressed xenograft tumor growth in mice. In addition, knockdown of SNORA71A inhibite", "h × width × width × 0.5). After 8 weeks, the mice were anesthetized with pentobarbital (Sigma Chemi", "S Lumina XRMS Series III (PerkinElmer, USA). Mice were then sacrificed and tumors were exercised. A"], "order_basis": "paper_text_order:549", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["iated with worse survival of NSCLC patients. Knockdown of SNORA71A suppressed proliferation of both", "d PC9 cells, and induced G0/G1 phase arrest. Knockdown of SNORA71A also suppressed xenograft tumor", "xenograft tumor growth in mice. In addition, knockdown of SNORA71A inhibited cell invasion and migr", "ries (Beijing, China). A549-LV-NC or A549-LV-siRNA cells (4 × 106 per 100 μl) were injected sub"], "order_basis": "paper_text_order:733", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["of SNORA71A suppressed proliferation of both A549 and PC9 cells, and induced G0/G1 phase arres", "nces (Shanghai, China). All these cells were cultured in RPMI-1640 medium (Hyclone Ltd., USA) supplem", "methods Cell culture Lung cancer cell lines (A549, PC9, NCI-H1299, NCI-H1975, H292, H460, H661", "e Vital River Laboratories (Beijing, China). A549-LV-NC or A549-LV-siRNA cells (4 × 106 per 10"], "order_basis": "paper_text_order:788", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Unpaired 2 tail student's t-test was used for comparison between groups."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}