Upregulation of cGMP-dependent Protein Kinase (PRKG1) in the Development of Adolescent Idiopathic Scoliosis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32558266", "kind": "science-record", "revision": 8, "content_hash": "sha256:d2f043828b2676e77d8897dcacc2e769fea78b64a90e4d36f074a9deb43e778d", "created_at": "2026-11-01T15:41:03Z", "updated_at": "2026-11-01T22:44:58Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Upregulation of cGMP-dependent Protein Kinase (PRKG1) in the Development of Adolescent Idiopathic Scoliosis.", "doi": "10.1111/os.12694", "pmid": "32558266", "authors": ["Cang-Long Hou", "Bo Li", "Ya-Jun Cheng", "Ming Li", "Zong-de Yang"], "journal": "Orthopaedic surgery", "year": 2020, "abstract": "OBJECTIVE: To explore the molecular regulatory mechanisms underlying fibroblast differentiation and dysfunction in the development of adolescent idiopathic scoliosis (AIS) in an effort to identify candidate therapeutic targets for AIS.\nMETHODS: The GSE110359 dataset, obtained from the bone marrow stromal cells of 12 AIS patients and five healthy controls, was retrieved from the GEO database. The data were preprocessed and differentially expressed genes (DEGs) were identified. KEGG pathway and Gene Ontology (GO)-Biological Process (BP) enrichment analyses were performed to identify the function of the DEGs. A protein-protein interaction (PPI) and a microRNA-transcription factor (TF)-target co-regulatory network were constructed to identify hub genes in the development of AIS. In addition, hub DEGs were evaluated by quantitative PCR (qPCR) and immunohistochemical staining.\nRESULTS: A total of 188 DEGs including 100 up-regulated and 88 down-regulated genes were obtained. The up-regulated DEGs were related to \"p53 signaling pathway\", \"FoxO signaling pathway\", and \"cGMP-PKG signaling pathway\" terms, while the down-regulated DEGs were significantly enriched in seven terms including \"protein processing in endoplasmic reticulum\". The key up-regulated genes, PRKG1, CCNG2, and KAT2B, and the key down-regulated genes, MAP2K1 and DUSP6, were identified by the PPI and miRNA-TF-Target regulatory network analyses. mRNA expression patterns for PRKG1, DUSP6, and KAT2B were successfully verified by qPCR. In addition, PRKG1 protein levels were found to be elevated during the immunohistochemical analysis.\nCONCLUSION: Increased expression of PRKG1 in AIS patients might be an attractive therapeutic target for AIS. However, further gain or loss-of-function studies should be conducted.", "claims": [{"id": "claim-method", "statement": "Differential expression analysis was conducted using the classical Bayesian method from the limma package (Version 3.10.3, http://www.bioconductor.org/packages/2.9/bioc/html/limma.html).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32558266", "locator": "sections[5] \"Data Preprocessing and DEG Screening\" paragraph 3", "quote": "Differential expression analysis was conducted using the classical Bayesian method from the limma package (Version 3.10.3, http://www.bioconductor.org/packages/2.9/bioc/html/limma.html)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32558266"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32558266", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/os.12694", "sha256": "sha256:b0f3576c47d55071363752ebde45386f35b6f6ef8dc6b807166841618e094f10", "bytes": 28027, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/os.12694", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7454216", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:32558266:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b8c9a51299303623862de9143eaf7a22d83472a642b38104359bd17c495061df", "bytes": 754, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#os12694-tbl-0001", "version": null, "note": "The forward and reverse primers of genes and GAPDH normalizer for RT‐PCR", "structure": {"pmcid": "PMC7454216", "section_index": 9, "section_title": "Quantitative Reverse Transcription PCR (qRT‐PCR)", "row_count": 13, "column_count": 3}, "table": {"label": "TABLE 1", "caption": "The forward and reverse primers of genes and GAPDH normalizer for RT‐PCR", "rows": [["Primer", "Direction", "Sequence (5′‐3′)"], ["MAP2K1", "Forward", "CAATGGCGGTGTGGTGTTC"], ["Reverse", "GATTGCGGGTTTGATCTCCAG"], ["PRKG1", "Forward", "GACAACGATGAACCACCAC"], ["Reverse", "GCTTTGCTTCAGGACCAC"], ["DUSP6", "Forward", "GAAATGGCGATCAGCAAGACG"], ["Reverse", "CGACGACTCGTATAGCTCCTG"], ["KAT2B", "Forward", "CGAATCGCCGTGAAGAAAGC"], ["Reverse", "CTTGCAGGCGGAGTACACT"], ["CCNG2", "Forward", "TAGCAGGGACAGTGGATA"], ["Reverse", "AATACTTGGGCAATAGGA"], ["GAPDH", "Forward", "TGACAACTTTGGTATCGTGGAAGG"], ["Reverse", "AGGCAGGGATGATGTTCTGGAGAG"]], "row_count": 13, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[9]/table-wrap[1]#os12694-tbl-0001"}}, {"id": "asset:table:pmid:32558266:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0e42d0d2fd9dcf4ff616457d596d021128b3aa95ba6bf9a43e1c16b31f8295f1", "bytes": 2273, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#os12694-tbl-0002", "version": null, "note": "KEGG pathway and Gene Ontology (GO)‐Biological Process (BP) analysis results of differentially expressed genes (DEGs)", "structure": {"pmcid": "PMC7454216", "section_index": 14, "section_title": "DEG Functional Enrichment Results", "row_count": 24, "column_count": 6}, "table": {"label": "TABLE 2", "caption": "KEGG pathway and Gene Ontology (GO)‐Biological Process (BP) analysis results of differentially expressed genes (DEGs)", "rows": [["", "ID", "Name", "Count", "P Value", "Gene"], ["Up‐regulated genes"], ["Pathway", "hsa04115", "p53 signaling pathway", "3", "3.04E‐03", "DDB2;STEAP3;CCNG2"], ["hsa04068", "FoxO signaling pathway", "3", "1.84E‐02", "FBXO32;RBL2;CCNG2"], ["hsa04022", "cGMP‐PKG signaling pathway", "3", "3.64E‐02", "GTF2I;PRKG1;PDE5A"], ["GO‐BP", "GO:0006357", "regulation of transcription from RNA polymerase II promoter", "8", "4.06E‐03", "CAMTA2, TSHZ1, ANKRA2, RBL2, GTF2I, TFDP2, VEZF1, BRD8"], ["GO:0006633", "fatty acid biosynthetic process", "3", "2.37E‐02", "ELOVL4, FAXDC2, CBR4"], ["GO:0006091", "generation of precursor metabolites and energy", "3", "2.46E‐02", "FECH, SLC25A27, DHTKD1"], ["GO:0007264", "small GTPase mediated signal transduction", "5", "2.65E‐02", "PLD2, RASL11A, ARL17A, RALBP1, DOCK11"], ["GO:0007165", "signal transduction", "11", "3.88E‐02", "RAP2B, RALBP1, GTF2I, PPP2R5D, PKIG, PDE5A, MCC, PRKG1, BRD8, DAPK1, DTNA"], ["Down‐regulated genes"], ["Pathway", "hsa04141", "Protein processing in endoplasmic reticulum", "4", "2.78E‐03", "ERO1A;STT3A;DERL1;TXNDC5"], ["hsa05020", "Prion diseases", "2", "7.98E‐03", "LAMC1;MAP2K1"], ["hsa05110", "Vibrio cholerae infection", "2", "1.58E‐02", "KDELR2;ERO1A"], ["hsa00510", "N‐Glycan biosynthesis", "2", "1.64E‐02", "STT3A;MGAT5"], ["hsa00590", "Arachidonic acid metabolism", "2", "2.20E‐02", "PTGS1;CBR1"], ["hsa04610", "Complement and coagulation cascades", "2", "3.24E‐02", "A2M;MBL2"], ["hsa05222", "Small cell lung cancer", "2", "4.25E‐02", "LAMC1;TRAF3"], ["GO‐BP", "GO:0006457", "protein folding", "4", "2.65E‐02", "GRPEL1, ERO1A, TXNDC5, PDIA6"], ["GO:0034976", "response to endoplasmic reticulum stress", "3", "2.95E‐02", "ERO1A, TXNDC5, PDIA6"], ["GO:0022617", "extracellular matrix disassembly", "3", "3.02E‐02", "A2M, LAMC1, CTSG"], ["GO:0045454", "cell redox homeostasis", "3", "3.10E‐02", "ERO1A, TXNDC5, PDIA6"], ["GO:0019371", "cyclooxygenase pathway", "2", "3.52E‐02", "CBR1, PTGS1"], ["GO:0034975", "protein folding in endoplasmic reticulum", "2", "4.55E‐02", "ERO1A, EMC1"]], "row_count": 24, "column_count": 6, "numeric_cells": 67, "header_rows": 1, "locator": "section[14]/table-wrap[1]#os12694-tbl-0002"}}, {"id": "asset:table:pmid:32558266:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5891e754773bcdbc9687d3d4f77f5ca05834bf28389e4dbd81796eb93436f032", "bytes": 948, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#os12694-tbl-0003", "version": null, "note": "KEGG pathway enriched by differentially expressed genes (DEGs) in the sub‐network module", "structure": {"pmcid": "PMC7454216", "section_index": 15, "section_title": "The PPI Network and Sub‐Network Modules", "row_count": 10, "column_count": 5}, "table": {"label": "TABLE 3", "caption": "KEGG pathway enriched by differentially expressed genes (DEGs) in the sub‐network module", "rows": [["ID", "Name", "Count", "P Value", "Genes"], ["hsa04068", "FoxO signaling pathway", "3", "2.17E‐04", "MAP2K1;RBL2;CCNG2"], ["hsa04730", "Long‐term depression", "2", "1.53E‐03", "PRKG1;MAP2K1"], ["hsa04540", "Gap junction", "2", "3.45E‐03", "PRKG1;MAP2K1"], ["hsa04270", "Vascular smooth muscle contraction", "2", "5.98E‐03", "PRKG1;MAP2K1"], ["hsa04919", "Thyroid hormone signaling pathway", "2", "6.09E‐03", "MAP2K1;KAT2B"], ["hsa04022", "cGMP‐PKG signaling pathway", "2", "1.16E‐02", "PRKG1;MAP2K1"], ["hsa05203", "Viral carcinogenesis", "2", "1.50E‐02", "RBL2;KAT2B"], ["hsa04010", "MAPK signaling pathway", "2", "2.53E‐02", "DUSP6;MAP2K1"], ["hsa04151", "PI3K‐Akt signaling pathway", "2", "4.45E‐02", "MAP2K1;RBL2"]], "row_count": 10, "column_count": 5, "numeric_cells": 27, "header_rows": 1, "locator": "section[15]/table-wrap[1]#os12694-tbl-0003"}}], "gaps": []}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differential expression analysis was conducted using the classical Bayesian method from the limma package (Version 3.10.3, http://www.bioconductor.org/packages/2.9/bioc/html/limma.html)."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": [], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:32558266", "asset:table:pmid:32558266:1", "asset:table:pmid:32558266:2", "asset:table:pmid:32558266:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:04:17Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 23410, "completion_tokens": 1349, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32558266", "type": "paper", "label": "pmid:32558266"}, {"id": "source:pmid:32558266", "type": "manuscript", "label": "PMID 32558266 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32558266", "type": "paper", "label": "pmid:32558266"}, {"id": "source:pmid:32558266", "type": "manuscript", "label": "PMID 32558266 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32558266", "type": "extraction", "used": ["source:pmid:32558266"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32558266", "parent_hash": "sha256:2867822d2c66965163f72aa96afd00e40c9fd149b3ffb6b94885029df5774f88", "fork_of": null, "generation": 7}, "gaps": ["execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["hub DEGs were evaluated by quantitative PCR (qPCR) and immunohistochemical staining. RESULTS:", "SP6, and KAT2B were successfully verified by qPCR. In addition, PRKG1 protein levels were foun"], "order_basis": "paper_text_order:908", "id": "assay:1"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ere evaluated by quantitative PCR (qPCR) and immunohistochemical staining. RESULTS: A total of 188 DEGs inclu", "levels were found to be elevated during the immunohistochemical analysis. CONCLUSION: Increased expression o"], "order_basis": "paper_text_order:918", "id": "assay:2"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Differential expression analysis was conducted using the classical Bayesian method from the limma package (Version 3.10.3, http://www.bioconductor.org/packages/2.9/bioc/html/limma.html)."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}