Elevated hsa-miR-590-3p expression down-regulates HMGB2 expression and contributes to the severity of IgA nephropathy.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:31557418", "kind": "science-record", "revision": 7, "content_hash": "sha256:7554a6b6e9925fd8761dc43eb5dda90014b2d93754acacbe322781c491b5f79f", "created_at": "2026-11-01T15:40:50Z", "updated_at": "2026-11-01T22:44:14Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Elevated hsa-miR-590-3p expression down-regulates HMGB2 expression and contributes to the severity of IgA nephropathy.", "doi": "10.1111/jcmm.14582", "pmid": "31557418", "authors": ["Yaling Zhai", "Yuanyuan Qi", "Xiaoqing Long", "Yanna Dou", "Dong Liu", "Genyang Cheng", "Jing Xiao", "Zhangsuo Liu", "Zhanzheng Zhao"], "journal": "Journal of cellular and molecular medicine", "year": 2019, "abstract": "Peripheral blood mononuclear cells (PBMCs) play important roles in the pathogenesis of IgA nephropathy (IgAN). Our study aimed to provide a deep understanding of IgAN and focused on the dysregulation of hsa-miR-590-3p and its target gene HMGB2 in PBMCs. Three gene expression profile datasets (GSE14795, GSE73953 and GSE25590) were downloaded from the GEO database. The DEGs (differentially expressed genes)-miRNA network that was associated with IgAN was constructed by Cytoscape, and HMGB2 and hsa-miR-590-3p were selected for further exploration. The dual-luciferase reporter system was utilized to verify their interaction. Then, the expression levels of HMGB2 and hsa-miR-590-3p in PBMCs were detected by qPCR in another cohort, and the correlation of their expression levels with the clinical pathological manifestations and serum Gd-IgA1(galactose-deficient IgA1) levels was also investigated. HMGB2 was identified as the target gene of hsa-miR-590-3p. Furtherly, the elderly patients had higher HMGB2 expression levels than the expression levels of the younger patients. As the serum creatinine, serum BUN levels increased, the expression of HMGB2 decreased; Besides, the HMGB2 expression was positively correlated with serum complement 3(C3) levels, and it also had a negative correlation with the diastolic blood pressure, but not reach statistical significance. What is more, both hsa-miR-590-3p and HMGB2 expression had a slight correlation tendency with serum Gd-IgA1 levels in the whole population. In conclusion, HMGB2, the target gene of hsa-miR-590-3p, was identified to correlate with the severity of IgAN, and this provides more clues for the pathogenesis of IgAN.", "claims": [{"id": "claim-method", "statement": "For continuous variables, data with normal distribution were expressed as the mean ± SD and were compared by an independent‐sample t test, and Pearson Correlation was used if need; the other data were expressed as the median (first quartile and third quartile) and were analysed by the Mann‐Whitney U test, and the Spearman Correlation was utilized for the correlation analysis.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31557418", "locator": "sections[10] \"Statistical analysis\" paragraph 2", "quote": "For continuous variables, data with normal distribution were expressed as the mean ± SD and were compared by an independent‐sample t test, and Pearson Correlation was used if need; the other data were expressed as the median (first quartile and third quartile) and were analysed by the Mann‐Whitney U test, and the Spearman Correlation was utilized for the correlation analysis."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31557418", "locator": "sections[23] \"(untitled)\" paragraph 1", "quote": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:31557418"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE14795"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE14795"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:31557418", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/jcmm.14582", "sha256": "sha256:0e1b90f4af17d9ef47e08505df0ac2117c6a3f47fa544398faf152bf60f94a54", "bytes": 36513, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/jcmm.14582", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6815813", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE14795", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE14795", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE14795", "version": null, "note": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM369302", "GSM369303", "GSM369304", "GSM369305", "GSM369306", "GSM369346", "GSM369347", "GSM369348", "GSM369349", "GSM369350", "GSM369351", "GSM369353", "GSM369354", "GSM369357", "GSM369359", "GSM369894", "GSM369895", "GSM369897", "GSM369898", "GSM369899", "GSM503853", "GSM503855", "GSM503856", "GSM503858", "GSM503859", "GSM503860"], "sample_count": 26, "group_sizes": null, "group_sizes_basis": null, "platform": "96;571", "taxon": "Homo sapiens", "title": "Altered modulation of WNT-β-catenin and PI3K/Akt pathways in IgA nephropathy", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE25590", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE25590", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE25590", "version": null, "note": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM627751", "GSM627779", "GSM627781", "GSM627926", "GSM627964", "GSM627983", "GSM627984", "GSM627998", "GSM627999", "GSM628000", "GSM628001", "GSM628002", "GSM628003", "GSM628004"], "sample_count": 14, "group_sizes": null, "group_sizes_basis": null, "platform": "7731", "taxon": "Homo sapiens", "title": "miR-148b modulates the C1GALT1 expression explaining the abnormal glycosylation process in IgA Nephropathy", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE73953", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE73953", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE73953", "version": null, "note": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1906717", "GSM1906718", "GSM1906719", "GSM1906720", "GSM1906721", "GSM1906722", "GSM1906723", "GSM1906724", "GSM1906725", "GSM1906726", "GSM1906727", "GSM1906728", "GSM1906729", "GSM1906730", "GSM1906731", "GSM1906732", "GSM1906733", "GSM1906734", "GSM1906735", "GSM1906736", "GSM1906737", "GSM1906738", "GSM1906739", "GSM1906740", "GSM1906741"], "sample_count": 25, "group_sizes": null, "group_sizes_basis": null, "platform": "4133", "taxon": "Homo sapiens", "title": "Microarray analysis of peripheral blood mononuclear cells (PBMCs) from IgA nephropathy patients, membranous nephropathy patients and healthy controls.", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:31557418:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:815e69e4a8154d21a67544c077d43ce47daeb67346f5451caec9b4ecce5152cc", "bytes": 632, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#jcmm14582-tbl-0001", "version": null, "note": "Information on the three gene expresssion profile dataset", "structure": {"pmcid": "PMC6815813", "section_index": 3, "section_title": "Microarray data preprocessing", "row_count": 5, "column_count": 6}, "table": {"label": "Table 1", "caption": "Information on the three gene expresssion profile dataset", "rows": [["", "Before nomalization", "After normalization", "Platforms"], ["IgAN sample count", "Control sample count", "IgAN sample count", "Control sample count"], ["GSE14795", "12", "8", "8", "6", "Affymetrix Human Genome U133A Array"], ["GSE73953", "15", "16 (pooled)", "15", "16 (poold)", "Agilent‐014850 Whole Human Genome Microarray 4x44K G4112F"], ["GSE25590", "7", "7", "4", "3", "GPL7731 Agilent‐019118 Human miRNA Microarray 2.0"]], "row_count": 5, "column_count": 6, "numeric_cells": 18, "header_rows": 2, "locator": "section[3]/table-wrap[1]#jcmm14582-tbl-0001"}}, {"id": "asset:table:pmid:31557418:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0d26715ce17b06b85793ef7d459bdb712f7b4b0c53a7c317bc729d981a869d5c", "bytes": 527, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#jcmm14582-tbl-0002", "version": null, "note": "The primer pairs for HMGB2, GAPDH and has‐mir‐590‐3p", "structure": {"pmcid": "PMC6815813", "section_index": 8, "section_title": "Detection of the expression of HMGB2 and hsa‐miR‐590‐3p", "row_count": 7, "column_count": 3}, "table": {"label": "Table 2", "caption": "The primer pairs for HMGB2, GAPDH and has‐mir‐590‐3p", "rows": [["", "Sequence"], ["HMGB2", "F", "5′‐GTGGCCTAGCTCGTCAAGTT‐3′"], ["R", "5′‐GCGTACGAGGACATTTTGCC‐3′"], ["GAPDH", "F", "5′‐GGGAAACTGTGGCGTGAT‐3′"], ["R", "5′‐GAGTGGGTGTCGCTGTTGA‐3′"], ["hsa‐miR‐590‐3p", "F", "5′‐TAATTTTATGTATAAGCTAGT‐3′"], ["R", "5′‐GTGCAGGGTCCGAGGT‐3′"]], "row_count": 7, "column_count": 3, "numeric_cells": 7, "header_rows": 1, "locator": "section[8]/table-wrap[1]#jcmm14582-tbl-0002"}}, {"id": "asset:table:pmid:31557418:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7a37edd39139a0dd78e08e4e2ec8fc70d817acefa7c3c9fdb0760988d903f6a0", "bytes": 1031, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#jcmm14582-tbl-0003", "version": null, "note": "7miRNAs and 19 targeted genes associated with IgAN", "structure": {"pmcid": "PMC6815813", "section_index": 12, "section_title": "Screened miRNAs and target genes associated with IgAN", "row_count": 20, "column_count": 3}, "table": {"label": "Table 3", "caption": "7miRNAs and 19 targeted genes associated with IgAN", "rows": [["Gene symbol", "Fold change (Log2 transformed)", "microRNA"], ["ARID4A", "−1.65", "hsa‐miR‐519c‐3p"], ["CETN3", "−1.75", "hsa‐miR‐520b"], ["CNOT3", "−1.21", "hsa‐miR‐920"], ["GCC2", "−1.29", "hsa‐miR‐590‐3p"], ["HABP4", "−1.76", "hsa‐miR‐519c‐3p"], ["HMGB2", "−1.22", "hsa‐miR‐590‐3p"], ["IFIT5", "−1.13", "hsa‐miR‐384"], ["JMJD1C", "−1.85", "hsa‐miR‐648"], ["MAN1A1", "−1.29", "hsa‐miR‐590‐3p"], ["MAPK6", "−1.37", "hsa‐miR‐384"], ["NAMPT", "−1.12", "hsa‐miR‐590‐3p"], ["NPTN", "−1.29", "hsa‐miR‐873"], ["RAB1A", "−1.57", "hsa‐miR‐648"], ["RASA1", "−1.17", "hsa‐miR‐648"], ["RBM26", "−1.33", "hsa‐miR‐384"], ["TGFA", "−1.65", "hsa‐miR‐384"], ["TMEM57", "−1.29", "hsa‐miR‐384"], ["TUBGCP3", "−1.42", "hsa‐miR‐873"], ["ZFR", "−1.09", "hsa‐miR‐384"]], "row_count": 20, "column_count": 3, "numeric_cells": 40, "header_rows": 1, "locator": "section[12]/table-wrap[1]#jcmm14582-tbl-0003"}}, {"id": "asset:table:pmid:31557418:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0dbdad815c91c7194252ed134695ff3abcfb4cd61fc815701a0cac8a8b292c5d", "bytes": 3796, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[2]#jcmm14582-tbl-0004", "version": null, "note": "GO and KEGG enrichment analysis results for DEGs identified in the three microarray", "structure": {"pmcid": "PMC6815813", "section_index": 12, "section_title": "Screened miRNAs and target genes associated with IgAN", "row_count": 30, "column_count": 4}, "table": {"label": "Table 4", "caption": "GO and KEGG enrichment analysis results for DEGs identified in the three microarray", "rows": [["Description", "gene count", "Pvalue", "Genes"], ["GO terms"], ["GO:0044699‐single‐organism process", "18", "1.00 × 10‐3", "ZFR;TMEM57;MAN1A1;HABP4;IFIT5;TGFA;CETN3;GCC2;JMJD1C;NAMPT;RASA1;MAPK6;RAB1A;ARID4A;TUBGCP3;HMGB2;NPTN;CNOT3"], ["GO:0044707‐single‐multicellular organism process", "13", "4.07 × 10‐6", "ZFR;TMEM5;HABP4;TGFA;JMJD1C;NAMPT;RASA1;MAPK6;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0032501‐multicellular organismal process", "13", "7.82 × 10‐6", "ZFR;TMEM57;HABP4;TGFA;JMJD1C;NAMPT;RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0048856‐anatomical structure development", "11", "5.60 × 10‐5", "ZFR;TMEM57;;NAMPT;RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0044767‐single‐organism developmental process", "11", "1.13 × 10‐4", "ZFR;TMEM57;TGFA;NAMPT;RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0032502‐developmental process", "11", "1.32 × 10‐4", "ZFR;TMEM57;TGFA;NAMPT;RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0060255‐regulation of macromolecule metabolic process", "11", "1.57 × 10‐3", "HABP4;TGFA;JMJD1C;NAMPT;RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0019222‐regulation of metabolic process", "11", "6.12 × 10‐3", "HABP4;TGFA;JMJD1C;NAMPT;RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0007275‐multicellular organism development", "10", "1.02 × 10‐4", "ZFR;TMEM57;TGFA;NAMPT;RASA1;MAPK6 ;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0048518‐positive regulation of biological process", "10", "5.60 × 10‐4", "IFIT5;TGFA;NAMPT;RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0016043‐cellular component organization", "10", "5.45 × 10‐3", "CETN3;GCC2;JMJD1C;RASA1;MAPK6 ;RAB1A;ARID4A;TUBGCP3;HMGB2;NPTN"], ["GO:0080090‐regulation of primary metabolic process", "10", "6.26 × 10‐3", "HABP4;TGFA;JMJD1C;NAMPT;RASA1;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0071840‐cellular component organization or biogenesis", "10", "6.85 × 10‐3", "CETN3;GCC2;JMJD1C;RASA1;MAPK6 ;RAB1A;ARID4A;TUBGCP3;HMGB2;NPTN"], ["GO:0031323‐regulation of cellular metabolic process", "10", "6.93 × 10‐3", "HABP4;TGFA;JMJD1C;NAMPT;RASA1;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0048522‐positive regulation of cellular process", "9", "5.74 × 10‐4", "IFIT5;TGFA;NAMPT;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0048731‐system development", "8", "1.59 × 10‐3", "TMEM57;TGFA;NAMPT;RASA1;MAPK6 ;ARID4A;HMGB2;NPTN"], ["GO:0006996‐organelle organization", "8", "4.66 × 10‐3", "CETN3;GCC2;JMJD1C;RASA1;RAB1A;ARID4A;TUBGCP3;HMGB2"], ["GO:0006464‐cellular protein modification process", "8", "9.25 × 10‐3", "MAN1A1;TGFA;JMJD1C;RASA1;MAPK6 ;RAB1A;ARID4A;NPTN"], ["GO:0036211‐protein modification process", "8", "9.25 × 10‐3", "MAN1A1;TGFA;JMJD1C;RASA1;MAPK6 ;RAB1A;ARID4A;NPTN"], ["GO:0048468‐cell development", "7", "9.85 × 10‐5", "RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:1902589‐single‐organism organelle organization", "7", "2.16 × 10‐3", "CETN3;GCC2;RASA1;RAB1A;ARID4A;TUBGCP3;HMGB2"], ["GO:0009893‐positive regulation of metabolic process", "7", "3.75 × 10‐3", "TGFA;NAMPT;RASA1;RAB1A;ARID4A;HMGB2;NPTN"], ["GO:0030154‐cell differentiation", "7", "3.83 × 10‐3", "RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["GO:0065008‐regulation of biological quality", "7", "4.32 × 10‐3", "HABP4;JMJD1C;RASA1;RAB1A;ARID4A;HMGB2;NPTN"], ["GO:0048869‐cellular developmental process", "7", "7.37 × 10‐3", "RASA1;MAPK6 ;RAB1A;ARID4A;HMGB2;NPTN;CNOT3"], ["KEGG pathways"], ["hsa00760‐Nicotinate and nicotinamide metabolism", "1", "2.94 × 10‐2", "NAMPT"], ["hsa00510‐N‐Glycan biosynthesis", "1", "4.76 × 10‐2", "MAN1A1"]], "row_count": 30, "column_count": 4, "numeric_cells": 88, "header_rows": 1, "locator": "section[12]/table-wrap[2]#jcmm14582-tbl-0004"}}, {"id": "asset:table:pmid:31557418:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d2a17d262ad93785f2a518a62b962647246f8a52efdc4326a6bc5a7a6d428d93", "bytes": 980, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#jcmm14582-tbl-0005", "version": null, "note": "The baseline data of 37 patients with IgAN", "structure": {"pmcid": "PMC6815813", "section_index": 14, "section_title": "Increased hsa‐miR‐590‐3p expression and decreased HMGB2 expression in IgAN", "row_count": 22, "column_count": 2}, "table": {"label": "Table 5", "caption": "The baseline data of 37 patients with IgAN", "rows": [["Characters", "Mean ± SD or median(IQR) or n"], ["Male/female", "23/14"], ["Age (year)", "42.11 ± 14.80"], ["With hypertension (%)", "26(70.27%)"], ["SBP (mmHg)", "135.97 ± 17.61"], ["DBP (mmHg)", "86.00 ± 10.39"], ["24 h proteinuria (g/d)", "1.75 (0.75,4.09)"], ["SCR (μmol/L)", "117 (82,189.50)"], ["BUN (mmol/L)", "6.60 (5.00,11.61)"], ["Uric Acid (μmol/L)", "342.19 ± 82.37"], ["Albumin (g/L)", "35.23 ± 8.98"], ["TCHO (mmol/L)", "4.40 (3.59,5.43)"], ["TG (mmol/L)", "1.93 (1.17, 2.60)"], ["C3 (mg/L)", "1.21 (1.04,1.38)"], ["C4 (mg/L)", "0.30 (0.25, 0.34)"], ["Blood cell count in urine", "24.50 (5.25,48.75)"], ["Oxford classification (n)", ""], ["M score (M0/M1)", "28/9"], ["E score (E0/E1)", "29/8"], ["S score (S0/S1)", "16/21"], ["C score(C0/C1/C2)", "17/18/2"], ["T score (T0/T1/T2)", "20/8/9"]], "row_count": 22, "column_count": 2, "numeric_cells": 21, "header_rows": 1, "locator": "section[14]/table-wrap[1]#jcmm14582-tbl-0005"}}], "gaps": ["asset:data:geo:GSE14795 not downloaded", "asset:data:geo:GSE14795 licence not read", "asset:data:geo:GSE25590 not downloaded", "asset:data:geo:GSE25590 licence not read", "asset:data:geo:GSE73953 not downloaded", "asset:data:geo:GSE73953 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "For continuous variables, data with normal distribution were expressed as the mean ± SD and were compared by an independent‐sample t test, and Pearson Correlation was used if need; the other data were expressed as the median (first quartile and third quartile) and were analysed by the Mann‐Whitney U test, and the Spearman Correlation was utilized for the correlation analysis."}}, {"id": "method-2", "family": "correlation_analysis", "specific": "spearman", "label": "Correlation analysis", "dsl_operations": ["spearman_rho"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Spearman Correlation"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["pearson_r"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pearson."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE14795", "GSE73953", "GSE25590"], "resolved_accessions": ["GSE14795", "GSE73953", "GSE25590"], "statements": ["Raw data used during the current study are available from the corresponding author on reasonable request for non‐commercial use."], "basis": "The paper names GSE14795, GSE73953, GSE25590 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["pearson_r"], "assets": ["source:pmid:31557418", "data:geo:GSE14795", "asset:table:pmid:31557418:1", "asset:table:pmid:31557418:2", "asset:table:pmid:31557418:3", "asset:table:pmid:31557418:4", "asset:table:pmid:31557418:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE14795"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:16:18Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 31932, "completion_tokens": 1441, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:31557418", "type": "paper", "label": "pmid:31557418"}, {"id": "source:pmid:31557418", "type": "manuscript", "label": "PMID 31557418 full text"}, {"id": "data:geo:GSE14795", "type": "dataset", "label": "GEO GSE14795"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:31557418", "type": "paper", "label": "pmid:31557418"}, {"id": "source:pmid:31557418", "type": "manuscript", "label": "PMID 31557418 full text"}, {"id": "data:geo:GSE14795", "type": "dataset", "label": "GEO GSE14795"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-31557418", "type": "extraction", "used": ["source:pmid:31557418"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE14795", "type": "accession_resolution", "used": ["data:geo:GSE14795"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:31557418", "parent_hash": "sha256:5af20e79489e9c2c00a3611b002c6421a814d769ccf3efd7a841280f053e1770", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE14795 licence not read", "asset:data:geo:GSE14795 not downloaded", "asset:data:geo:GSE25590 licence not read", "asset:data:geo:GSE25590 not downloaded", "asset:data:geo:GSE73953 licence not read", "asset:data:geo:GSE73953 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["and hsa-miR-590-3p in PBMCs were detected by qPCR in another cohort, and the correlation of th"], "order_basis": "paper_text_order:784", "id": "assay:1"}, {"role": "analysis", "definition_id": "correlation_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["pearson_r"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["For continuous variables, data with normal distribution were expressed as the mean ± SD and were compared by an independent‐sample t test, and Pearson Correlation was used if need; the other data were expressed as the median (first quartile and third quartile) and were analysed by the Mann‐Whitney U test, and the Spearman Correlation was utilized for the correlation analysis."], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}