A novel prognostic signature of immune-related genes for patients with colorectal cancer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32564470", "kind": "science-record", "revision": 7, "content_hash": "sha256:1130591986fe36a7be0443786bfe450f39254d939d6070adb2ed3210e2ca8a22", "created_at": "2026-11-01T15:41:03Z", "updated_at": "2026-11-01T22:01:46Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "A novel prognostic signature of immune-related genes for patients with colorectal cancer.", "doi": "10.1111/jcmm.15443", "pmid": "32564470", "authors": ["Jun Wang", "Shaojun Yu", "Guofeng Chen", "Muxing Kang", "Xiaoli Jin", "Yi Huang", "Lele Lin", "Dan Wu", "Lie Wang", "Jian Chen"], "journal": "Journal of cellular and molecular medicine", "year": 2020, "abstract": "Colorectal cancer (CRC) is one of the most commonly diagnosed cancers with an estimated 1.8 million new cases worldwide and associated with high mortality rates of 881 000 CRC-related deaths in 2018. Screening programs and new therapies have only marginally improved the survival of CRC patients. Immune-related genes (IRGs) have attracted attention in recent years as therapeutic targets. The aim of this study was to identify an immune-related prognostic signature for CRC. To this end, we combined gene expression and clinical data from the CRC data sets of The Cancer Genome Atlas (TCGA) into an integrated immune landscape profile. We identified a total of 476 IRGs that were differentially expressed in CRC vs normal tissues, of which 18 were survival related according to univariate Cox analysis. Stepwise multivariate Cox proportional hazards analysis established an immune-related prognostic signature consisting of SLC10A2, FGF2, CCL28, NDRG1, ESM1, UCN, UTS2 and TRDC. The predictive ability of this signature for 3- and 5-year overall survival was determined using receiver operating characteristics (ROC), and the respective areas under the curve (AUC) were 79.2% and 76.6%. The signature showed moderate predictive accuracy in the validation and GSE38832 data sets as well. Furthermore, the 8-IRG signature correlated significantly with tumour stage, invasion, lymph node metastasis and distant metastasis by univariate Cox analysis, and was established an independent prognostic factor by multivariate Cox regression analysis for CRC. Gene set enrichment analysis (GSEA) revealed a relationship between the IRG prognostic signature and various biological pathways. Focal adhesions and ECM-receptor interactions were positively correlated with the risk scores, while cytosolic DNA sensing and metabolism-related pathways were negatively correlated. Finally, the bioinformatics results were validated by real-time RT-qPCR. In conclusion, we identified and validated a novel, immune-related prognostic signature for patients with CRC, and this signature reflects the dysregulated tumour immune microenvironment and has a potential for better CRC patient management.", "claims": [{"id": "claim-data-access", "statement": "All data generated or analysed during this study are included in this published article and its supplementary information files.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32564470", "locator": "sections[25] \"DATA AVAILABILITY STATEMENT\" paragraph 2", "quote": "All data generated or analysed during this study are included in this published article and its supplementary information files."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32564470"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE38832"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:group_comparison_wilcoxon", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE38832"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:group_comparison_wilcoxon"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32564470", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/jcmm.15443", "sha256": "sha256:813d984228275c67d34bc45bc43357acd54f5941c395d31944981a87ea9a440d", "bytes": 43306, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/jcmm.15443", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7412433", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE38832", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38832", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE38832", "version": null, "note": "All data generated or analysed during this study are included in this published article and its supplementary information files.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analysed during this study are included in this published article and its supplementary information files.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM950411", "GSM950412", "GSM950413", "GSM950414", "GSM950415", "GSM950416", "GSM950417", "GSM950418", "GSM950419", "GSM950420", "GSM950421", "GSM950422", "GSM950423", "GSM950424", "GSM950425", "GSM950426", "GSM950427", "GSM950428", "GSM950429", "GSM950430", "GSM950431", "GSM950432", "GSM950433", "GSM950434", "GSM950435", "GSM950436", "GSM950437", "GSM950438", "GSM950439", "GSM950440", "GSM950441", "GSM950442", "GSM950443", "GSM950444", "GSM950445", "GSM950446", "GSM950447", "GSM950448", "GSM950449", "GSM950450", "GSM950451", "GSM950452", "GSM950453", "GSM950454", "GSM950455", "GSM950456", "GSM950457", "GSM950458", "GSM950459", "GSM950460", "GSM950461", "GSM950462", "GSM950463", "GSM950464", "GSM950465", "GSM950466", "GSM950467", "GSM950468", "GSM950469", "GSM950470", "GSM950471", "GSM950472", "GSM950473", "GSM950474", "GSM950475", "GSM950476", "GSM950477", "GSM950478", "GSM950479", "GSM950480", "GSM950481", "GSM950482", "GSM950483", "GSM950484", "GSM950485", "GSM950486", "GSM950487", "GSM950488", "GSM950489", "GSM950490", "GSM950491", "GSM950492", "GSM950493", "GSM950494", "GSM950495", "GSM950496", "GSM950497", "GSM950498", "GSM950499", "GSM950500", "GSM950501", "GSM950502", "GSM950503", "GSM950504", "GSM950505", "GSM950506", "GSM950507", "GSM950508", "GSM950509", "GSM950510", "GSM950511", "GSM950512", "GSM950513", "GSM950514", "GSM950515", "GSM950516", "GSM950517", "GSM950518", "GSM950519", "GSM950520", "GSM950521", "GSM950522", "GSM950523", "GSM950524", "GSM950525", "GSM950526", "GSM950527", "GSM950528", "GSM950529", "GSM950530", "GSM950531", "GSM950532"], "sample_count": 122, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "NFAT transcriptional activity is associated with metastatic capacity in colon cancer", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32564470:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ac9e7e17b8681ff828457c2869873be4d2458a44d486520f62d6f867036153fa", "bytes": 613, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#jcmm15443-tbl-0001", "version": null, "note": "The information of primers used in real‐time RT–PCR", "structure": {"pmcid": "PMC7412433", "section_index": 10, "section_title": "Real‐time quantitative polymerase chain reaction (RT‑qPCR)", "row_count": 7, "column_count": 5}, "table": {"label": "TABLE 1", "caption": "The information of primers used in real‐time RT–PCR", "rows": [["Gene", "Sequences of primers", "Accession No.", "Tm (°C)", "Amplicon (bp)"], ["SLC10A2", "FOR: AGGTGCCGAACGGTTGCTT", "NM_000452.2", "60°C", "113"], ["REV: AGCGGGAAGGTGAATACGACA", "60°C"], ["ESM1", "FOR: CTTGCTACCGCACAGTCTCA", "NM_001135604.2", "60°C", "124"], ["REV: GCCATGTCATGCTCTTTGCAG", "60°C"], ["GAPDH", "FOR: GGAAGCTTGTCATCAATGGAAATC", "NM_002046", "60°C", "168"], ["REV: TGATGACCCTTTTGGCTCCC", "60°C"]], "row_count": 7, "column_count": 5, "numeric_cells": 13, "header_rows": 1, "locator": "section[10]/table-wrap[1]#jcmm15443-tbl-0001"}}, {"id": "asset:table:pmid:32564470:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a505eed2c3c26ebad69638b484478f987e0e69412fbb3140ddd6a47a7a0ae525", "bytes": 863, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#jcmm15443-tbl-0002", "version": null, "note": "The results of stepwise multivariate Cox proportional hazards model", "structure": {"pmcid": "PMC7412433", "section_index": 13, "section_title": "Construction of an immune‐gene expression signature in CRC", "row_count": 9, "column_count": 7}, "table": {"label": "TABLE 2", "caption": "The results of stepwise multivariate Cox proportional hazards model", "rows": [["Gene symbol", "Coef", "HR", "HR.95L", "HR.95H", "P‐value", "Regulation"], ["SLC10A2", "0.638812", "1.89423", "1.202826", "2.983063", ".005834", "Down"], ["FGF2", "0.386611", "1.471984", "1.234656", "1.754931", "1.63E‐05", "Down"], ["CCL28", "−0.09426", "0.910051", "0.851113", "0.973069", ".005796", "Down"], ["NDRG1", "0.011524", "1.011591", "1.003183", "1.020069", ".006806", "Down"], ["ESM1", "0.124352", "1.132414", "1.057736", "1.212365", ".000354", "Up"], ["UCN", "0.377663", "1.458871", "1.157773", "1.838275", ".001364", "Up"], ["UTS2", "0.254362", "1.289639", "1.028137", "1.617652", ".02781", "Up"], ["TRDC", "0.129341", "1.138078", "1.015503", "1.275449", ".026111", "Down"]], "row_count": 9, "column_count": 7, "numeric_cells": 44, "header_rows": 1, "locator": "section[13]/table-wrap[1]#jcmm15443-tbl-0002"}}, {"id": "asset:table:pmid:32564470:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c9ed8b6a60258bc7d2c01404981502d0792c716f6bbc27cf304075f2efb4e3e5", "bytes": 902, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#jcmm15443-tbl-0003", "version": null, "note": "The univariate and multivariate Cox analysis for risk signature and clinical factors", "structure": {"pmcid": "PMC7412433", "section_index": 15, "section_title": "The IRG signature confers additional prognostic power for CRC patients", "row_count": 9, "column_count": 5}, "table": {"label": "TABLE 3", "caption": "The univariate and multivariate Cox analysis for risk signature and clinical factors", "rows": [["Factors", "Univariate Cox analysis", "Multivariate Cox analysis"], ["Hazard ratio (95% CI)", "P‐value", "Hazard ratio (95% CI)", "P‐value"], ["Age", "1.036 (1.012‐1.061)", ".003", "1.050 (1.024‐1.075)", "<.0001"], ["Gender", "0.991 (0.614‐1.600)", ".972", "0.723 (0.436‐1.197)", ".207"], ["pStage", "2.597 (1.964‐3.434)", "<.0001", "1.545 (0.644‐3.707)", ".330"], ["pT", "3.554 (2.195‐5.753)", "<.0001", "2.394 (1.367‐4.192)", ".002"], ["pN", "2.249 (1.696‐2.982)", "<.0001", "1.163 (0.706‐1.917)", ".553"], ["pM", "5.440 (3.334‐8.877)", "<.0001", "1.553 (0.468‐5.159)", ".472"], ["Risk score", "2.205 (1.775‐2.739)", "<.0001", "1.849 (1.473‐2.320)", "<.0001"]], "row_count": 9, "column_count": 5, "numeric_cells": 30, "header_rows": 2, "locator": "section[15]/table-wrap[1]#jcmm15443-tbl-0003"}}], "gaps": ["asset:data:geo:GSE38832 not downloaded", "asset:data:geo:GSE38832 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "wilcoxon", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Wilcoxon"}}, {"id": "method-2", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Cox proportional hazards"}}, {"id": "method-3", "family": "correlation_analysis", "specific": "spearman", "label": "Correlation analysis", "dsl_operations": ["spearman_rho"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Spearman correlation"}}, {"id": "method-4", "family": null, "specific": null, "label": "Univariate Cox analysis", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The survival‐related IRGs were identified by univariate Cox analysis with the survival R package (P < .05)."}}], "targets": [], "gaps": ["method.reader_named_unmapped", "method.group_comparison_wilcoxon"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: wilcoxon."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE38832"], "resolved_accessions": ["GSE38832"], "statements": ["All data generated or analysed during this study are included in this published article and its supplementary information files."], "basis": "The paper names GSE38832 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32564470", "data:geo:GSE38832", "asset:table:pmid:32564470:1", "asset:table:pmid:32564470:2", "asset:table:pmid:32564470:3"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "group_comparison_wilcoxon", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE38832"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:20:28Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 33425, "completion_tokens": 1490, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32564470", "type": "paper", "label": "pmid:32564470"}, {"id": "source:pmid:32564470", "type": "manuscript", "label": "PMID 32564470 full text"}, {"id": "data:geo:GSE38832", "type": "dataset", "label": "GEO GSE38832"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32564470", "type": "paper", "label": "pmid:32564470"}, {"id": "source:pmid:32564470", "type": "manuscript", "label": "PMID 32564470 full text"}, {"id": "data:geo:GSE38832", "type": "dataset", "label": "GEO GSE38832"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32564470", "type": "extraction", "used": ["source:pmid:32564470"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE38832", "type": "accession_resolution", "used": ["data:geo:GSE38832"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32564470", "parent_hash": "sha256:7e542e7c3227145532b9a2f18576bdaa916f1360478696114fca77e1a278cf6a", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE38832 licence not read", "asset:data:geo:GSE38832 not downloaded", "execution.not_run", "method.group_comparison_wilcoxon", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:group_comparison_wilcoxon"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ormatics results were validated by real-time RT-qPCR. In conclusion, we identified and validated", "atics results were validated by real-time RT-qPCR. In conclusion, we identified and validated"], "order_basis": "paper_text_order:1972", "id": "assay:1"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Wilcoxon"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}