STAT1 and its related molecules as potential biomarkers in Mycobacterium tuberculosis infection.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32048448", "kind": "science-record", "revision": 8, "content_hash": "sha256:689025db70ad61f4235affd84077ecb6c14877814a6377ee457ee97293b991b0", "created_at": "2026-11-01T15:40:56Z", "updated_at": "2026-11-01T22:44:34Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "STAT1 and its related molecules as potential biomarkers in Mycobacterium tuberculosis infection.", "doi": "10.1111/jcmm.14856", "pmid": "32048448", "authors": ["Xing-Hao Yi", "Bo Zhang", "Yu-Rong Fu", "Zheng-Jun Yi"], "journal": "Journal of cellular and molecular medicine", "year": 2020, "abstract": "Tuberculosis (TB) is a severe infectious disease that seriously endangers human health. The immune defence mechanism of the body against TB is still unclear. The purpose of this study was to find the key molecules involved in the immune defence response during TB infection, and provide reference for the treatment of TB and further understanding of the immune defence mechanism of the body. Data from GSE83456 were downloaded from GEO data sets for analysis, and a total of 192 differentially expressed genes were screened out. Most of these genes are enriched in the interferon signalling pathway and are defence response-related. We also found that STAT1 plays an important role in the immune defence of TB infection and it is one of the key genes related to interferon signalling pathway. STAT1-related molecules including hsa-miR-448, hsa-miR-223-3p, SAMD8_hsa_circRNA 994 and TWF1_hsa_circRNA 9897 were therefore screened out. Furthermore, expression levels of hsa-miR-448 and hsa-miR-223-3p were then verified by qRT-PCR. Results showed that both hsa-miR-448 and hsa-miR-223-3p were down-regulated in plasma from patients with pulmonary TB. Taken together, our data indicate that an mRNA-miRNA-circRNA interaction chain may play an important role in the infection of MTB, and STAT1 and related molecules including hsa-miR-223-3p, has-miR-448, SAMD8_hsa_circRNA994 and TWF1_hsa_circRNA9897 were identified as potential biomarkers in the development of active TB.", "claims": [{"id": "claim-method", "statement": "The original expression matrix was normalized and processed by R. The limma package was used to screen out differentially expressed genes. The P‐value of genes was calculated using t test method, and Benjamini and Hochberg's method was used to calculate the adjusted P‐value. The clinical samples of TB infection were retrieved from the GEO database. A total of 106 blood samples were selected from http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE83456, including 45 pulmonary tuberculosis (PTB) samples and 61 healthy control (HC) samples.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32048448", "locator": "sections[4] \"Data process\" paragraph 2", "quote": "The original expression matrix was normalized and processed by R."}, {"asset": "source:pmid:32048448", "locator": "sections[4] \"Data process\" paragraph 2", "quote": "The limma package was used to screen out differentially expressed genes."}, {"asset": "source:pmid:32048448", "locator": "sections[4] \"Data process\" paragraph 2", "quote": "The P‐value of genes was calculated using t test method, and Benjamini and Hochberg's method was used to calculate the adjusted P‐value."}, {"asset": "source:pmid:32048448", "locator": "sections[3] \"Acquisition of RNA information\" paragraph 2", "quote": "The clinical samples of TB infection were retrieved from the GEO database."}, {"asset": "source:pmid:32048448", "locator": "sections[3] \"Acquisition of RNA information\" paragraph 2", "quote": "A total of 106 blood samples were selected from http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE83456, including 45 pulmonary tuberculosis (PTB) samples and 61 healthy control (HC) samples."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Data sets used and analysed during the current study are available from the corresponding author on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32048448", "locator": "sections[23] \"DATA AVAILABILITY STATEMENT\" paragraph 2", "quote": "Data sets used and analysed during the current study are available from the corresponding author on reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32048448"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE83456"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE83456"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32048448", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/jcmm.14856", "sha256": "sha256:3fe614b6ccd021ea97cc31694f62741fb5629287870fa4250ace96c7e905b9ba", "bytes": 45432, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/jcmm.14856", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7077527", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE83456", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE83456", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE83456", "version": null, "note": "Data sets used and analysed during the current study are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data sets used and analysed during the current study are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2203540", "GSM2203541", "GSM2203542", "GSM2203543", "GSM2203544", "GSM2203545", "GSM2203546", "GSM2203547", "GSM2203548", "GSM2203549", "GSM2203550", "GSM2203551", "GSM2203552", "GSM2203553", "GSM2203554", "GSM2203555", "GSM2203556", "GSM2203557", "GSM2203558", "GSM2203559", "GSM2203560", "GSM2203561", "GSM2203562", "GSM2203563", "GSM2203564", "GSM2203565", "GSM2203566", "GSM2203567", "GSM2203568", "GSM2203569", "GSM2203570", "GSM2203571", "GSM2203572", "GSM2203573", "GSM2203574", "GSM2203575", "GSM2203576", "GSM2203577", "GSM2203578", "GSM2203579", "GSM2203580", "GSM2203581", "GSM2203582", "GSM2203583", "GSM2203584", "GSM2203585", "GSM2203586", "GSM2203587", "GSM2203588", "GSM2203589", "GSM2203590", "GSM2203591", "GSM2203592", "GSM2203593", "GSM2203594", "GSM2203595", "GSM2203596", "GSM2203597", "GSM2203598", "GSM2203599", "GSM2203600", "GSM2203601", "GSM2203602", "GSM2203603", "GSM2203604", "GSM2203605", "GSM2203606", "GSM2203607", "GSM2203608", "GSM2203609", "GSM2203610", "GSM2203611", "GSM2203612", "GSM2203613", "GSM2203614", "GSM2203615", "GSM2203616", "GSM2203617", "GSM2203618", "GSM2203619", "GSM2203620", "GSM2203621", "GSM2203622", "GSM2203623", "GSM2203624", "GSM2203625", "GSM2203626", "GSM2203627", "GSM2203628", "GSM2203629", "GSM2203630", "GSM2203631", "GSM2203632", "GSM2203633", "GSM2203634", "GSM2203635", "GSM2203636", "GSM2203637", "GSM2203638", "GSM2203639", "GSM2203640", "GSM2203641", "GSM2203642", "GSM2203643", "GSM2203644", "GSM2203645", "GSM2203646", "GSM2203647", "GSM2203648", "GSM2203649", "GSM2203650", "GSM2203651", "GSM2203652", "GSM2203653", "GSM2203654", "GSM2203655", "GSM2203656", "GSM2203657", "GSM2203658", "GSM2203659", "GSM2203660", "GSM2203661", "GSM2203662", "GSM2203663", "GSM2203664", "GSM2203665", "GSM2203666", "GSM2203667", "GSM2203668", "GSM2203669", "GSM2203670", "GSM2203671", "GSM2203672", "GSM2203673", "GSM2203674", "GSM2203675", "GSM2203676", "GSM2203677", "GSM2203678", "GSM2203679", "GSM2203680", "GSM2203681", "GSM2203682", "GSM2203683", "GSM2203684", "GSM2203685", "GSM2203686", "GSM2203687", "GSM2203688", "GSM2203689", "GSM2203690", "GSM2203691", "GSM2203692", "GSM2203693", "GSM2203694", "GSM2203695", "GSM2203696", "GSM2203697", "GSM2203698", "GSM2203699", "GSM2203700", "GSM2203701", "GSM2203702", "GSM2203703", "GSM2203704", "GSM2203705", "GSM2203706", "GSM2203707", "GSM2203708", "GSM2203709", "GSM2203710", "GSM2203711", "GSM2203712", "GSM2203713", "GSM2203714", "GSM2203715", "GSM2203716", "GSM2203717", "GSM2203718", "GSM2203719", "GSM2203720", "GSM2203721", "GSM2203722", "GSM2203723", "GSM2203724", "GSM2203725", "GSM2203726", "GSM2203727", "GSM2203728", "GSM2203729", "GSM2203730", "GSM2203731", "GSM2203732", "GSM2203733", "GSM2203734", "GSM2203735", "GSM2203736", "GSM2203737", "GSM2203738", "GSM2203739", "GSM2203740", "GSM2203741"], "sample_count": 202, "group_sizes": null, "group_sizes_basis": null, "platform": "10558", "taxon": "Homo sapiens", "title": "The transcriptional signature of active tuberculosis reflects symptom status in extra-pulmonary and pulmonary tuberculosis", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32048448:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ff999508a441c5053bccabea389536431a1d298c548fb8e9ce1bf424f3c44281", "bytes": 691, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#jcmm14856-tbl-0001", "version": null, "note": "Oligonucleotides used in this study", "structure": {"pmcid": "PMC7077527", "section_index": 8, "section_title": "Quantitative reverse transcription polymerase chain reaction (qRT‐PCR)", "row_count": 7, "column_count": 3}, "table": {"label": "Table 1", "caption": "Oligonucleotides used in this study", "rows": [["Primer sets name", "Reverse transcriptase primer (5′ to 3′)", "Real‐time quantitative PCR primer (5′ to 3′)"], ["U6", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA", "F: AGAGAAGATTAGCATGGCCCCTG"], ["R: ATCCAGTGCAGGGTCCGAGG"], ["hsa‐mir‐223‐3p", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGGGT", "F:GCGCGTGTCAGTTTGTCAAAT"], ["R:AGTGCAGGGTCCGAGGTATT"], ["hsa‐mir‐448", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGGGA", "F:GCGCGTTGCATATGTAGGATG"], ["R:AGTGCAGGGTCCGAGGTATT"]], "row_count": 7, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[8]/table-wrap[1]#jcmm14856-tbl-0001"}}, {"id": "asset:table:pmid:32048448:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a058d34bf93bb3cd69fd304ad008f896a1c7827141c5a8c03c2ed24eee5de5ad", "bytes": 961, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#jcmm14856-tbl-0002", "version": null, "note": "MCODE was used to process the data downloaded from the STRING to further mining gene clusters. Specific data of gene clusters were exported and presented in a tabular form", "structure": {"pmcid": "PMC7077527", "section_index": 13, "section_title": "Construction of protein‐protein interaction (PPI) network and further excavation of gene clusters involved in immune system–related biological pathway", "row_count": 8, "column_count": 5}, "table": {"label": "Table 2", "caption": "MCODE was used to process the data downloaded from the STRING to further mining gene clusters. Specific data of gene clusters were exported and presented in a tabular form", "rows": [["Cluster", "Score (Density*#Nodes)", "Nodes", "Edges", "Node IDs"], ["1", "34.973", "38", "647", "RTP4, UBE2L6, IFI44L, PLSCRl, DDX60, IFI6, SAMD9L, OAS2, IFI44, XAFI, IFITM3, PARP9, EPSTil, IFITMl, IRF7, HERC5, GBP2, GBPl, IFIT2, TRIM22, STAT2, OASl, IFI27, RSAD2, IFIT5, IFI35, CMPK2, ISG15, DDX58, STATl, LY6E, IFIHl, IFITl,IFIT3, CXCLlO, OASL, MXl, OAS3"], ["2", "4", "4", "6", "FCGRlA, FCGRlB, MT2A, GBP6"], ["3", "4", "4", "6", "PLAUR, CLEC4D, GPR84, CEACAMl"], ["4", "4", "4", "6", "SERPINGl, C2, CIQB, CIQC"], ["5", "3.333", "4", "5", "CCR7, CCRL2, CD27, CD38"], ["6", "3", "3", "3", "SlPRl, GPR183, P2RY14"], ["7", "3", "3", "3", "CASP5, CARD16, CARD17"]], "row_count": 8, "column_count": 5, "numeric_cells": 33, "header_rows": 1, "locator": "section[13]/table-wrap[1]#jcmm14856-tbl-0002"}}, {"id": "asset:table:pmid:32048448:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7bb4b7dd4148b262230f2503d38c775a7d282ff9399250afe1536573083c7c26", "bytes": 783, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[2]#jcmm14856-tbl-0003", "version": null, "note": "Top 10 biological processes enriched in cluster 1", "structure": {"pmcid": "PMC7077527", "section_index": 13, "section_title": "Construction of protein‐protein interaction (PPI) network and further excavation of gene clusters involved in immune system–related biological pathway", "row_count": 11, "column_count": 3}, "table": {"label": "Table 3", "caption": "Top 10 biological processes enriched in cluster 1", "rows": [["Biological process", "Gene count", "False discovery rate"], ["Defence response to virus", "29", "8.03 × 10−45"], ["Response to virus", "30", "1.44 × 10−42"], ["Type I interferon signalling pathway", "21", "8.30 × 10−37"], ["Innate immune response", "31", "1.67 × 10−33"], ["Response to other organism", "32", "1.40 × 10−32"], ["Defence response", "35", "1.6 × 10−32"], ["Immune response", "32", "2.0 × 10−24"], ["Cytokine‐mediated signalling pathway", "25", "5.8 × 10−24"], ["Immune system process", "35", "4.2 × 10−23"], ["Response to stress", "37", "3.00 × 10−21"]], "row_count": 11, "column_count": 3, "numeric_cells": 20, "header_rows": 1, "locator": "section[13]/table-wrap[2]#jcmm14856-tbl-0003"}}, {"id": "asset:table:pmid:32048448:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:19d9c6f07c233e7fdc1819e6b45c3ec98b9465bef01e22cacf461076a326107e", "bytes": 556, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#jcmm14856-tbl-0004", "version": null, "note": "miRNAs and its target genes", "structure": {"pmcid": "PMC7077527", "section_index": 14, "section_title": "Further miRNA mining and interaction network analysis", "row_count": 10, "column_count": 3}, "table": {"label": "Table 4", "caption": "miRNAs and its target genes", "rows": [["miRNA", "Genes targeted By miRNA", "Gene count"], ["miR‐130a‐5p", "GBP1, IFIT2", "2"], ["miR‐605‐5p", "GBP1, 0AS3", "2"], ["miR‐223‐3p", "MX1, STAT1", "2"], ["miR‐1231", "OAS3, STAT1", "2"], ["miR‐3915", "IFIT2, MX1", "2"], ["miR‐3918", "OAS2, DDX58", "2"], ["miR‐448", "STAT1, 0AS2", "2"], ["miR‐936", "DDX58, IFIT2", "2"], ["miR‐181a‐2‐3p", "STATl, OAS3", "2"]], "row_count": 10, "column_count": 3, "numeric_cells": 22, "header_rows": 1, "locator": "section[14]/table-wrap[1]#jcmm14856-tbl-0004"}}], "gaps": ["asset:data:geo:GSE83456 not downloaded", "asset:data:geo:GSE83456 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "reordered", "quote": "The original expression matrix was normalized and processed by R. The limma package was used to screen out differentially expressed genes. The P‐value of genes was calculated using t test method, and Benjamini and Hochberg's method was used to calculate the adjusted P‐value. The clinical samples of TB infection were retrieved from the GEO database. A total of 106 blood samples were selected from http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE83456, including 45 pulmonary tuberculosis (PTB) samples and 61 healthy control (HC) samples."}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE83456"], "resolved_accessions": ["GSE83456"], "statements": ["Data sets used and analysed during the current study are available from the corresponding author on reasonable request."], "basis": "The paper names GSE83456 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:32048448", "data:geo:GSE83456", "asset:table:pmid:32048448:1", "asset:table:pmid:32048448:2", "asset:table:pmid:32048448:3", "asset:table:pmid:32048448:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE83456"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:18:12Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 34399, "completion_tokens": 990, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32048448", "type": "paper", "label": "pmid:32048448"}, {"id": "source:pmid:32048448", "type": "manuscript", "label": "PMID 32048448 full text"}, {"id": "data:geo:GSE83456", "type": "dataset", "label": "GEO GSE83456"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32048448", "type": "paper", "label": "pmid:32048448"}, {"id": "source:pmid:32048448", "type": "manuscript", "label": "PMID 32048448 full text"}, {"id": "data:geo:GSE83456", "type": "dataset", "label": "GEO GSE83456"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32048448", "type": "extraction", "used": ["source:pmid:32048448"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE83456", "type": "accession_resolution", "used": ["data:geo:GSE83456"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32048448", "parent_hash": "sha256:b816cdf4c0e87e2ab866aa8456b4574035b2e4409a0a0b91c034b144361d83b0", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE83456 licence not read", "asset:data:geo:GSE83456 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The original expression matrix was normalized and processed by R. The limma package was used to screen out differentially expressed genes. The P‐value of genes was calculated using t test method, and Benjamini and Hochberg's method was used to calculate the adjusted P‐value. The clinical samples of TB infection were retrieved from the GEO database. A total of 106 blood samples were selected from http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE83456, including 45 pulmonary tuberculosis (PTB) samples and 61 healthy control (HC) samples."], "order_basis": "analysis_only", "id": "assay:1"}]}