Weighted gene co-expression network analysis reveals specific modules and hub genes related to neuropathic pain in dorsal root ganglions.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:31696225", "kind": "science-record", "revision": 8, "content_hash": "sha256:79405d89595426773d448a211b831a23e64336bfee027999c041e6e172e2ef1a", "created_at": "2026-11-01T15:40:51Z", "updated_at": "2026-11-01T22:00:59Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Weighted gene co-expression network analysis reveals specific modules and hub genes related to neuropathic pain in dorsal root ganglions.", "doi": "10.1042/BSR20191511", "pmid": "31696225", "authors": ["Nan Cheng", "Zheng Zhang", "Yue Guo", "Zhuo-Lin Qiu", "Jing-Yi Du", "Zi-Qing Hei", "Xiang Li"], "journal": "Bioscience reports", "year": 2019, "abstract": "Neuropathic pain is a common, debilitating clinical issue. Here, the weighted gene co-expression network analysis (WGCNA) was used to identify the specific modules and hub genes that are related to neuropathic pain. The microarray dataset of a neuropathic rat model induced by tibial nerve transection (TNT), including dorsal root ganglion (DRG) tissues from TNT model (n=7) and sham (n=8) rats, was downloaded from the ArrayExpress database (E-MTAB-2260). The co-expression network modules were identified by the WGCNA package. The protein-protein interaction (PPI) network was constructed, and the node with highest level of connectivity in the network were identified as the hub gene. A total of 1739 genes and seven modules were identified. The most significant module was the brown module, which contained 215 genes that were primarily associated with the biological process (BP) of the defense response and molecular function of calcium ion binding. Furthermore, C-C motif chemokine ligand 2 (Ccl2), Fos and tissue inhibitor of metalloproteinase 1 (Timp1) which were identified as the hub genes in the PPI network and two subnetworks separately. The in vivo studies validated that mRNA and protein levels of Ccl2, Fos and Timp1 were up-regulated in DRG and spinal cord tissues after TNT. The present study offers novel insights into the molecular mechanisms of neuropathic pain in the context of peripheral nerve injury.", "claims": [{"id": "claim-method", "statement": "We performed R package ‘WGCNA’ to construct weighted co-expression networks that could depict the correlation of gene expression patterns and highlight the highly correlated gene modules [3]. The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31696225", "locator": "sections[4] \"WGCNA\" paragraph 2", "quote": "We performed R package ‘WGCNA’ to construct weighted co-expression networks that could depict the correlation of gene expression patterns and highlight the highly correlated gene modules [3]."}, {"asset": "source:pmid:31696225", "locator": "sections[3] \"Microarray data sources and processing\" paragraph 2", "quote": "The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:31696225", "locator": "sections[3] \"Microarray data sources and processing\" paragraph 2", "quote": "The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:31696225"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:E-MTAB-2260"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:E-MTAB-2260"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:31696225", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1042/BSR20191511", "sha256": "sha256:76a5251ebb1109568bc8f96a14329f705b0fb491c4b9fc3cd7dacecdf5b7b298", "bytes": 34926, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1042/BSR20191511", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6851524", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:E-MTAB-2260", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=E-MTAB-2260", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "E-MTAB-2260", "version": null, "note": "The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats.", "access_statement_kind": "repository_route_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": null, "resolution_checked_at": "2026-10-31T18:28:58Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:31696225:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:20f3383922baa96f01351b4af78b46161a80fb205579d50544c205cf9efd4152", "bytes": 521, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#T1", "version": null, "note": "The sequences of sense and antisense oligonucleotide primers", "structure": {"pmcid": "PMC6851524", "section_index": 10, "section_title": "Quantitative real‐time polymerase chain reaction", "row_count": 5, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of sense and antisense oligonucleotide primers", "rows": [["mRNA", "Sense primer", "Antisense primer"], ["Ccl2", "5′‐TGCTGCTACTCATTCACTGGC", "5′‐CCTTATTGGGGTCAGCACAG"], ["Aif-1", "5′‐AGGCCACCAGCGTCTG", "5′‐GCTGTACTTGGGATCATCGAG"], ["Timp1", "5′-CCCAACCCACCCACAGACAG", "5′-GCCCGCGATGAGAAACTCCT"], ["GAPDH", "5′‐TCCTACCCCCAATGTATCCG", "5′‐CCTTTAGTGGGCCCTCGG"]], "row_count": 5, "column_count": 3, "numeric_cells": 9, "header_rows": 1, "locator": "section[10]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:31696225:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fdacdbe6d993cd4566f33c335fd3d300bc3867dd059d92d53bdc660ff4f238d9", "bytes": 449, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#T2", "version": null, "note": "Correlations between modules and TNT", "structure": {"pmcid": "PMC6851524", "section_index": 15, "section_title": "WGCNA and module identification", "row_count": 8, "column_count": 4}, "table": {"label": "Table 2", "caption": "Correlations between modules and TNT", "rows": [["Module", "Gene count", "Correlation", "P-value"], ["Brown", "215", "0.9", "6.0e-06"], ["Green", "72", "0.33", "0.2"], ["Gray", "72", "0.097", "0.7"], ["Blue", "500", "0.029", "0.9"], ["Yellow", "151", "−0.067", "0.8"], ["Red", "60", "−0.19", "0.5"], ["Turquoise", "669", "−0.59", "0.02"]], "row_count": 8, "column_count": 4, "numeric_cells": 21, "header_rows": 1, "locator": "section[15]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:31696225:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7a75383e710d1916aa579cc479b069e4b36108f393504bf5c98016f58ba8fddb", "bytes": 3360, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#T3", "version": null, "note": "The top significantly enriched GO terms and pathways for genes in each module", "structure": {"pmcid": "PMC6851524", "section_index": 16, "section_title": "GO and pathway enrichment analyses for the brown module", "row_count": 20, "column_count": 9}, "table": {"label": "Table 3", "caption": "The top significantly enriched GO terms and pathways for genes in each module", "rows": [["Module", "GO", "Pathway"], ["", "Term (BP)", "P-value", "Term (MF)", "P-value", "Term (CC)", "P-value", "Term", "P-value"], ["Brown (gene count: 215)", "Inflammatory response", "2.957e-11", "Metal ion transmembrane transport activity", "4.229e-7", "Neuron to neuron synapse", "2.144e-14", "Complement and coagulation cascades", "8.124e-7"], ["", "Defense response", "5.044e-11", "Channel activity", "5.719e-7", "Extracellular matrix", "4.743e-14", "Glutamatergic synapse", "3.179e-6"], ["", "Regulation of ion transmembrane transport", "7.044e-11", "Passive transmembrane transporter activity", "6.397e-7", "Synaptic membrane", "4.743e-14", "Circadian entrainment", "2.777e-5"], ["Green (gene count: 72)", "No genes were enriched", "No P-value", "No genes were enriched", "No P-value", "No genes were enriched", "No P-value", "No genes were enriched", "No P-value"], ["Gray (gene count: 72)", "No genes were enriched", "No P-value", "Receptor signaling complex scaffold activity", "4.231e-3", "Postsynaptic membrane", "1.071e-3", "No genes were enriched", "No P-value"], ["", "", "", "Transmembrane receptor protein kinase activity", "2.532e-3", "Synaptic membrane", "1.162e-3", "", ""], ["", "", "", "", "", "Extracellular matrix", "1.202e-3", "", ""], ["Blue (gene count: 500)", "Regulation of transporter activity", "1.077e-14", "Drug transmembrane transporter activity", "2.658e-5", "Neuron to neuron synapse", "1.886e-6", "Glutamatergic synapse", "2.971e-6"], ["", "Amino acid transport", "1.421e-14", "Postsynaptic neurotransmitter receptor activity", "2.759e-5", "Synaptic membrane", "1.886e-6", "Neuroactive ligand–receptor interaction", "4.872e-5"], ["", "Neurotransmitter transport", "2.254e-14", "Structural constituent of postsynaptic specialization", "5.778e-5", "Postsynaptic specialization", "2.965e-6", "Circadian entrainment", "4.871e-5"], ["Yellow (gene count: 151)", "Extracellular structure organization", "5.787e-14", "Extracellular matrix structural constituent", "6.985e-9", "Collagen-containing extracellular matrix", "2.198e-18", "ECM–receptor interaction", "1.127e-7"], ["", "Extracellular matrix organization", "1.778e-13", "Platelet-derived growth factor binding", "2.143e-6", "Extracellular matrix", "8.979e-18", "Protein digestion and absorption", "1.181e-7"], ["", "Collagen fibril organization", "2.054e-7", "Sphingolipid binding", "1.211e-4", "Collagen trimer", "5.774e-12", "Focal adhesion", "8.861e-6"], ["Red (gene count: 60)", "No genes were enriched", "No P-value", "No genes were enriched", "No P-value", "cis-Golgi network", "4.742e-2", "No genes were enriched", "No P-value"], ["", "", "", "", "", "Nuclear chromatin", "4.742e-2", "", ""], ["Turquoise (gene count: 669)", "Negative regulation of neuron differentiation", "8.699e-8", "Metal ion transmembrane transporter activity", "1.974e-7", "Neuron to neuron synapse", "3.608e-13", "Long-term depression", "2.665e-4"], ["", "Multicellular organismal response to stress", "2.247e-7", "Cation channel activity", "6.125e-7", "Asymmetric synapse", "1.604e-10", "Proximal tubule bicarbonate reclamation", "2.665e-4"], ["", "Negative regulation of nervous system development", "4.403e-7", "Substrate-specific channel activity", "6.806e-6", "Postsynaptic density", "2.025e-10", "Glutamatergic synapse", "2.665e-4"]], "row_count": 20, "column_count": 9, "numeric_cells": 62, "header_rows": 2, "locator": "section[16]/table-wrap[1]#T3"}}], "gaps": ["asset:data:geo:E-MTAB-2260 not downloaded", "asset:data:geo:E-MTAB-2260 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": null, "specific": null, "label": "Weighted gene co-expression network analysis (WGCNA) using the ArrayExpress microarray dataset E-MTAB-2260", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "reordered", "quote": "We performed R package ‘WGCNA’ to construct weighted co-expression networks that could depict the correlation of gene expression patterns and highlight the highly correlated gene modules [3]. The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["E-MTAB-2260"], "resolved_accessions": ["E-MTAB-2260"], "statements": ["The microarray dataset of neuropathic pain (E-MTAB-2260), published by Jamieson and colleagues [7], was downloaded from the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress/), which includes 15 DRG tissues from tibial nerve transection (TNT) model (n=7) and sham (n=8) rats."], "basis": "The paper names E-MTAB-2260 in ArrayExpress and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:31696225", "data:geo:E-MTAB-2260", "asset:table:pmid:31696225:1", "asset:table:pmid:31696225:2", "asset:table:pmid:31696225:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:E-MTAB-2260"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:16:43Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 27351, "completion_tokens": 1229, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:31696225", "type": "paper", "label": "pmid:31696225"}, {"id": "source:pmid:31696225", "type": "manuscript", "label": "PMID 31696225 full text"}, {"id": "data:geo:E-MTAB-2260", "type": "dataset", "label": "GEO E-MTAB-2260"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:31696225", "type": "paper", "label": "pmid:31696225"}, {"id": "source:pmid:31696225", "type": "manuscript", "label": "PMID 31696225 full text"}, {"id": "data:geo:E-MTAB-2260", "type": "dataset", "label": "GEO E-MTAB-2260"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-31696225", "type": "extraction", "used": ["source:pmid:31696225"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-E-MTAB-2260", "type": "accession_resolution", "used": ["data:geo:E-MTAB-2260"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:31696225", "parent_hash": "sha256:52d755179407bac71d8d95b2ac72031bb412dad0cfd0804a20eebaee8c3ff3d4", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:E-MTAB-2260 licence not read", "asset:data:geo:E-MTAB-2260 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["es that are related to neuropathic pain. The microarray dataset of a neuropathic rat model induced b", "Materials and methods Microarray data processing Fifteen tissue sample files"], "order_basis": "paper_text_order:313", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["network and two subnetworks separately. The in vivo studies validated that mRNA and protein leve", "ain. The microarray dataset of a neuropathic rat model induced by tibial nerve transection (T", "tissues from TNT model (n=7) and sham (n=8) rats, was downloaded from the ArrayExpress databa"], "order_basis": "paper_text_order:349", "id": "assay:2"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}