Identification of key differentially expressed genes and gene mutations in breast ductal carcinoma in situ using RNA-seq analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32156290", "kind": "science-record", "revision": 4, "content_hash": "sha256:3f626ac5fbd7ffc1ea3f56a05a5378b22a617eb0f2b4938a55a78338ee12f246", "created_at": "2026-11-01T15:40:57Z", "updated_at": "2026-11-01T21:22:58Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of key differentially expressed genes and gene mutations in breast ductal carcinoma in situ using RNA-seq analysis.", "doi": "10.1186/s12957-020-01820-z", "pmid": "32156290", "authors": ["Congyuan Zhu", "Hao Hu", "Jianping Li", "Jingli Wang", "Ke Wang", "Jingqiu Sun"], "journal": "World journal of surgical oncology", "year": 2020, "abstract": "BACKGROUND: The aim of this study was to identify the key differentially expressed genes (DEGs) and high-risk gene mutations in breast ductal carcinoma in situ (DCIS).\nMETHODS: Raw data (GSE36863) were downloaded from the database of Gene Expression Omnibus (GEO), including three DCIS samples (DCIS cell lines MCF10.DCIS, Sum102, and Sum225) and one normal control sample (normal mammary epithelial cell line MCF10A). The DEGs were analyzed using NOIseq and annotated via DAVID. Motif scanning in the promoter region of DEGs was performed via SeqPos. Additionally, single nucleotide variations (SNVs) were identified via GenomeAnalysisTK and SNV risk was assessed via VarioWatch. Mutant genes with a high frequency and risk were validated by RT-PCR analyses.\nRESULTS: Finally, 5391, 7073, and 7944 DEGs were identified in DCIS, Sum102, and Sum22 cell lines, respectively, when compared with MCF10A. VENN analysis of the three cell lines revealed 603 upregulated and 1043 downregulated DEGs, including 16 upregulated and 36 downregulated transcription factor (TF) genes. In addition, six TFs each (e.g., E2F1 and CREB1) were found to regulate the core up- and downregulated DEGs, respectively. Furthermore, SNV detection results revealed 1104 (MCF10.DCIS), 2833 (Sum102), and 1132 (Sum22) mutation sites. Four mutant genes (RWDD4, SDHC, SEPT7, and SFN) with high frequency and risk were identified. The results of RT-PCR analysis as well as bioinformatics analysis consistently demonstrated that the expression of RWDD4, SDHC, SEPT7, and SFN was downregulated in the tumor tissues as compared with that in adjacent non-tumor tissues.\nCONCLUSIONS: The differentially expressed TFs, TFs regulating DEGs (e.g., E2F1 and CREB1), and high-frequency mutant genes (RWDD4, SDHC, SEPT7, and SFN) might play key roles in the pathogenesis of DCIS.", "claims": [{"id": "claim-method", "statement": "DEGs between DCIS and normal samples were then selected via NOISeq [14] with a q value ≥ 0.8.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32156290", "locator": "sections[4] \"Read alignment and differential expression analysis\" paragraph 2", "quote": "DEGs between DCIS and normal samples were then selected via NOISeq [14] with a q value ≥ 0.8."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32156290", "locator": "sections[23] \"notes\" paragraph 1", "quote": "The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32156290"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE36863"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE36863"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32156290", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12957-020-01820-z", "sha256": "sha256:09c806b0b2fcbeac1c37bc94107bb3746db77d2e222a5854345d5aa3615a6a39", "bytes": 26657, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12957-020-01820-z", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7063758", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE36863", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36863", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE36863", "version": null, "note": "The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM903303", "GSM903304", "GSM903305", "GSM903306"], "sample_count": 4, "group_sizes": null, "group_sizes_basis": null, "platform": "10999", "taxon": "Homo sapiens", "title": "DEEP SEQUENCING OF MODELS OF BREAST DUCTAL CARCINOMA IN SITU REVEALS ALDH5A1 AS A NOVEL POTENTIAL THERAPEUTIC TARGET", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32156290:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:819dc309c915f1c0f6050b56763f3faac6c6a53dc84e771a3d83ff54bbd507cf", "bytes": 590, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#Tab1", "version": null, "note": "Primers and primer sequences of Q-PCR genes", "structure": {"pmcid": "PMC7063758", "section_index": 9, "section_title": "Real-time polymerase chain reaction verification", "row_count": 11, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primers and primer sequences of Q-PCR genes", "rows": [["Primer", "Sequence(5′–3′)"], ["RWDD4-hF", "TGCCAACGAGGACCAGGAG"], ["RWDD4-hR", "AGGCTTTGGGATCACCATTTT"], ["SDHC-hF", "TGCCTCCGAGCCCACTTTA"], ["SDHC-hR", "TTATTCCAGAACCGCTCCATC"], ["SEPT7-hF", "AGGAGCGTCAACAGCAGCAC"], ["SEPT7-hR", "CCCAATCCAGATTCACCCACT"], ["SFN-hF", "GCCGAACGCTATGAGGACA"], ["SFN-hR", "GCTCAATACTGGACAGCACCC"], ["GAPDH-hF", "TGACAACTTTGGTATCGTGGAAGG"], ["GAPDH-hR", "AGGCAGGGATGATGTTCTGGAGAG"]], "row_count": 11, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[9]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:32156290:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4f87bf6be29619cccfc30817d5f92b5e640f2816c7ddad03b5080bd3a9728604", "bytes": 1414, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#Tab2", "version": null, "note": "Functional enrichment analysis of the overlapping DEGs", "structure": {"pmcid": "PMC7063758", "section_index": 12, "section_title": "Identification of core DEGs and functional enrichment analysis", "row_count": 21, "column_count": 4}, "table": {"label": "Table 2", "caption": "Functional enrichment analysis of the overlapping DEGs", "rows": [["GO Term", "Gene Counts", "TF Genes", "p value"], ["Downregulated overlapping DEGs"], ["Translation", "38", "", "3.88E-06"], ["Positive regulation of programmed cell death", "41", "HIP1, ID3, IFI16, NR3C1, PML, RXRA, TP53BP2", "1.36E-04"], ["RNA processing", "46", "", "7.09E-04"], ["Regulation of cell migration", "20", "", "8.03E-04"], ["Negative regulation of cell proliferation", "33", "ESR2, NKX3-1, NME2, PML, RXRA", "0.001239"], ["Regulation of lipid metabolic process", "15", "NR3C1, NR5A1, PPARA", "0.001380"], ["Cell adhesion", "52", "LEF1, NME2", "0.004558"], ["JNK cascade", "9", "", "0.008755"], ["Cellular protein localization", "33", "", "0.008962"], ["Response to hormone stimulus", "30", "ESR2, PPARA, RXRA", "0.010205"], ["Upregulated overlapping DEGs"], ["Positive regulation of tumor necrosis factor production", "4", "", "0.005861"], ["Regulation of tumor necrosis factor production", "5", "", "0.007442"], ["Response to lipopolysaccharide", "7", "NKX2-1", "0.013341"], ["Small GTPase mediated signal transduction", "15", "", "0.024022"], ["Cytokine production", "5", "", "0.028739"], ["Regulation of phosphate metabolic process", "20", "", "0.040473"], ["Regulation of cAMP biosynthetic process", "7", "", "0.043362"], ["Blood circulation", "10", "", "0.047845"]], "row_count": 21, "column_count": 4, "numeric_cells": 39, "header_rows": 1, "locator": "section[12]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:32156290:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9142324a2d369eb9aba69da3cacd7218dcf88c4f7ab159b49f3dfccbcdcf0096", "bytes": 713, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[2]#Tab3", "version": null, "note": "The overlapping DEGs associated with cell surface and extracellular matrix part", "structure": {"pmcid": "PMC7063758", "section_index": 12, "section_title": "Identification of core DEGs and functional enrichment analysis", "row_count": 4, "column_count": 5}, "table": {"label": "Table 3", "caption": "The overlapping DEGs associated with cell surface and extracellular matrix part", "rows": [["Location", "Upregulated DEGs", "Downregulated DEGs"], ["Count", "Gene name", "Counts", "Gene name"], ["Cell surface", "11", "NOD2, IL12RB1, CORIN, FREM2, FLT3, LRRTM1, FCER1G, CHRNA4, TPO, HSPA5, SCNN1A", "17", "PTPRK, CAV1, PARD3, SELL, LHCGR, MFGE8, ITGA4, ADA, CDH13, SDC1, BGN, SULF2, RC3H2, HSPB1, TGFBR3, SCNN1G, ADAM9"], ["Extracellular matrix part", "5", "LAMB4, COL9A2, FREM2, COL11A2, COL10A1", "12", "COL17A1, COL7A1, LAMA5, NID1, COL1A1, LAMB1, DST, PRSS12, COL4A6, COL4A5, FN1, ANXA2"]], "row_count": 4, "column_count": 5, "numeric_cells": 8, "header_rows": 2, "locator": "section[12]/table-wrap[2]#Tab3"}}, {"id": "asset:table:pmid:32156290:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d19d250660e6d622bacc6aceb6d773dbb9c1c62a646047860f7f3e2078b72e4c", "bytes": 376, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#Tab4", "version": null, "note": "Upstream TF analysis of overlapping DEGs", "structure": {"pmcid": "PMC7063758", "section_index": 13, "section_title": "Upstream TFs and functional enrichment analysis of DEGs", "row_count": 3, "column_count": 3}, "table": {"label": "Table 4", "caption": "Upstream TF analysis of overlapping DEGs", "rows": [["Promoter regions", "Candidate TF counts", "TF genes"], ["Downregulated DEGs", "6", "E2F1, ELK1, HIF1A, MYB, NR2C2, TFAP2A"], ["Upregulated DEGs", "6", "CREB1, ELK4, GABPA, NFYA, PAX5, ZBTB7B"]], "row_count": 3, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[13]/table-wrap[1]#Tab4"}}, {"id": "asset:table:pmid:32156290:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c5c34f7ddd697c3730dcbbfdf062d9c0f52f346647dce301ae179ad84ca600f9", "bytes": 539, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab5", "version": null, "note": "Mutant sites with high-frequency in breast ductal carcinoma in situ cell lines", "structure": {"pmcid": "PMC7063758", "section_index": 14, "section_title": "Detection of somatic mutations and SNVs", "row_count": 5, "column_count": 7}, "table": {"label": "Table 5", "caption": "Mutant sites with high-frequency in breast ductal carcinoma in situ cell lines", "rows": [["Chromosome", "Position", "Reference base", "Mutated base", "Corresponding gene", "Observed frequency", "Tumor-associated genes"], ["chr1", "161332189", "C", "A", "SDHC", "2", ""], ["chr1", "27190350", "G", "A", "SFN", "2", "Tumor suppressor"], ["chr4", "184562622", "C", "A", "RWDD4", "2", ""], ["chr7", "35840881", "G", "C", "SEPT7", "2", ""]], "row_count": 5, "column_count": 7, "numeric_cells": 8, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab5"}}], "gaps": ["asset:data:geo:GSE36863 not downloaded", "asset:data:geo:GSE36863 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": null, "specific": null, "label": "NOISeq", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "DEGs between DCIS and normal samples were then selected via NOISeq [14] with a q value ≥ 0.8."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "method", "blocked_on": "method:not_determinable", "axes": {"method": {"tier": "R4", "expressible": false, "required_operations": [], "missing_operations": [], "basis": "The reader quoted the method the paper names (NOISeq), but the corpus's method extractor could not map it onto a DSL operation, so the method is published but not expressible."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE36863"], "resolved_accessions": ["GSE36863"], "statements": ["The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request."], "basis": "The paper names GSE36863 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32156290", "data:geo:GSE36863", "asset:table:pmid:32156290:1", "asset:table:pmid:32156290:2", "asset:table:pmid:32156290:3", "asset:table:pmid:32156290:4", "asset:table:pmid:32156290:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE36863"]}, "gaps": ["method:not_determinable"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:18:42Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 21842, "completion_tokens": 1383, "cached_tokens": 7424}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32156290", "type": "paper", "label": "pmid:32156290"}, {"id": "source:pmid:32156290", "type": "manuscript", "label": "PMID 32156290 full text"}, {"id": "data:geo:GSE36863", "type": "dataset", "label": "GEO GSE36863"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32156290", "type": "paper", "label": "pmid:32156290"}, {"id": "source:pmid:32156290", "type": "manuscript", "label": "PMID 32156290 full text"}, {"id": "data:geo:GSE36863", "type": "dataset", "label": "GEO GSE36863"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32156290", "type": "extraction", "used": ["source:pmid:32156290"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE36863", "type": "accession_resolution", "used": ["data:geo:GSE36863"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32156290", "parent_hash": "sha256:42588ae8950ce97e023cd3701bf8387c8f4169592dff3eab0deeca9fb5e84ece", "fork_of": null, "generation": 3}, "gaps": ["asset:data:geo:GSE36863 licence not read", "asset:data:geo:GSE36863 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ons in breast ductal carcinoma in situ using RNA-seq analysis."], "order_basis": "paper_text_order:68", "id": "assay:1"}]}