MiR-16-5p regulates postmenopausal osteoporosis by directly targeting VEGFA.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32427128", "kind": "science-record", "revision": 9, "content_hash": "sha256:71a21eb1891aee1f84882253121b0216581696e64f6e55c615c31ecf89477ca8", "created_at": "2026-11-01T15:41:01Z", "updated_at": "2026-11-01T22:44:52Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "MiR-16-5p regulates postmenopausal osteoporosis by directly targeting VEGFA.", "doi": "10.18632/aging.103223", "pmid": "32427128", "authors": ["Tao Yu", "Xiaomeng You", "Haichao Zhou", "Wenbao He", "Zihua Li", "Bing Li", "Jiang Xia", "Hui Zhu", "Youguang Zhao", "Guangrong Yu", "Yuan Xiong", "Yunfeng Yang"], "journal": "Aging", "year": 2020, "abstract": "In this study, we used bioinformatics tools, and experiments with patient tissues and human mesenchymal stem cells (hMSCs) to identify differentially regulated genes (DEGs) and microRNAs (miRNAs) that promote postmenopausal osteoporosis. By analyzing the GSE56815 dataset from the NCBI GEO database, we identified 638 DEGs, including 371 upregulated and 267 downregulated genes, in postmenopausal women with low bone density. Enrichment and protein-protein interaction network analyses showed that TP53, RPS27A, and VEGFA were the top three hub genes with the highest degree of betweenness and closeness centrality. TargetScanHuman and DIANA software analyses and dual luciferase reporter assays confirmed that miR-16a-5p directly targets the 3'UTR of VEGFA. Postmenopausal patients with osteoporosis showed higher miR-16-5p and lower VEGFA levels than those without osteoporosis (n=10 each). VEGFA levels were higher in miR-16-5p knockdown hMSCs and were reduced in miR-16-5p-overexpressing hMSCs. mRNA expression of osteogenic markers, ALP, OCN, and RUNX2, as well as calcium deposition based on Alizarin red staining, correlated inversely with miR-16-5p levels and correlated positively with VEGFA levels. These findings suggest that miR-16-5p suppresses osteogenesis by inhibiting VEGFA expression and is a promising target for postmenopausal osteoporosis therapy.", "claims": [{"id": "claim-method", "statement": "Binary groups were compared using Student's t-test,, whereas, multiple groups (more than two) were compared using one-way ANOVA with Tukey post hoc test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32427128", "locator": "sections[21] \"Statistical analysis\" paragraph 2", "quote": "Binary groups were compared using Student's t-test,, whereas, multiple groups (more than two) were compared using one-way ANOVA with Tukey post hoc test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The RNA microarray data of 20 postmenopausal women with osteoporosis and 20 healthy postmenopausal women in the GSE56815 dataset was retrieved from NCBI Gene Expression Omnibus (GEO) database.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32427128", "locator": "sections[11] \"Data search and identification of deferentially expressed genes (DEGs)\" paragraph 2", "quote": "The RNA microarray data of 20 postmenopausal women with osteoporosis and 20 healthy postmenopausal women in the GSE56815 dataset was retrieved from NCBI Gene Expression Omnibus (GEO) database."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32427128"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE56815"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE56815"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32427128", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.18632/aging.103223", "sha256": "sha256:e2f207604789d502d07369bdb0ea58dfb30db5367942f306ff7931979bbb3f91", "bytes": 36836, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.18632/aging.103223", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7288956", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE56815", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE56815", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE56815", "version": null, "note": "The RNA microarray data of 20 postmenopausal women with osteoporosis and 20 healthy postmenopausal women in the GSE56815 dataset was retrieved from NCBI Gene Expression Omnibus (GEO) database.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The RNA microarray data of 20 postmenopausal women with osteoporosis and 20 healthy postmenopausal women in the GSE56815 dataset was retrieved from NCBI Gene Expression Omnibus (GEO) database.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1369756", "GSM1369757", "GSM1369758", "GSM1369759", "GSM1369760", "GSM1369761", "GSM1369762", "GSM1369763", "GSM1369764", "GSM1369765", "GSM1369766", "GSM1369767", "GSM1369768", "GSM1369769", "GSM1369770", "GSM1369771", "GSM1369772", "GSM1369773", "GSM1369774", "GSM1369775", "GSM1369776", "GSM1369777", "GSM1369778", "GSM1369779", "GSM1369780", "GSM1369781", "GSM1369782", "GSM1369783", "GSM1369784", "GSM1369785", "GSM1369786", "GSM1369787", "GSM1369788", "GSM1369789", "GSM1369790", "GSM1369791", "GSM1369792", "GSM1369793", "GSM1369794", "GSM1369795", "GSM1369796", "GSM1369797", "GSM1369798", "GSM1369799", "GSM1369800", "GSM1369801", "GSM1369802", "GSM1369803", "GSM1369804", "GSM1369805", "GSM1369806", "GSM1369807", "GSM1369808", "GSM1369809", "GSM1369810", "GSM1369811", "GSM1369812", "GSM1369813", "GSM1369814", "GSM1369815", "GSM1369816", "GSM1369817", "GSM1369818", "GSM1369819", "GSM1369820", "GSM1369821", "GSM1369822", "GSM1369823", "GSM1369824", "GSM1369825", "GSM1369826", "GSM1369827", "GSM1369828", "GSM1369829", "GSM1369830", "GSM1369831", "GSM1369832", "GSM1369833", "GSM1369834", "GSM1369835"], "sample_count": 80, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Gene expression study of blood monocytes in pre- and postmenopausal females with low or high bone mineral density (HG-U133A)", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32427128:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7b5763570ceab6ea9ca478fa99f0500f4f9b694e66cd864e0decd7e9d04847fa", "bytes": 681, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#t1", "version": null, "note": "Degree of the top 10 genes in the protein-protein interaction network.", "structure": {"pmcid": "PMC7288956", "section_index": 4, "section_title": "Construction of the protein-protein interaction (PPI) network of the DEGs", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "Degree of the top 10 genes in the protein-protein interaction network.", "rows": [["Gene ID", "Gene name", "Degree"], ["TP53", "Tumor protein p53", "91"], ["RPS27A", "Ribosomal Protein S27a", "60"], ["VEGFA", "Vascular Endothelial Growth Factor A", "58"], ["MAPK8", "Mitogen-Activated Protein Kinase 8", "42"], ["CDC42", "Cell Division Cycle 42", "40"], ["CREBBP", "CREB binding protein", "38"], ["SIRT1", "Sirtuin 1", "33"], ["RPL35A", "Ribosomal Protein L35a", "31"], ["RPL30", "Ribosomal Protein L30", "30"], ["SNRPG", "Small Nuclear Ribonucleoprotein Polypeptide G", "30"]], "row_count": 11, "column_count": 3, "numeric_cells": 22, "header_rows": 0, "locator": "section[4]/table-wrap[1]#t1"}}, {"id": "asset:table:pmid:32427128:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:13b130abd9f0f12c5a8319797a4a54d37c7a62832d641051775e9807090eee8d", "bytes": 1650, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#t2", "version": null, "note": "Top 3 GO terms according to biological process, molecular function, and cellular component, and top 3 KEGG pathways related to the top 10 hub genes in module.", "structure": {"pmcid": "PMC7288956", "section_index": 5, "section_title": "Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis", "row_count": 20, "column_count": 5}, "table": {"label": "Table 2", "caption": "Top 3 GO terms according to biological process, molecular function, and cellular component, and top 3 KEGG pathways related to the top 10 hub genes in module.", "rows": [["(A) Biological processes"], ["Term", "Name", "Count", "P-value", "Genes"], ["GO:0071456", "Cellular response to hypoxia", "5", "2.6E-7", "VEGFA, CREBBP, TP53, SIRT1, RPS27A"], ["GO:0036294", "Cellular response to decreased oxygen levels", "5", "3.2E-7", "VEGFA, CREBBP, TP53, SIRT1, RPS27A"], ["GO:0071453", "Cellular response to oxygen levels", "5", "4.2E-7", "VEGFA, CREBBP, TP53, SIRT1, RPS27A"], ["(B) Molecular functions"], ["Term", "Name", "Count", "P-value", "Genes"], ["GO:0002039", "P53 binding", "3", "6.5E-4", "CREBBP, TP53, SIRT1"], ["GO:1901363", "Heterocyclic compound binding", "9", "2.9E-3", "CDC42, RPL35A, RPL30, CREBBP, TP53, MAPK8, SIRT1, RPS27A, SNRPG"], ["GO:0097159", "Organic cyclic compound binding", "9", "3.2E-3", "CDC42, RPL35A, RPL30, CREBBP, TP53, MAPK8, SIRT1, RPS27A, SNRPG"], ["(C) Cellular component"], ["Term", "Name", "Count", "P-value", "Genes"], ["GO:0022626", "Cytosolic ribosome", "3", "2.0E-3", "RPL35A, RPL30, RPS27A"], ["GO:0044391", "Ribosomal subunit", "3", "4.5E-3", "RPL35A, RPL30, RPS27A"], ["GO:0044445", "Cytosolic part", "3", "7.1E-3", "RPL35A, RPL30, RPS27A"], ["(D) KEGG pathway"], ["Term", "Name", "Count", "P-value", "Genes"], ["hsa05212", "Pancreatic cancer", "4", "4.4E-5", "CDC42, VEGFA, TP53, MAPK8"], ["Hsa05200", "Pathways in cancer", "5", "6.1E-4", "CDC42, VEGFA, CREBBP, TP53, MAPK8"], ["hsa05211", "Renal cell carcinoma", "3", "2.4E-3", "CDC42, VEGFA, CREBBP"]], "row_count": 20, "column_count": 5, "numeric_cells": 49, "header_rows": 0, "locator": "section[5]/table-wrap[1]#t2"}}, {"id": "asset:table:pmid:32427128:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:44bdc7f0af90ba34466a4931fd35b1ec14b5d932f72e157a44f9cad6b96c2247", "bytes": 865, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t3", "version": null, "note": "QRT-PCR primers used in the study.", "structure": {"pmcid": "PMC7288956", "section_index": 17, "section_title": "QRT-PCR analysis", "row_count": 15, "column_count": 2}, "table": {"label": "Table 3", "caption": "QRT-PCR primers used in the study.", "rows": [["Gene name", "Primer sequence"], ["hsa - miR-16-5p - Forward", "TGGGGTAGCAGCACGTAAA"], ["hsa - miR-16-5p - Reverse", "CTCAACTGGTGTCGTGGAGTC"], ["hsa-U6-Forward", "CTCGCTTCGGCAGCACA"], ["hsa-U6-Reverse", "AACGCTTCACGAATTTGCGT"], ["hsa-VEGFA-Forward", "AGGGCAGAATCATCACGAAGT"], ["hsa-VEGFA-Reverse", "AGGGTCTCGATTGGATGGCA"], ["hsa-ALP - Forward", "ACCACCACGAGAGTGAACCA"], ["hsa-ALP - Reverse", "CGTTGTCTGAGTACCAGTCCC"], ["hsa-OCN - Forward", "CAAAGGTGCAGCCTTTGTGTC"], ["hsa-OCN - Reverse", "TCACAGTCCGGATTGAGCTCA"], ["hsa-Runx2 - Forward", "TGGTTACTGTCATGGCGGGTA"], ["hsa-Runx2 - Reverse", "TCTCAGATCGTTGAACCTTGCTA"], ["hsa-GAPDH - Forward", "CCGTTGAATTTGCCGTGA"], ["hsa-GAPDH - Reverse", "TGATGACCCTTTTGGCTCCC"]], "row_count": 15, "column_count": 2, "numeric_cells": 2, "header_rows": 0, "locator": "section[17]/table-wrap[1]#t3"}}], "gaps": ["asset:data:geo:GSE56815 not downloaded", "asset:data:geo:GSE56815 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Binary groups were compared using Student's t-test,, whereas, multiple groups (more than two) were compared using one-way ANOVA with Tukey post hoc test."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-3", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-4", "family": "network_analysis", "specific": "centrality", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "centrality"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE56815"], "resolved_accessions": ["GSE56815"], "statements": ["The RNA microarray data of 20 postmenopausal women with osteoporosis and 20 healthy postmenopausal women in the GSE56815 dataset was retrieved from NCBI Gene Expression Omnibus (GEO) database."], "basis": "The paper names GSE56815 in NCBI Gene Expression Omnibus (GEO) database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32427128", "data:geo:GSE56815", "asset:table:pmid:32427128:1", "asset:table:pmid:32427128:2", "asset:table:pmid:32427128:3"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE56815"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:19:56Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 31551, "completion_tokens": 902, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32427128", "type": "paper", "label": "pmid:32427128"}, {"id": "source:pmid:32427128", "type": "manuscript", "label": "PMID 32427128 full text"}, {"id": "data:geo:GSE56815", "type": "dataset", "label": "GEO GSE56815"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32427128", "type": "paper", "label": "pmid:32427128"}, {"id": "source:pmid:32427128", "type": "manuscript", "label": "PMID 32427128 full text"}, {"id": "data:geo:GSE56815", "type": "dataset", "label": "GEO GSE56815"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32427128", "type": "extraction", "used": ["source:pmid:32427128"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE56815", "type": "accession_resolution", "used": ["data:geo:GSE56815"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32427128", "parent_hash": "sha256:f32b72c2f54d0ecace502ac752cb12dcb8828c4d2a4810b37b8f54e3d569d9f7", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE56815 licence not read", "asset:data:geo:GSE56815 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["each). VEGFA levels were higher in miR-16-5p knockdown hMSCs and were reduced in miR-16-5p-overexpr", "and VEGFA levels in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC,", "miR-16-5p levels in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC,", "P, OCN and RUNX2, in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC,"], "order_basis": "paper_text_order:963", "id": "assay:1"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["6-5p, antagomiR-NC, and antagomiR-16-5p. (E) Western blotting analysis shows relative VEGFA protein levels"], "order_basis": "paper_text_order:3888", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Binary groups were compared using Student's t-test,, whereas, multiple groups (more than two) were compared using one-way ANOVA with Tukey post hoc test."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}