Identification of a potentially functional circRNA-miRNA-mRNA regulatory network for investigating pathogenesis and providing possible biomarkers of bladder cancer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32015691", "kind": "science-record", "revision": 8, "content_hash": "sha256:385f36e14669866438c78f17a23bf629dd26401862e7b46f2ac2625b8b434ca4", "created_at": "2026-11-01T15:40:55Z", "updated_at": "2026-11-01T22:44:32Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of a potentially functional circRNA-miRNA-mRNA regulatory network for investigating pathogenesis and providing possible biomarkers of bladder cancer.", "doi": "10.1186/s12935-020-1108-3", "pmid": "32015691", "authors": ["Hong-Cheng Lu", "Jia-Qi Yao", "Xiao Yang", "Jie Han", "Jing-Zi Wang", "Kun Xu", "Rui Zhou", "Hao Yu", "Qiang Lv", "Min Gu"], "journal": "Cancer cell international", "year": 2020, "abstract": "BACKGROUND: Circular RNAs (circRNAs) have received considerable attention in human cancer research. However, many circRNAs remain to be detected. In our study, we determined novel circRNAs and investigated their effects on bladder cancer (BCa).\nMETHODS: Microarray dataset GSE92675 was downloaded from Gene Expression Omnibus (GEO). Then, we combined computational biology with quantitative real-time polymerase chain reaction (qRT-PCR) to select related circRNAs in BCa. The selected circRNA-microRNA (miRNA)-messenger RNA (mRNA) regulatory subnetwork was determined by Gene Oncology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses.\nRESULTS: The regulatory network constructed from the microarray dataset (GSE92675) contained 49 differentially expressed circRNAs (DECs). GO and KEGG analyses showed that the MAPK and PI3K-AKT signaling pathways were statistically significant. On the basis of qRT-PCR and the degree value calculated by the cytoHubba plugin of Cytoscape, hsa_circ_0011385 was finally confirmed. The subnetwork around hsa_circ_0011385 was constructed. In addition, we created a protein-protein interaction (PPI) network composed of 67 nodes and 274 edges after removing independent nodes. GO and KEGG analyses showed that hubgenes were involved in cell cycle activities. Moreover, they could be regulated by miRNAs and play an eventful role in BCa pathogenesis.\nCONCLUSIONS: We proposed a novel circRNA-miRNA-mRNA network related to BCa pathogenesis. This network might be a new molecular biomarker and could be used to develop potential treatment strategies for BCa.", "claims": [{"id": "claim-method", "statement": "To select DECs, R package Limma was adopted.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32015691", "locator": "sections[12] \"Identification of DECs in BCa\" paragraph 2", "quote": "To select DECs, R package Limma was adopted."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Authors can provide all of datasets analyzed during the study on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32015691", "locator": "sections[23] \"notes\" paragraph 1", "quote": "Authors can provide all of datasets analyzed during the study on reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32015691"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE92675"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE92675"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32015691", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12935-020-1108-3", "sha256": "sha256:a8f0e9e6482f6355d180f5a5505d280d93287ea360ec12b9f4b3f0f1943a15b4", "bytes": 25540, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12935-020-1108-3", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC6990554", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE92675", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE92675", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE92675", "version": null, "note": "Authors can provide all of datasets analyzed during the study on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Authors can provide all of datasets analyzed during the study on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2434319", "GSM2434320", "GSM2434321", "GSM2434322", "GSM2434323", "GSM2434324", "GSM2434325", "GSM2434326"], "sample_count": 8, "group_sizes": null, "group_sizes_basis": null, "platform": "19978", "taxon": "Homo sapiens", "title": "Expression profiles of circular RNAs in bladder cancer", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32015691:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c690cb328740a9559018c81c90a9a1efa821aba1cf944a8a2e5d91673e2898a4", "bytes": 333, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#Tab1", "version": null, "note": "Basic information of the microarray dataset from GEO", "structure": {"pmcid": "PMC6990554", "section_index": 12, "section_title": "Identification of DECs in BCa", "row_count": 2, "column_count": 6}, "table": {"label": "Table 1", "caption": "Basic information of the microarray dataset from GEO", "rows": [["Data source", "Platform", "First author", "Year", "Region", "Sample size (T/N)"], ["GSE92675", "GPL19978", "Chen J", "2016", "CHINA", "4/4"]], "row_count": 2, "column_count": 6, "numeric_cells": 4, "header_rows": 1, "locator": "section[12]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:32015691:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:59878f543f65863e761f0c497014bcaafa11f68c2de34a79a824ea92c8026df2", "bytes": 862, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab2", "version": null, "note": "Features of 9 selected circRNAs", "structure": {"pmcid": "PMC6990554", "section_index": 14, "section_title": "Subnetwork analyses of circRNA", "row_count": 10, "column_count": 5}, "table": {"label": "Table 2", "caption": "Features of 9 selected circRNAs", "rows": [["circRNA name", "Gene symbol", "Position", "Strand", "Regulation"], ["hsa_circ_0001955", "CSNK1G1", "chr15:64495280–64508912", "−", "Up"], ["hsa_circ_0032821", "CEP128", "chr14:81209418–81227957", "−", "Up"], ["hsa_circ_0060219", "KIAA0889", "chr20:35457456–35467844", "−", "Up"], ["hsa_circ_0011385", "EIF3I", "chr1:32691771–32692131", "+", "Up"], ["hsa_circ_0084171", "FNTA", "chr8:42914234–42932507", "+", "Up"], ["hsa_circ_0040039", "SNTB2", "chr16:69279504–69318147", "+", "Down"], ["hsa_circ_0082582", "TRIM24", "chr7:138203933–138255748", "+", "Down"], ["hsa_circ_0009172", "DNA2", "chr10:70218860–70229920", "−", "Down"], ["hsa_circ_0077526", "BVES", "chr6:105563560–105564743", "−", "Down"]], "row_count": 10, "column_count": 5, "numeric_cells": 21, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:32015691:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b67eae6be6522bcaa1447802830208aae17674da97097ada0749362ad5eff67f", "bytes": 661, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#Tab3", "version": null, "note": "Clinicopathological features in 16 BCa patients", "structure": {"pmcid": "PMC6990554", "section_index": 14, "section_title": "Subnetwork analyses of circRNA", "row_count": 18, "column_count": 5}, "table": {"label": "Table 3", "caption": "Clinicopathological features in 16 BCa patients", "rows": [["Characteristics", "Case", "hsa_circ_0011385 expression", "P value"], ["Low", "High"], ["All cases", "16", "8", "8", ""], ["Age (years)"], ["< 65", "10", "6", "4", "0.6084"], ["≥ 65", "6", "2", "4", ""], ["Gender", "0.8287"], ["Male", "7", "4", "3", ""], ["Female", "9", "4", "5", ""], ["Smoke", "0.1626"], ["Yes", "13", "7", "6", ""], ["No", "3", "1", "2", ""], ["Grade", "0.8022"], ["Low", "7", "3", "4", ""], ["High", "9", "5", "4", ""], ["Tumor size(cm)", "0.0406*"], ["< 3", "9", "2", "7", ""], ["≥ 3", "7", "6", "1", ""]], "row_count": 18, "column_count": 5, "numeric_cells": 43, "header_rows": 2, "locator": "section[14]/table-wrap[2]#Tab3"}}, {"id": "asset:table:pmid:32015691:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:aff597ec66e4967a07b40abf679cc9dba0bb8c1e1a662e6cc1fcf86a545faffc", "bytes": 662, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[3]#Tab4", "version": null, "note": "Primers sequences for qRT-PCR", "structure": {"pmcid": "PMC6990554", "section_index": 14, "section_title": "Subnetwork analyses of circRNA", "row_count": 9, "column_count": 3}, "table": {"label": "Table 4", "caption": "Primers sequences for qRT-PCR", "rows": [["Gene ID", "Primer sequences"], ["Forward", "Reverse"], ["Beta-actin", "AGCGAGCATCCCCCAAAGTT", "GGGCACGAAGGCTCATCATT"], ["hsa_circ_0011385", "TCATTGTTGTCAATCTGGCTC", "CAGTGCTGTTTGGGGACC"], ["U6", "AAAGCAAATCATCGGACGACC", "GTACAACACATTGTTTCCTCGGA"], ["mir-211-5p", "CGCGTCCGCTTCCTACTGTT", "AGTGCAGGGTCCGAGGTATT"], ["mir-204-5p", "GCGCGTCCGTATCCTACTGTT", "AGTGCAGGGTCCGAGGTATT"], ["mir-182-5p", "CGCGTCACACTCAAGATGGTAA", "AGTGCAGGGTCCGAGGTATT"], ["mir-96-5p", "CGCGTCGTTTTTACACGATCA", "AGTGCAGGGTCCGAGGTATT"]], "row_count": 9, "column_count": 3, "numeric_cells": 5, "header_rows": 2, "locator": "section[14]/table-wrap[3]#Tab4"}}], "gaps": ["asset:data:geo:GSE92675 not downloaded", "asset:data:geo:GSE92675 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "To select DECs, R package Limma was adopted."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE92675"], "resolved_accessions": ["GSE92675"], "statements": ["Authors can provide all of datasets analyzed during the study on reasonable request."], "basis": "The paper names GSE92675 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:32015691", "data:geo:GSE92675", "asset:table:pmid:32015691:1", "asset:table:pmid:32015691:2", "asset:table:pmid:32015691:3", "asset:table:pmid:32015691:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE92675"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:18:04Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 22061, "completion_tokens": 1514, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32015691", "type": "paper", "label": "pmid:32015691"}, {"id": "source:pmid:32015691", "type": "manuscript", "label": "PMID 32015691 full text"}, {"id": "data:geo:GSE92675", "type": "dataset", "label": "GEO GSE92675"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32015691", "type": "paper", "label": "pmid:32015691"}, {"id": "source:pmid:32015691", "type": "manuscript", "label": "PMID 32015691 full text"}, {"id": "data:geo:GSE92675", "type": "dataset", "label": "GEO GSE92675"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32015691", "type": "extraction", "used": ["source:pmid:32015691"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE92675", "type": "accession_resolution", "used": ["data:geo:GSE92675"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32015691", "parent_hash": "sha256:397638b45cf62cb5d70cae0893d60a90427fbd6e8806e1f97cc3679957a94fe7", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE92675 licence not read", "asset:data:geo:GSE92675 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ir effects on bladder cancer (BCa). METHODS: Microarray dataset GSE92675 was downloaded from Gene Ex", "The regulatory network constructed from the microarray dataset (GSE92675) contained 49 differential"], "order_basis": "paper_text_order:374", "id": "assay:1"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["To select DECs, R package Limma was adopted."], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}