PIK3C3 Acts as a Tumor Suppressor in Esophageal Squamous Cell Carcinoma and Was Regulated by MiR-340-5p.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32207410", "kind": "science-record", "revision": 9, "content_hash": "sha256:38ba25926e0839e98f0e898f91f3b4f717b11c5d19dcdc24eebda2bfdda74203", "created_at": "2026-11-01T15:40:58Z", "updated_at": "2026-11-01T22:44:40Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "PIK3C3 Acts as a Tumor Suppressor in Esophageal Squamous Cell Carcinoma and Was Regulated by MiR-340-5p.", "doi": "10.12659/MSM.920642", "pmid": "32207410", "authors": ["Xiaobo Wang", "Min Gu", "Yongjian Ju", "Juying Zhou"], "journal": "Medical science monitor : international medical journal of experimental and clinical research", "year": 2020, "abstract": "BACKGROUND Esophageal squamous cell carcinoma (ESCC), a major histological subtype of esophageal cancer, is a common cause of tumor-related deaths in the world. Due to the lack of understanding of the pathogenesis of ESCC, its clinical treatment is still a big challenge. In the present study, we aimed to identify an ESCC-related gene in the GEO dataset, and to explore its function and mechanism in ESCC. MATERIAL AND METHODS The GSE dataset (GSE100492) consisting of 10 samples was analyzed using GEO2R for identifying the differentially expressed genes between ESCC and normal samples. Expression levels of mRNA and miRNA in ESCC tissues and cells were detected via quantitative real-time polymerase chain reaction. Protein expression was analyzed by western blot. Cell proliferation viability was determined through MTT and colony formation. Cell distribution and apoptosis was detected by flow cytometry. MiRNA target prediction was analyzed by bioinformatics. The interplay between miR-340-5p and PIK3C3 was validated by dual-luciferase reporter assay. RESULTS PIK3C3 was lowly expressed in ESCC tissue and indicated a poor prognosis in patents. Overexpression of PIK3C3 in vitro repressed cell proliferation of KYSE-150 and TE-12 cells. Moreover, PIK3C3 overexpression was demonstrated to enhance the sensitivity of KYSE-150 and TE-12 cells to irradiation. In addition, miR-340-5p was revealed to directly bind and negatively modulate PIK3C3 expression in ESCC. Blockage of miR-340-5p promoted ESCC cell proliferation, while rescue of PIK3C3 reversed this effect. MiR-340-5p was highly expressed in ESCC tissue and it exhibited a negative correlation with PIK3C3 expression. CONCLUSIONS MiR-340-5p functioned as an oncogene of ESCC by directly binding and repressing the expression of PIK3C3.", "claims": [{"id": "claim-method", "statement": "Statistical analysis was conducted on GraphPad Prism (Version 7.0, USA) using one-way ANOVA analysis or Student t-test and data were showed as mean±standard deviation (SD).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32207410", "locator": "sections[11] \"Statistical analysis\" paragraph 2", "quote": "Statistical analysis was conducted on GraphPad Prism (Version 7.0, USA) using one-way ANOVA analysis or Student t-test and data were showed as mean±standard deviation (SD)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The GSE dataset GSE100492 consisting of 10 samples was downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/) and analyzed using GEO2R.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32207410", "locator": "sections[3] \"Microarray datasets\" paragraph 2", "quote": "The GSE dataset GSE100492 consisting of 10 samples was downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/) and analyzed using GEO2R."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32207410"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE100492"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE100492"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32207410", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.12659/MSM.920642", "sha256": "sha256:4ca0dd67bbda6cc1ea6c4035ac07f9d9b35b6b80381497a8be284aade939aecc", "bytes": 31727, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.12659/MSM.920642", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7111147", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE100492", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE100492", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE100492", "version": null, "note": "The GSE dataset GSE100492 consisting of 10 samples was downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/) and analyzed using GEO2R.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GSE dataset GSE100492 consisting of 10 samples was downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/) and analyzed using GEO2R.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM2684969", "GSM2684970", "GSM2684971", "GSM2684972"], "sample_count": 4, "group_sizes": null, "group_sizes_basis": null, "platform": "21493", "taxon": "Mus musculus", "title": "m6A peaks in mouse brain sample.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32207410:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7329c931cae18b78fd3802d741f73ea77897bc12a9469bf55a2e971d9c8d0619", "bytes": 500, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#t1-medscimonit-26-e920642", "version": null, "note": "The sequences of primers in this study.", "structure": {"pmcid": "PMC7111147", "section_index": 5, "section_title": "Quantitative real-time PCR (qRT-PCR)", "row_count": 6, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of primers in this study.", "rows": [["Gene", "Primer"], ["Forward (5′-3′)", "Reverse (5′-3′)"], ["GAPDH", "TGTTCGTCATGGGTGTGAAC", "ATGGCATGGACTGTGGTCAT"], ["MiR-340-5p", "GCTTATAAAGCAATGAGACTGATT", "CTCAACTGGTGTCGTGGA"], ["PIK3C3", "TGTGATGTCAATGCCAGTTA", "TACTAACAGGTGGAAATGCTC"], ["U6", "CTCGCTTCG GCAGCACA", "AACGCTTCACGAATTTGCGT"]], "row_count": 6, "column_count": 3, "numeric_cells": 3, "header_rows": 2, "locator": "section[5]/table-wrap[1]#t1-medscimonit-26-e920642"}}, {"id": "asset:table:pmid:32207410:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d77c0ed2c389910d8abd21c299ff95dcaab14aef6024b1c914c6d214197a3a0a", "bytes": 882, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#t2-medscimonit-26-e920642", "version": null, "note": "The association between PIK3C3 expression and clinic pathological parameters in 31 cases of esophageal squamous cell carcinoma patients.", "structure": {"pmcid": "PMC7111147", "section_index": 13, "section_title": "PIK3C3 was identified to be downregulated in ESCC", "row_count": 17, "column_count": 4}, "table": {"label": "Table 2", "caption": "The association between PIK3C3 expression and clinic pathological parameters in 31 cases of esophageal squamous cell carcinoma patients.", "rows": [["", "All cases", "PIK3C3"], ["High expression", "Low expression", "P value"], ["Age (year)", "0.053"], [">60", "15", "10 (66.7%)", "5 (33.3%)"], ["≤60", "16", "5 (31.3%)", "11 (68.8%)"], ["Gender", "0.475"], ["Male", "14", "6 (42.9%)", "8 (57.1%)"], ["Female", "17", "6 (35.3%)", "11 (64.7%)"], ["pN status", "0.012"], ["N0", "24", "17 (70.8%)", "7 (29.2%)"], ["N1–N2", "7", "1 (14.3%)", "6 (85.7%)"], ["pM status", "0.195"], ["M0", "28", "21 (75.0%)", "7 (25.0%)"], ["M1", "3", "1 (33.3%)", "2 (66.7%)"], ["Clinical stage", "0.037"], ["I & II", "23", "16 (69.6%)", "7 (30.4%)"], ["III & IV", "8", "2 (25.0%)", "6 (75.0%)"]], "row_count": 17, "column_count": 4, "numeric_cells": 37, "header_rows": 2, "locator": "section[13]/table-wrap[1]#t2-medscimonit-26-e920642"}}, {"id": "asset:table:pmid:32207410:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c70d6c8801ac0e0fa5638b27c320c338af2578e06690d85e2138c83000de2419", "bytes": 887, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t3-medscimonit-26-e920642", "version": null, "note": "The association between miR-340-5p expression and clinic pathological parameters in 31 cases of esophageal squamous cell carcinoma patients.", "structure": {"pmcid": "PMC7111147", "section_index": 17, "section_title": "PIK3C3 reversed the promotive effects of miR-340-5p on ESCC cell proliferation", "row_count": 17, "column_count": 4}, "table": {"label": "Table 3", "caption": "The association between miR-340-5p expression and clinic pathological parameters in 31 cases of esophageal squamous cell carcinoma patients.", "rows": [["", "All cases", "MiR-340-5p"], ["High expression", "Low expression", "P value"], ["Age (year)", "0.422"], [">60", "15", "6 (40.0%)", "9 (60.0%)"], ["≤60", "16", "8 (50.0%)", "8 (50.0%)"], ["Gender", "0.276"], ["Male", "14", "9 (64.3%)", "5 (35.7%)"], ["Female", "17", "8 (47.1%)", "9 (52.9%)"], ["pN status", "0.058"], ["N0", "24", "7 (29.2%)", "17 (70.8%)"], ["N1–N2", "7", "5 (71.4%)", "2 (28.6%)"], ["pM status", "0.027"], ["M0", "28", "7 (25.0%)", "21 (75.0%)"], ["M1", "3", "3 (100.0%)", "0 (0.0%)"], ["Clinical stage", "0.037"], ["I & II", "23", "7 (30.4%)", "16 (69.6%)"], ["III & IV", "8", "6 (75.0%)", "2 (25.0%)"]], "row_count": 17, "column_count": 4, "numeric_cells": 38, "header_rows": 2, "locator": "section[17]/table-wrap[1]#t3-medscimonit-26-e920642"}}], "gaps": ["asset:data:geo:GSE100492 not downloaded", "asset:data:geo:GSE100492 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Statistical analysis was conducted on GraphPad Prism (Version 7.0, USA) using one-way ANOVA analysis or Student t-test and data were showed as mean±standard deviation (SD)."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE100492"], "resolved_accessions": ["GSE100492"], "statements": ["The GSE dataset GSE100492 consisting of 10 samples was downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/) and analyzed using GEO2R."], "basis": "The paper names GSE100492 in GEO database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32207410", "data:geo:GSE100492", "asset:table:pmid:32207410:1", "asset:table:pmid:32207410:2", "asset:table:pmid:32207410:3"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE100492"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:18:55Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 28041, "completion_tokens": 862, "cached_tokens": 9216}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32207410", "type": "paper", "label": "pmid:32207410"}, {"id": "source:pmid:32207410", "type": "manuscript", "label": "PMID 32207410 full text"}, {"id": "data:geo:GSE100492", "type": "dataset", "label": "GEO GSE100492"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32207410", "type": "paper", "label": "pmid:32207410"}, {"id": "source:pmid:32207410", "type": "manuscript", "label": "PMID 32207410 full text"}, {"id": "data:geo:GSE100492", "type": "dataset", "label": "GEO GSE100492"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32207410", "type": "extraction", "used": ["source:pmid:32207410"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE100492", "type": "accession_resolution", "used": ["data:geo:GSE100492"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32207410", "parent_hash": "sha256:9d28c0150c0bd736500f4482a25f0eeb3f6c5b7c3c2579605a829113d0e8b940", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE100492 licence not read", "asset:data:geo:GSE100492 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["reaction. Protein expression was analyzed by western blot. Cell proliferation viability was determined"], "order_basis": "paper_text_order:815", "id": "assay:1"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["and colony formation. Cell distribution and apoptosis was detected by flow cytometry. MiRNA target", "oliferation viability was determined through MTT and colony formation. Cell distribution and"], "order_basis": "paper_text_order:881", "id": "assay:2"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["l distribution and apoptosis was detected by flow cytometry. MiRNA target prediction was analyzed by bio"], "order_basis": "paper_text_order:955", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["nk (Shanghai, China). All kinds of cell were cultured in RPMI-1640 medium (Invitrogen, USA) supplemen"], "order_basis": "paper_text_order:2454", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Statistical analysis was conducted on GraphPad Prism (Version 7.0, USA) using one-way ANOVA analysis or Student t-test and data were showed as mean±standard deviation (SD)."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}