Establishment of a Prognostic Model Using Immune-Related Genes in Patients With Hepatocellular Carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32158466", "kind": "science-record", "revision": 8, "content_hash": "sha256:d93fa398727d8063f41ac303a46b1c6d839ad8e1994f3e90e7a16b9d93f7d8e4", "created_at": "2026-11-01T15:40:57Z", "updated_at": "2026-11-01T22:44:38Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Establishment of a Prognostic Model Using Immune-Related Genes in Patients With Hepatocellular Carcinoma.", "doi": "10.3389/fgene.2020.00055", "pmid": "32158466", "authors": ["Wen-Jie Wang", "Han Wang", "Ting-Yan Hua", "Wei Song", "Jie Zhu", "Jing-Jing Wang", "Yue-Qing Huang", "Zhi-Liang Ding"], "journal": "Frontiers in genetics", "year": 2020, "abstract": "Hepatocellular carcinoma (HCC) is one of the most prevalent neoplasms worldwide, particularly in China. Immune-related genes (IRGs) and immune infiltrating lymphocytes play specific roles in tumor growth. Considering how important immunotherapy has become for HCC treatment in the past decade, our objective was to establish a prognostic model by screening survival-related IRGs in patients with HCC. Using edgeR, we identified differentially expressed IRGs (DEIRGs), DEmiRNAs, and DElncRNAs. Functional enrichment analysis of DEIRGs was performed to investigate the biological functions of IRGs via gene ontology annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses. Protein-protein interaction and competing endogenous RNA networks were established using Cytoscape. Survival-associated IRGs were selected via univariate COX regression analysis, a The Cancer Genome Atlas (TCGA) prognostic model and GSE76427 validation model were developed using multivariate COX regression analysis test by AIC (Akaike Information Criterion). We identified 116 DEIRGs in patients with HCC; the \"cytokine-cytokine receptor interaction\" pathway was found to be the most enriched pathway. Via the prognostic model helped us classify patients into high- and low-risk score groups based on overall survival (OS); high risk score was associated with worse OS, and a positive correlation was observed between the prognostic model and immune cell infiltration. To summarize, we established a prognostic model using survival-related IRGs that provides sufficient information for prognosis prediction and immunotherapy of patients with HCC.", "claims": [{"id": "claim-method", "statement": "Survival curves were generated using the Kaplan-Meier method, and the log-rank test was used to compare differences between the two groups.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32158466", "locator": "sections[12] \"Statistical Analysis\" paragraph 2", "quote": "Survival curves were generated using the Kaplan-Meier method, and the log-rank test was used to compare differences between the two groups."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets analysed for this study were obtained from TCGA data portal (https://portal.gdc.cancer.gov/) and GEO data portal (https://www.ncbi.nlm.nih.gov/geo/).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32158466", "locator": "sections[24] \"Data Availability Statement\" paragraph 2", "quote": "The datasets analysed for this study were obtained from TCGA data portal (https://portal.gdc.cancer.gov/) and GEO data portal (https://www.ncbi.nlm.nih.gov/geo/)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32158466"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE76427"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE76427"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32158466", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fgene.2020.00055", "sha256": "sha256:5ca7d968fc72f15367368e6ec4582b020d4f8d600c59927b922bc023e8726465", "bytes": 32848, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fgene.2020.00055", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7052339", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE76427", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE76427", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE76427", "version": null, "note": "The datasets analysed for this study were obtained from TCGA data portal (https://portal.gdc.cancer.gov/) and GEO data portal (https://www.ncbi.nlm.nih.gov/geo/).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets analysed for this study were obtained from TCGA data portal (https://portal.gdc.cancer.gov/) and GEO data portal (https://www.ncbi.nlm.nih.gov/geo/).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2011285", "GSM2011286", "GSM2011287", "GSM2011288", "GSM2011289", "GSM2011290", "GSM2011291", "GSM2011292", "GSM2011293", "GSM2011294", "GSM2011295", "GSM2011296", "GSM2011297", "GSM2011298", "GSM2011299", "GSM2011300", "GSM2011301", "GSM2011302", "GSM2011303", "GSM2011304", "GSM2011305", "GSM2011306", "GSM2011307", "GSM2011308", "GSM2011309", "GSM2011310", "GSM2011311", "GSM2011312", "GSM2011313", "GSM2011314", "GSM2011315", "GSM2011316", "GSM2011317", "GSM2011318", "GSM2011319", "GSM2011320", "GSM2011321", "GSM2011322", "GSM2011323", "GSM2011324", "GSM2011325", "GSM2011326", "GSM2011327", "GSM2011328", "GSM2011329", "GSM2011330", "GSM2011331", "GSM2011332", "GSM2011333", "GSM2011334", "GSM2011335", "GSM2011336", "GSM2011337", "GSM2011338", "GSM2011339", "GSM2011340", "GSM2011341", "GSM2011342", "GSM2011343", "GSM2011344", "GSM2011345", "GSM2011346", "GSM2011347", "GSM2011348", "GSM2011349", "GSM2011350", "GSM2011351", "GSM2011352", "GSM2011353", "GSM2011354", "GSM2011355", "GSM2011356", "GSM2011357", "GSM2011358", "GSM2011359", "GSM2011360", "GSM2011361", "GSM2011362", "GSM2011363", "GSM2011364", "GSM2011365", "GSM2011366", "GSM2011367", "GSM2011368", "GSM2011369", "GSM2011370", "GSM2011371", "GSM2011372", "GSM2011373", "GSM2011374", "GSM2011375", "GSM2011376", "GSM2011377", "GSM2011378", "GSM2011379", "GSM2011380", "GSM2011381", "GSM2011382", "GSM2011383", "GSM2011384", "GSM2011385", "GSM2011386", "GSM2011387", "GSM2011388", "GSM2011389", "GSM2011390", "GSM2011391", "GSM2011392", "GSM2011393", "GSM2011394", "GSM2011395", "GSM2011396", "GSM2011397", "GSM2011398", "GSM2011399", "GSM2011400", "GSM2011401", "GSM2011402", "GSM2011403", "GSM2011404", "GSM2011405", "GSM2011406", "GSM2011407", "GSM2011408", "GSM2011409", "GSM2011410", "GSM2011411", "GSM2011412", "GSM2011413", "GSM2011414", "GSM2011415", "GSM2011416", "GSM2011417", "GSM2011418", "GSM2011419", "GSM2011420", "GSM2011421", "GSM2011422", "GSM2011423", "GSM2011424", "GSM2011425", "GSM2011426", "GSM2011427", "GSM2011428", "GSM2011429", "GSM2011430", "GSM2011431", "GSM2011432", "GSM2011433", "GSM2011434", "GSM2011435", "GSM2011436", "GSM2011437", "GSM2011438", "GSM2011439", "GSM2011440", "GSM2011441", "GSM2011442", "GSM2011443", "GSM2011444", "GSM2011445", "GSM2011446", "GSM2011447", "GSM2011448", "GSM2011449", "GSM2011450", "GSM2011451"], "sample_count": 167, "group_sizes": null, "group_sizes_basis": null, "platform": "10558", "taxon": "Homo sapiens", "title": "Microarray expression data for tumor and adjacent non-tumor tissues from hepatocellular carcinoma patients", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32158466:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7217c4d36371392a30b79e62ffaec443fde28866cbaa0fa21c626e6eeb290dba", "bytes": 887, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#T1", "version": null, "note": "The clinical features of TCGA hepatocellular carcinoma patients.", "structure": {"pmcid": "PMC7052339", "section_index": 4, "section_title": "Data Acquisition and Processing", "row_count": 25, "column_count": 3}, "table": {"label": "Table 1", "caption": "The clinical features of TCGA hepatocellular carcinoma patients.", "rows": [["Clinical features"], ["Age (years)", "media", "73"], ["", "Rage", "18-90"], ["", "Numbers of patients (n=374)", "Numbers of patients (%)"], ["Gender", "Female", "120 (32.09)"], ["", "Male", "254 (67.91)"], ["Grade", "G1", "55 (14.71)"], ["", "G2", "179 (47.86)"], ["", "G3", "136 (36.36)"], ["", "unknown", "4 (1.07)"], ["T stage", "T1", "185 (49.47)"], ["", "T2", "94 (24.13)"], ["", "T3", "81 (21.66)"], ["", "T4", "13 (4.74)"], ["N stage", "0", "257 (68.72)"], ["", "1", "5 (1.37)"], ["", "unknown", "113 (29.91)"], ["M stage", "0", "364 (97.32)"], ["", "1", "5 (1.34)"], ["", "unknown", "5 (1.34)"], ["AJCC stage", "I", "175 (46.78)"], ["", "II", "86 (25.27)"], ["", "III", "86 (25.27)"], ["", "IV", "5 (1.34)"], ["", "unknown", "5 (1.34)"]], "row_count": 25, "column_count": 3, "numeric_cells": 28, "header_rows": 1, "locator": "section[4]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:32158466:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:cf21b691b474672e671ce9625890207a884a9538652f9fb9282260101445f2d8", "bytes": 876, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#T2", "version": null, "note": "Primer sequences for qRT-PCR.", "structure": {"pmcid": "PMC7052339", "section_index": 11, "section_title": "Quantitative Real-Time PCR (qRT-PCR)", "row_count": 17, "column_count": 2}, "table": {"label": "Table 2", "caption": "Primer sequences for qRT-PCR.", "rows": [["Primer", "Seqence 5'-3'"], ["IL11 forward", "GTGGCCAAGATACAGCTGTCGC"], ["IL11 reverse", "GGTAGGACAGTAGGTCCGCTC"], ["IL17 forward", "AGA GAT ATC CCT CTG TGATC"], ["IL17 reverse", "TAC CCC AAA GTT ATC TCA GG"], ["SPP1 forward", "TCACCTGTGCCATACCAGTT"], ["SPP1 reverse", "TGTGGTCATGGCTTTCGTTG"], ["MAPT forward", "AAGATCGGCTCCACTGAGAA"], ["MAPT reverse", "ATGAGCCACACTTGGAGGTC"], ["BIRC5 forward", "CGCATCTCTACATTCAAG"], ["BIRC5 reverse", "ATGTTCCTCTCTCGTGAT"], ["miR-204 forward", "ACACTCCAGCTGGGTTCCCTTTGTCATCC"], ["miR-204 reverse", "CTCAACTGGTGTCGTGGA"], ["SNHG12 forward", "TCTGGTGATCGAGGACTTCC"], ["SNHG12 reverse", "ACCTCCTCAGTATCACACACT"], ["GAPDH forward", "CAACGAATTTGGCTACAGCA"], ["GAPDH reverse", "AGGGGTCTACATGGCAACTG"]], "row_count": 17, "column_count": 2, "numeric_cells": 9, "header_rows": 1, "locator": "section[11]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:32158466:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4a1ffc96dfbfaa3f487d0b3f1801829ac910f9f9549b530ece730583ddef8267", "bytes": 825, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#T3", "version": null, "note": "Univariate and Multivariate Cox regression analysis of survival associated IRGS.", "structure": {"pmcid": "PMC7052339", "section_index": 20, "section_title": "Clinical Outcome of Patients With HCC Using the IRGPM", "row_count": 9, "column_count": 5}, "table": {"label": "Table 3", "caption": "Univariate and Multivariate Cox regression analysis of survival associated IRGS.", "rows": [["Risk Factors", "Overall Survival (OS)"], ["", "Univariate analysis", "Multivariate analysis"], ["", "HR (95% CI)", "P value", "OR (95% CI)", "P value"], ["Age", "1.002(0.986−1.017", "0.824", "1.006(0.990−1.022)", "0.484"], ["gender", "0.886(0.578−1.358)", "0.580", "1.110(0.713−1.729)", "0.643"], ["grade", "1.173(0.886−1.551)", "0.265", "1.125(0.827−1.531)", "0.452"], ["AJCC stage", "1.866(1.488−2.341)", "<0.001**", "1.247(0.461−3.378)", "0.664"], ["T stage", "1.826(1.472−2.265)", "<0.001**", "1.408(0.541−3.666)", "0.483"], ["Risk score", "2.238 (1.293-3.872)", "<0.001**", "2.071 (1.183-3.625)", "<0.001**"]], "row_count": 9, "column_count": 5, "numeric_cells": 26, "header_rows": 3, "locator": "section[20]/table-wrap[1]#T3"}}], "gaps": ["asset:data:geo:GSE76427 not downloaded", "asset:data:geo:GSE76427 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Survival curves were generated using the Kaplan-Meier method, and the log-rank test was used to compare differences between the two groups."}}, {"id": "method-2", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Student's t-test"}}, {"id": "method-3", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-4", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "COX regression"}}, {"id": "method-5", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "log-rank"}}, {"id": "method-6", "family": "differential_expression", "specific": "edger", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.7, "band": "medium", "quote": "edgeR"}}, {"id": "method-7", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "Protein-protein interaction"}}, {"id": "method-8", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.8, "band": "high", "quote": "ROC curve"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE76427"], "resolved_accessions": ["GSE76427"], "statements": ["The datasets analysed for this study were obtained from TCGA data portal (https://portal.gdc.cancer.gov/) and GEO data portal (https://www.ncbi.nlm.nih.gov/geo/)."], "basis": "The paper names GSE76427 in Gene Expression Omnibus (GEO) data portal and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:32158466", "data:geo:GSE76427", "asset:table:pmid:32158466:1", "asset:table:pmid:32158466:2", "asset:table:pmid:32158466:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE76427"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:18:38Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 25713, "completion_tokens": 1069, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32158466", "type": "paper", "label": "pmid:32158466"}, {"id": "source:pmid:32158466", "type": "manuscript", "label": "PMID 32158466 full text"}, {"id": "data:geo:GSE76427", "type": "dataset", "label": "GEO GSE76427"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32158466", "type": "paper", "label": "pmid:32158466"}, {"id": "source:pmid:32158466", "type": "manuscript", "label": "PMID 32158466 full text"}, {"id": "data:geo:GSE76427", "type": "dataset", "label": "GEO GSE76427"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32158466", "type": "extraction", "used": ["source:pmid:32158466"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE76427", "type": "accession_resolution", "used": ["data:geo:GSE76427"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32158466", "parent_hash": "sha256:c72a87ad6d3fe71206a5f78ed9f8a8c7984bb70433dde77d02598be50a9fc4b7", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE76427 licence not read", "asset:data:geo:GSE76427 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Survival curves were generated using the Kaplan-Meier method, and the log-rank test was used to compare differences between the two groups."], "order_basis": "analysis_only", "id": "assay:1"}]}