Identification of Four Pathological Stage-Relevant Genes in Association with Progression and Prognosis in Clear Cell Renal Cell Carcinoma by Integrated Bioinformatics Analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32309427", "kind": "science-record", "revision": 8, "content_hash": "sha256:1c97cab106a6b19d0d6abff09d7c3bbe5933b06ba879b00b2939f0bcf59b7944", "created_at": "2026-11-01T15:40:59Z", "updated_at": "2026-11-01T22:44:46Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of Four Pathological Stage-Relevant Genes in Association with Progression and Prognosis in Clear Cell Renal Cell Carcinoma by Integrated Bioinformatics Analysis.", "doi": "10.1155/2020/2137319", "pmid": "32309427", "authors": ["Dengyong Xu", "Yuzi Xu", "Yiming Lv", "Fei Wu", "Yunlong Liu", "Ming Zhu", "Dake Chen", "Bingjun Bai"], "journal": "BioMed research international", "year": 2020, "abstract": "Clear cell renal cell carcinoma (ccRCC) is a major histological subtype of renal cell carcinoma and can be clinically divided into four stages according to the TNM criteria. Identifying clinical stage-related genes is beneficial for improving the early diagnosis and prognosis of ccRCC. By using bioinformatics analysis, we aim to identify clinical stage-relevant genes that are significantly associated with the development of ccRCC. First, we analyzed the gene expression microarray data sets: GSE53757 and GSE73731. We divided these data into five groups by staging information-normal tissue and ccRCC stages I, II, III, and IV-and eventually identified 500 differentially expressed genes (DEGs). To obtain precise stage-relevant genes, we subsequently applied weighted gene coexpression network analysis (WGCNA) to the GSE73731 dataset and KIRC data from The Cancer Genome Atlas (TCGA). Two modules from each dataset were identified to be related to the tumor TNM stage. Several genes with high inner connection inside the modules were considered hub genes. The intersection results between hub genes of key modules and 500 DEGs revealed UBE2C, BUB1B, RRM2, and TPX2 as highly associated with the stage of ccRCC. In addition, the candidate genes were validated at both the RNA expression level and the protein level. Survival analysis also showed that 4 genes were significantly correlated with overall survival. In conclusion, our study affords a deeper understanding of the molecular mechanisms associated with the development of ccRCC and provides potential biomarkers for early diagnosis and individualized treatment for patients at different stages of ccRCC.", "claims": [{"id": "claim-method", "statement": "The gene expression levels in ccRCC stages I, II, III, and IV were compared with those in normal tissue using the limma package [33] in R software.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32309427", "locator": "sections[4] \"2.2. Identification of DEGs\" paragraph 2", "quote": "The gene expression levels in ccRCC stages I, II, III, and IV were compared with those in normal tissue using the limma package [33] in R software."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All data included in this study are available upon request by contact with the corresponding author.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32309427", "locator": "sections[28] \"Data Availability\" paragraph 2", "quote": "All data included in this study are available upon request by contact with the corresponding author."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32309427"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE53757"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE53757"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32309427", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1155/2020/2137319", "sha256": "sha256:79b29a342d802cd40dcb3cfe96e154e1815b4571a664b5dc2146f198b6466b0c", "bytes": 46391, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1155/2020/2137319", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7142335", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE53757", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE53757", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE53757", "version": null, "note": "All data included in this study are available upon request by contact with the corresponding author.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data included in this study are available upon request by contact with the corresponding author.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1300062", "GSM1300063", "GSM1300064", "GSM1300065", "GSM1300066", "GSM1300067", "GSM1300068", "GSM1300069", "GSM1300070", "GSM1300071", "GSM1300072", "GSM1300073", "GSM1300074", "GSM1300075", "GSM1300076", "GSM1300077", "GSM1300078", "GSM1300079", "GSM1300080", "GSM1300081", "GSM1300082", "GSM1300083", "GSM1300084", "GSM1300085", "GSM1300086", "GSM1300087", "GSM1300088", "GSM1300089", "GSM1300090", "GSM1300091", "GSM1300092", "GSM1300093", "GSM1300094", "GSM1300095", "GSM1300096", "GSM1300097", "GSM1300098", "GSM1300099", "GSM1300100", "GSM1300101", "GSM1300102", "GSM1300103", "GSM1300104", "GSM1300105", "GSM1300106", "GSM1300107", "GSM1300108", "GSM1300109", "GSM1300110", "GSM1300111", "GSM1300112", "GSM1300113", "GSM1300114", "GSM1300115", "GSM1300116", "GSM1300117", "GSM1300118", "GSM1300119", "GSM1300120", "GSM1300121", "GSM1300122", "GSM1300123", "GSM1300124", "GSM1300125", "GSM1300126", "GSM1300127", "GSM1300128", "GSM1300129", "GSM1300130", "GSM1300131", "GSM1300132", "GSM1300133", "GSM1300134", "GSM1300135", "GSM1300136", "GSM1300137", "GSM1300138", "GSM1300139", "GSM1300140", "GSM1300141", "GSM1300142", "GSM1300143", "GSM1300144", "GSM1300145", "GSM1300146", "GSM1300147", "GSM1300148", "GSM1300149", "GSM1300150", "GSM1300151", "GSM1300152", "GSM1300153", "GSM1300154", "GSM1300155", "GSM1300156", "GSM1300157", "GSM1300158", "GSM1300159", "GSM1300160", "GSM1300161", "GSM1300162", "GSM1300163", "GSM1300164", "GSM1300165", "GSM1300166", "GSM1300167", "GSM1300168", "GSM1300169", "GSM1300170", "GSM1300171", "GSM1300172", "GSM1300173", "GSM1300174", "GSM1300175", "GSM1300176", "GSM1300177", "GSM1300178", "GSM1300179", "GSM1300180", "GSM1300181", "GSM1300182", "GSM1300183", "GSM1300184", "GSM1300185", "GSM1300186", "GSM1300187", "GSM1300188", "GSM1300189", "GSM1300190", "GSM1300191", "GSM1300192", "GSM1300193", "GSM1300194", "GSM1300195", "GSM1300196", "GSM1300197", "GSM1300198", "GSM1300199", "GSM1300200", "GSM1300201", "GSM1300202", "GSM1300203", "GSM1300204", "GSM1300205"], "sample_count": 144, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene array analysis of clear cell renal cell carcinoma tissue versus matched normal kidney tissue", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE73731", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE73731", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE73731", "version": null, "note": "All data included in this study are available upon request by contact with the corresponding author.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data included in this study are available upon request by contact with the corresponding author.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1930996", "GSM1930997", "GSM1930998", "GSM1930999", "GSM1931000", "GSM1931001", "GSM1931002", "GSM1931003", "GSM1931004", "GSM1931005", "GSM1931006", "GSM1931007", "GSM1931008", "GSM1931009", "GSM1931010", "GSM1931011", "GSM1931012", "GSM1931013", "GSM1931014", "GSM1931015", "GSM1931016", "GSM1931017", "GSM1931018", "GSM1931019", "GSM1931020", "GSM1931021", "GSM1931022", "GSM1931023", "GSM1931024", "GSM1931025", "GSM1931026", "GSM1931027", "GSM1931028", "GSM1931029", "GSM1931030", "GSM1931031", "GSM1931032", "GSM1931033", "GSM1931034", "GSM1931035", "GSM1931036", "GSM1931037", "GSM1931038", "GSM1931039", "GSM1931040", "GSM1931041", "GSM1931042", "GSM1931043", "GSM1931044", "GSM1931045", "GSM1931046", "GSM1931047", "GSM1931048", "GSM1931049", "GSM1931050", "GSM1931051", "GSM1931052", "GSM1931053", "GSM1931054", "GSM1931055", "GSM1931056", "GSM1931057", "GSM1931058", "GSM1931059", "GSM1931060", "GSM1931061", "GSM1931062", "GSM1931063", "GSM1931064", "GSM1931065", "GSM1931066", "GSM1931067", "GSM1931068", "GSM1931069", "GSM1931070", "GSM1931071", "GSM1931072", "GSM1931073", "GSM1931074", "GSM1931075", "GSM1931076", "GSM1931077", "GSM1931078", "GSM1931079", "GSM1931080", "GSM1931081", "GSM1931082", "GSM1931083", "GSM1931084", "GSM1931085", "GSM1931086", "GSM1931087", "GSM1931088", "GSM1931089", "GSM1931090", "GSM1931091", "GSM1931092", "GSM1931093", "GSM1931094", "GSM1931095", "GSM1931096", "GSM1931097", "GSM1931098", "GSM1931099", "GSM1931100", "GSM1931101", "GSM1931102", "GSM1931103", "GSM1931104", "GSM1931105", "GSM1931106", "GSM1931107", "GSM1931108", "GSM1931109", "GSM1931110", "GSM1931111", "GSM1931112", "GSM1931113", "GSM1931114", "GSM1931115", "GSM1931116", "GSM1931117", "GSM1931118", "GSM1931119", "GSM1931120", "GSM1931121", "GSM1931122", "GSM1931123", "GSM1931124", "GSM1931125", "GSM1931126", "GSM1931127", "GSM1931128", "GSM1931129", "GSM1931130", "GSM1931131", "GSM1931132", "GSM1931133", "GSM1931134", "GSM1931135", "GSM1931136", "GSM1931137", "GSM1931138", "GSM1931139", "GSM1931140", "GSM1931141", "GSM1931142", "GSM1931143", "GSM1931144", "GSM1931145", "GSM1931146", "GSM1931147", "GSM1931148", "GSM1931149", "GSM1931150", "GSM1931151", "GSM1931152", "GSM1931153", "GSM1931154", "GSM1931155", "GSM1931156", "GSM1931157", "GSM1931158", "GSM1931159", "GSM1931160", "GSM1931161", "GSM1931162", "GSM1931163", "GSM1931164", "GSM1931165", "GSM1931166", "GSM1931167", "GSM1931168", "GSM1931169", "GSM1931170", "GSM1931171", "GSM1931172", "GSM1931173", "GSM1931174", "GSM1931175", "GSM1931176", "GSM1931177", "GSM1931178", "GSM1931179", "GSM1931180", "GSM1931181", "GSM1931182", "GSM1931183", "GSM1931184", "GSM1931185", "GSM1931186", "GSM1931187", "GSM1931188", "GSM1931189", "GSM1931190", "GSM1931191", "GSM1931192", "GSM1931193", "GSM1931194", "GSM1931195", "GSM1931196", "GSM1931197", "GSM1931198", "GSM1931199", "GSM1931200", "GSM1931201", "GSM1931202", "GSM1931203", "GSM1931204", "GSM1931205", "GSM1931206", "GSM1931207", "GSM1931208", "GSM1931209", "GSM1931210", "GSM1931211", "GSM1931212", "GSM1931213", "GSM1931214", "GSM1931215", "GSM1931216", "GSM1931217", "GSM1931218", "GSM1931219", "GSM1931220", "GSM1931221", "GSM1931222", "GSM1931223", "GSM1931224", "GSM1931225", "GSM1931226", "GSM1931227", "GSM1931228", "GSM1931229", "GSM1931230", "GSM1931231", "GSM1931232", "GSM1931233", "GSM1931234", "GSM1931235", "GSM1931236", "GSM1931237", "GSM1931238", "GSM1931239", "GSM1931240", "GSM1931241", "GSM1931242", "GSM1931243", "GSM1931244", "GSM1931245", "GSM1931246", "GSM1931247", "GSM1931248", "GSM1931249", "GSM1931250", "GSM1931251", "GSM1931252", "GSM1931253", "GSM1931254", "GSM1931255", "GSM1931256", "GSM1931257", "GSM1931258", "GSM1931259", "GSM1931260"], "sample_count": 265, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Clear cell renal cell carcinoma (ccRCC) samples", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32309427:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2773b9a94cb51dcc9c0b374fd68e292ee7fe5a43b58d3da17d7dd4f51af75273", "bytes": 668, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#tab1", "version": null, "note": "Real-time PCR primers.", "structure": {"pmcid": "PMC7142335", "section_index": 13, "section_title": "2.11. qPCR Validation of Key Hub Genes", "row_count": 11, "column_count": 2}, "table": {"label": "Table 1", "caption": "Real-time PCR primers.", "rows": [["Gene", "Real-time PCR primer sequences"], ["UBE2C", "F: 5′- AGTGGCTACCCTTACAATGCG -3′"], ["R: 5′- TTACCCTGGGTGTCCACGTT -3′"], ["BUB1B", "F: 5′- AAATGACCCTCTGGATGTTTGG -3′"], ["R: 5′- GCATAAACGCCCTAATTTAAGCC -3′"], ["RRM2", "F: 5′- GTGGAGCGATTTAGCCAAGAA -3′"], ["R: 5′- CACAAGGCATCGTTTCAATGG -3′"], ["TPX2", "F: 5′- ATGGAACTGGAGGGCTTTTTC -3′"], ["R: 5′- TGTTGTCAACTGGTTTCAAAGGT -3′"], ["β-Actin", "F: 5′- ACTCTTCCAGCCTTCCTTCC -3′"], ["R: 5′- CGTCATACTCCTGCTTGCTG -3′"]], "row_count": 11, "column_count": 2, "numeric_cells": 10, "header_rows": 1, "locator": "section[13]/table-wrap[1]#tab1"}}, {"id": "asset:table:pmid:32309427:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2235023330f468cdca395f4a7a00379138adaf6ed38925b5a4006c067024ad58", "bytes": 451, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#tab2", "version": null, "note": "GSE datasets involved in our study.", "structure": {"pmcid": "PMC7142335", "section_index": 16, "section_title": "3.1. Basic Characteristics of Microarray Data", "row_count": 7, "column_count": 3}, "table": {"label": "Table 2", "caption": "GSE datasets involved in our study.", "rows": [["Group", "Quantity", "GSE datasets"], ["Normal tissues", "72", "GSE53757"], ["ccRCC stage I", "62", "GSE53757+GSE73731"], ["ccRCC stage II", "29", "GSE53757+GSE73731"], ["ccRCC stage III", "41", "GSE53757+GSE73731"], ["ccRCC stage IV", "57", "GSE53757+GSE73731"], ["Total", "261", ""]], "row_count": 7, "column_count": 3, "numeric_cells": 11, "header_rows": 1, "locator": "section[16]/table-wrap[1]#tab2"}}, {"id": "asset:table:pmid:32309427:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8ade9c4dbdf817c489c1bda3254d609f6de0406b1e457803690b1e0accffdce1", "bytes": 691, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#tab3", "version": null, "note": "Four key hub genes selected from among 500 DEGs and 21 common hub genes from GSE73731 and TCGA-KIRC data.", "structure": {"pmcid": "PMC7142335", "section_index": 21, "section_title": "3.6. Weighted Gene Coexpression Network Analysis Using TCGA-KIRC Dataset and Filtration of Hub Genes", "row_count": 5, "column_count": 6}, "table": {"label": "Table 3", "caption": "Four key hub genes selected from among 500 DEGs and 21 common hub genes from GSE73731 and TCGA-KIRC data.", "rows": [["Gene symbol", "Description", "Log FC in stage I", "Log FC in stage II", "Log FC in stage III", "Log FC in stage IV"], ["UBE2C", "Ubiquitin-conjugating enzyme E2C", "2.92", "2.60", "3.68", "3.76"], ["BUB1B", "BUB1 mitotic checkpoint serine/threonine kinase B", "3.07", "2.24", "3.26", "3.19"], ["RRM2", "Ribonucleotide reductase regulatory subunit M2", "3.08", "2.9", "3.74", "4.10"], ["TPX2", "TPX2 microtubule nucleation factor", "2.59", "2.51", "3.14", "3.50"]], "row_count": 5, "column_count": 6, "numeric_cells": 16, "header_rows": 1, "locator": "section[21]/table-wrap[1]#tab3"}}, {"id": "asset:table:pmid:32309427:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:10220fdb08290a060093ee538dbb3ecd3c70d59cb4fd05a28f6efd3c036d3785", "bytes": 742, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[1]#tab4", "version": null, "note": "Histopathological characteristics of the ccRCC patients.", "structure": {"pmcid": "PMC7142335", "section_index": 22, "section_title": "3.7. Validation of RNA and Protein Expression Level for Key Hub Genes", "row_count": 9, "column_count": 7}, "table": {"label": "Table 4", "caption": "Histopathological characteristics of the ccRCC patients.", "rows": [["Patient", "Sex", "Age (years)", "Pathology", "Location", "Tumor size (cm)", "Stage"], ["1", "Male", "65", "ccRCC, partially PRCC", "Left", "12∗10.5", "III"], ["2", "Male", "80", "ccRCC", "Left", "14.8∗9.8", "IV"], ["3", "Female", "58", "ccRCC, partially PRCC", "Left", "7∗4∗2.5", "I"], ["4", "Male", "63", "ccRCC", "Right", "4.5∗4.5", "IV"], ["5", "Female", "81", "ccRCC, partially PRCC", "Left", "3∗2.2", "I"], ["6", "Female", "56", "ccRCC", "Right", "2.5∗3.1", "IV"], ["7", "Male", "57", "ccRCC", "Right", "5∗4.5", "II"], ["8", "Male", "34", "ccRCC", "Right", "3.5∗3.2", "I"]], "row_count": 9, "column_count": 7, "numeric_cells": 24, "header_rows": 1, "locator": "section[22]/table-wrap[1]#tab4"}}, {"id": "asset:table:pmid:32309427:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:d4d4cdec6e29e14542a6ce514aef9c93acff7c760d958abe1e1be4b349bb131b", "bytes": 807, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[2]#tab5", "version": null, "note": "IHC staining characteristics of hub genes from the Human Protein Atlas database.", "structure": {"pmcid": "PMC7142335", "section_index": 22, "section_title": "3.7. Validation of RNA and Protein Expression Level for Key Hub Genes", "row_count": 9, "column_count": 8}, "table": {"label": "Table 5", "caption": "IHC staining characteristics of hub genes from the Human Protein Atlas database.", "rows": [["Gene", "Patient ID", "Gender", "Age (years)", "Staining", "Intensity", "Quantity", "Location"], ["Normal tissues"], ["UBE2C", "3229", "Male", "59", "Medium", "Moderate", ">75%", "CytoplasmicMembranousNuclear"], ["RRM2", "1859", "Male", "61", "Not detected", "Negative", "None", "None"], ["TPX2", "1933", "Female", "56", "Low", "Weak", "25-75%", "CytoplasmicMembranous"], ["Cancerous tissues"], ["UBE2C", "2540", "Male", "61", "High", "Strong", ">75%", "CytoplasmicMembranousNuclear"], ["RRM2", "3616", "Female", "63", "Not detected", "Negative", "None", "None"], ["TPX2", "1831", "Male", "77", "Medium", "Strong", "25%", "Nuclear"]], "row_count": 9, "column_count": 8, "numeric_cells": 16, "header_rows": 1, "locator": "section[22]/table-wrap[2]#tab5"}}], "gaps": ["asset:data:geo:GSE53757 not downloaded", "asset:data:geo:GSE53757 licence not read", "asset:data:geo:GSE73731 not downloaded", "asset:data:geo:GSE73731 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The gene expression levels in ccRCC stages I, II, III, and IV were compared with those in normal tissue using the limma package [33] in R software."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE53757", "GSE73731"], "resolved_accessions": ["GSE53757", "GSE73731"], "statements": ["All data included in this study are available upon request by contact with the corresponding author."], "basis": "The paper names GSE53757, GSE73731 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:32309427", "data:geo:GSE53757", "asset:table:pmid:32309427:1", "asset:table:pmid:32309427:2", "asset:table:pmid:32309427:3", "asset:table:pmid:32309427:4", "asset:table:pmid:32309427:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE53757"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:19:20Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 37929, "completion_tokens": 1600, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32309427", "type": "paper", "label": "pmid:32309427"}, {"id": "source:pmid:32309427", "type": "manuscript", "label": "PMID 32309427 full text"}, {"id": "data:geo:GSE53757", "type": "dataset", "label": "GEO GSE53757"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32309427", "type": "paper", "label": "pmid:32309427"}, {"id": "source:pmid:32309427", "type": "manuscript", "label": "PMID 32309427 full text"}, {"id": "data:geo:GSE53757", "type": "dataset", "label": "GEO GSE53757"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32309427", "type": "extraction", "used": ["source:pmid:32309427"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE53757", "type": "accession_resolution", "used": ["data:geo:GSE53757"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32309427", "parent_hash": "sha256:8c4064c9a469d788e1c6e26036d23fee7588639dfd496b6b52b4697dbe250c69", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE53757 licence not read", "asset:data:geo:GSE53757 not downloaded", "asset:data:geo:GSE73731 licence not read", "asset:data:geo:GSE73731 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["cRCC. First, we analyzed the gene expression microarray data sets: GSE53757 and GSE73731. We divided"], "order_basis": "paper_text_order:606", "id": "assay:1"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The gene expression levels in ccRCC stages I, II, III, and IV were compared with those in normal tissue using the limma package [33] in R software."], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}