Integrated microarray analysis to identify potential biomarkers and therapeutic targets in dilated cardiomyopathy.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32626989", "kind": "science-record", "revision": 7, "content_hash": "sha256:9ec3072b6865c23855d293d97c8c76e2d3d94badca7a498fc2fc9685404908d2", "created_at": "2026-11-01T15:41:05Z", "updated_at": "2026-11-01T22:01:52Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Integrated microarray analysis to identify potential biomarkers and therapeutic targets in dilated cardiomyopathy.", "doi": "10.3892/mmr.2020.11145", "pmid": "32626989", "authors": ["Hao Zhang", "Junyu Huo", "Wanying Jiang", "Qijun Shan"], "journal": "Molecular medicine reports", "year": 2020, "abstract": "Dilated cardiomyopathy (DCM) is a primary cardiomyopathy with high mortality. The aim of the present study was to identify the related genes in DCM. The four expression profiles (GSE17800, GSE21610, GSE42955 and GSE79962) downloaded from the Gene Expression Omnibus (GEO) database were analyzed using RankProd and metaMA R packages to identify differentially expressed genes (DEGs). DEGs were uploaded to the Database for Annotation, Visualization and Integrated Discovery (DAVID), for Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. A protein‑protein interaction (PPI) network of the DEGs was constructed using the STRING database. In addition, hub genes were identified using the Cytoscape plugin cytoHubba. A mouse DCM model, which established via intraperitoneal injection with doxorubicin (DOX), was used to validate the hub genes. A total of 898 DEGs were identified across the four microarrays. Furthermore, GO analysis demonstrated that these DEGs were mainly enriched in cell adhesion, negative regulation of cell proliferation, negative regulation of apoptotic process and potassium ion transport. In addition, KEGG analysis revealed that DEGs were mainly enriched in the ECM‑receptor interaction, the p53 signaling pathway, cardiac muscle contraction and the hypoxia‑inducible factor signaling pathway. Proenkephalin (PENK), chordin like 1 (CHRDL1), calumenin (CALU), apolipoprotein L1, insulin‑like growth factor binding protein 3 (IGFBP3) and ceruloplasmin (CP) were identified as hub genes in the PPI network. Furthermore, the expression levels of PENK, CHRDL1, IGFBP3, CP and CALU in hearts with DCM were validated using a mouse model. In conclusion, the present study identified six hub genes related to DCM. Therefore, the present results may provide a potential mechanism for DCM involving these hub genes, which may serve as biomarkers for screening and diagnosis in the clinic.", "claims": [{"id": "claim-method", "statement": "The merged expression matrix was processed using metaMA and RankProd according to the reference manuals, and overlapping genes from the two methods were deemed as DEGs.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32626989", "locator": "sections[5] \"Meta-analysis of DEGs\" paragraph 2", "quote": "The merged expression matrix was processed using metaMA and RankProd according to the reference manuals, and overlapping genes from the two methods were deemed as DEGs."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All data generated or analyzed during this study are included in this published article.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32626989", "locator": "sections[24] \"Availability of data and materials\" paragraph 2", "quote": "All data generated or analyzed during this study are included in this published article."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32626989"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE17800"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE17800"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32626989", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3892/mmr.2020.11145", "sha256": "sha256:64092d99a647a462f00cc853982775c71b079d1c927b0ad7bbae2fb8246d0e1e", "bytes": 44758, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3892/mmr.2020.11145", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7339620", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE17800", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE17800", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE17800", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM444224", "GSM444226", "GSM444228", "GSM444230", "GSM444232", "GSM444234", "GSM444236", "GSM444238", "GSM444240", "GSM444242", "GSM444244", "GSM444246", "GSM444248", "GSM444250", "GSM444252", "GSM444254", "GSM444256", "GSM444258", "GSM444260", "GSM444262", "GSM444264", "GSM444266", "GSM444268", "GSM444270", "GSM444272", "GSM444274", "GSM444276", "GSM444278", "GSM444280", "GSM444282", "GSM444284", "GSM444286", "GSM444288", "GSM444289", "GSM444290", "GSM444291", "GSM444292", "GSM444293", "GSM444294", "GSM444295", "GSM444296", "GSM444297", "GSM444298", "GSM444299", "GSM444300", "GSM444301", "GSM444302", "GSM444303"], "sample_count": 48, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Myocardial gene expression profiles and cardiodepressant autoantibodies predict response of patients with dilated cardiomyopathy to immunoadsorption therapy", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE21610", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE21610", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE21610", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM545657", "GSM545658", "GSM545659", "GSM545660", "GSM545661", "GSM545662", "GSM545663", "GSM545664", "GSM545665", "GSM545666", "GSM545667", "GSM545668", "GSM545669", "GSM545670", "GSM545671", "GSM545672", "GSM545673", "GSM545674", "GSM545675", "GSM545676", "GSM545677", "GSM545678", "GSM545679", "GSM545680", "GSM545681", "GSM545682", "GSM545683", "GSM545684", "GSM545685", "GSM545686", "GSM545687", "GSM545688", "GSM545689", "GSM545690", "GSM545691", "GSM545692", "GSM545693", "GSM545694", "GSM545695", "GSM545696", "GSM545697", "GSM545698", "GSM545699", "GSM545700", "GSM545701", "GSM545702", "GSM545703", "GSM545704", "GSM545705", "GSM545706", "GSM545707", "GSM545708", "GSM545709", "GSM545710", "GSM545711", "GSM545712", "GSM545713", "GSM545714", "GSM545715", "GSM545716", "GSM545717", "GSM545718", "GSM545719", "GSM545720", "GSM545721", "GSM545722", "GSM545723", "GSM545724"], "sample_count": 68, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression analysis in non-failing and failing myocardium pre and post pulsatile and non-pulsatile VAD support", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE3585", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE3585", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE3585", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM82381", "GSM82382", "GSM82383", "GSM82384", "GSM82385", "GSM82386", "GSM82387", "GSM82388", "GSM82389", "GSM82390", "GSM82391", "GSM82392"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Dilated Cardiomyopathy and Non Failing Biopsies", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE42955", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE42955", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE42955", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1053914", "GSM1053915", "GSM1053916", "GSM1053917", "GSM1053918", "GSM1053919", "GSM1053920", "GSM1053921", "GSM1053922", "GSM1053923", "GSM1053924", "GSM1053925", "GSM1053926", "GSM1053927", "GSM1053928", "GSM1053929", "GSM1053930", "GSM1053931", "GSM1053932", "GSM1053933", "GSM1053934", "GSM1053935", "GSM1053936", "GSM1053937", "GSM1053938", "GSM1053939", "GSM1053940", "GSM1053941", "GSM1053942"], "sample_count": 29, "group_sizes": null, "group_sizes_basis": null, "platform": "6244", "taxon": "Homo sapiens", "title": "Expression data from human heart", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE79962", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE79962", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE79962", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2109130", "GSM2109131", "GSM2109132", "GSM2109133", "GSM2109134", "GSM2109135", "GSM2109136", "GSM2109137", "GSM2109138", "GSM2109139", "GSM2109140", "GSM2109141", "GSM2109142", "GSM2109143", "GSM2109144", "GSM2109145", "GSM2109146", "GSM2109147", "GSM2109148", "GSM2109149", "GSM2109150", "GSM2109151", "GSM2109152", "GSM2109153", "GSM2109154", "GSM2109155", "GSM2109156", "GSM2109157", "GSM2109158", "GSM2109159", "GSM2109160", "GSM2109161", "GSM2109162", "GSM2109163", "GSM2109164", "GSM2109165", "GSM2109166", "GSM2109167", "GSM2109168", "GSM2109169", "GSM2109170", "GSM2109171", "GSM2109172", "GSM2109173", "GSM2109174", "GSM2109175", "GSM2109176", "GSM2109177", "GSM2109178", "GSM2109179", "GSM2109180"], "sample_count": 51, "group_sizes": null, "group_sizes_basis": null, "platform": "6244", "taxon": "Homo sapiens", "title": "Widespread downregulation of cardiac mitochondrial and sarcomeric genes in patients with sepsis", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32626989:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ab50e3d2c96fc00f0a41ed2d2b8d667119ffc921f682262e7a7be4b1b86fb319", "bytes": 799, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#tI-mmr-22-02-0915", "version": null, "note": "Details of the microarrays used.", "structure": {"pmcid": "PMC7339620", "section_index": 4, "section_title": "Raw transcriptional data acquisition and preprocessing", "row_count": 6, "column_count": 5}, "table": {"label": "Table I.", "caption": "Details of the microarrays used.", "rows": [["GEO series number", "Control", "DCM", "Tissue", "Platform"], ["GSE17800", "8", "40", "Myocardium", "GPL570,[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array"], ["GSE21610", "8", "21", "Myocardium", "GPL570,[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array"], ["GSE42955", "5", "12", "Myocardium", "GPL6244,[HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version]"], ["GSE79962", "11", "9", "Myocardium", "GPL6244,[HuGene-1_0-st] Affymetrix Human Gene 1.0 ST Array [transcript (gene) version]"], ["GSE3585", "5", "7", "Myocardium", "GPL96,[HG-U133A] Affymetrix Human Genome U133A Array"]], "row_count": 6, "column_count": 5, "numeric_cells": 20, "header_rows": 1, "locator": "section[4]/table-wrap[1]#tI-mmr-22-02-0915"}}, {"id": "asset:table:pmid:32626989:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5d9d96e48763f9dc81be537aa5e9b92363dd17e76e4f0cabd17c0c9a6eaa41b0", "bytes": 592, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#tII-mmr-22-02-0915", "version": null, "note": "Primer sequences.", "structure": {"pmcid": "PMC7339620", "section_index": 11, "section_title": "RNA extraction and RT-qPCR", "row_count": 7, "column_count": 3}, "table": {"label": "Table II.", "caption": "Primer sequences.", "rows": [["Gene", "Forward (5′→3′)", "Reverse (5′→3′)"], ["PENK", "GGACTGCGCTAAATGCAGCTA", "GAAGCCTCCGTACCGTTTCAT"], ["CHRDL1", "AACCTCCAAGCCAAAACTTTGA", "CCAGTGCTACTTTTCTGGTTGTC"], ["CALU", "AATGCTGATGGGTTCATTGATCT", "GGTTCTTATCTCGAAACTCCACG"], ["IGFBP3", "CACACCGAGTGACCGATTCC", "GTGTCTGTGCTTTGAGACTCAT"], ["CP", "CTTAGCCTTGGCAAGAGATAAGC", "GATGACAGGGCCTAAAAACCC"], ["Actb", "GGCTGTATTCCCCTCCATCG", "CCAGTTGGTAACAATGCCATGT"]], "row_count": 7, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[11]/table-wrap[1]#tII-mmr-22-02-0915"}}, {"id": "asset:table:pmid:32626989:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8ddbe1cb38fef0adc99598a8a60fded6280c901bbea71e63aeefdf69b00990b9", "bytes": 1270, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#tIII-mmr-22-02-0915", "version": null, "note": "Top 30 upregulated differentially expressed genes.", "structure": {"pmcid": "PMC7339620", "section_index": 15, "section_title": "Identification of DEGs between patients with DCM and healthy controls", "row_count": 31, "column_count": 3}, "table": {"label": "Table III.", "caption": "Top 30 upregulated differentially expressed genes.", "rows": [["Upregulated gene", "Fold change", "Percentage of false prediction"], ["NPPA", "5.57", "6.41×10−49"], ["NPPB", "4.60", "5.28×10−40"], ["SFRP4", "2.46", "2.61×10−25"], ["SMOC2", "2.28", "4.41×10−23"], ["HBB", "2.53", "1.40×10−22"], ["EIF1AY", "2.45", "1.82×10−22"], ["PHLDA1", "1.99", "4.61×10−22"], ["LTBP2", "2.06", "7.48×10−20"], ["THBS4", "2.05", "2.12×10−19"], ["FRZB", "2.07", "5.42×10−19"], ["POSTN", "1.91", "5.71×10−19"], ["MXRA5", "1.82", "1.01×10−18"], ["CCN2", "1.96", "6.47×10−18"], ["OMD", "2.00", "6.13×10−18"], ["TNNT1", "1.91", "1.12×10−17"], ["PRELP", "2.06", "1.34×10−17"], ["ASPN", "1.81", "5.31×10−17"], ["FMOD", "1.94", "7.19×10−17"], ["CCDC80", "1.79", "1.42×10−16"], ["RGS4", "1.84", "1.04×10−15"], ["SERPINE2", "1.70", "2.58×10−15"], ["USP9Y", "1.68", "2.78×10−15"], ["STAT4", "1.90", "2.77×10−15"], ["PLCE1", "1.75", "2.67×10−15"], ["UCHL1", "1.80", "3.19×10−15"], ["OGN", "1.74", "1.08×10−14"], ["HSPA2", "1.72", "2.10×10−14"], ["NAP1L3", "1.77", "3.88×10−14"], ["MFAP4", "1.68", "4.80×10−14"], ["JAK2", "1.70", "1.27×10−13"]], "row_count": 31, "column_count": 3, "numeric_cells": 61, "header_rows": 1, "locator": "section[15]/table-wrap[1]#tIII-mmr-22-02-0915"}}, {"id": "asset:table:pmid:32626989:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:438347af2cda44f4e4ee7b4c9f2331d1b354e178d7751cb483599dd4f58dc620", "bytes": 1284, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[2]#tIV-mmr-22-02-0915", "version": null, "note": "Top 30 downregulated differentially expressed genes.", "structure": {"pmcid": "PMC7339620", "section_index": 15, "section_title": "Identification of DEGs between patients with DCM and healthy controls", "row_count": 31, "column_count": 3}, "table": {"label": "Table IV.", "caption": "Top 30 downregulated differentially expressed genes.", "rows": [["Downregulated gene", "Fold change", "Percentage of false prediction"], ["MYH6", "0.32", "2.33×10−38"], ["ETNPPL", "0.39", "6.74×10−29"], ["SERPINA3", "0.38", "1.88×10−27"], ["DHRS7C", "0.45", "1.51×10−25"], ["AQP4", "0.52", "1.29×10−20"], ["CCL2", "0.47", "1.89×10−17"], ["LYVE1", "0.58", "2.19×10−16"], ["LSAMP", "0.53", "2.69×10−16"], ["DLK1", "0.53", "6.81×10−16"], ["CORIN", "0.53", "1.04×10−15"], ["HOPX", "0.55", "1.92×10−15"], ["CA14", "0.55", "4.94×10−15"], ["RARRES1", "0.54", "8.04×10−15"], ["CD163", "0.62", "9.97×10−15"], ["KCNIP2", "0.60", "1.01×10−14"], ["C1orf105", "0.57", "1.20×10−14"], ["CD14", "0.56", "3.45×10−14"], ["F13A1", "0.61", "1.53×10−13"], ["F5", "0.82", "2.01×10−13"], ["TOGARAM2", "0.60", "2.15×10−13"], ["CPNE4", "0.59", "2.05×10−12"], ["AQP3", "0.62", "4.89×10−12"], ["VSIG4", "0.67", "1.31×10−11"], ["HEY2", "0.63", "5.73×10−11"], ["PLIN2", "0.62", "6.50×10−11"], ["SELE", "0.57", "1.46×10−10"], ["ADAMTS9", "0.63", "1.71×10−10"], ["NAMPT", "0.65", "1.90×10−10"], ["SLCO5A1", "0.60", "2.63×10−10"], ["HINT3", "0.60", "9.40×10−10"]], "row_count": 31, "column_count": 3, "numeric_cells": 65, "header_rows": 1, "locator": "section[15]/table-wrap[2]#tIV-mmr-22-02-0915"}}, {"id": "asset:table:pmid:32626989:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fcb8e582938df4296789acd24a7548307489ec0bb8a58613acfa919b410dc97c", "bytes": 784, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#tV-mmr-22-02-0915", "version": null, "note": "Topological properties of hub genes.", "structure": {"pmcid": "PMC7339620", "section_index": 19, "section_title": "Construction of the PPI network, and identification of important modules and hub genes", "row_count": 7, "column_count": 8}, "table": {"label": "Table V.", "caption": "Topological properties of hub genes.", "rows": [["Hub gene", "Degree", "MCC", "DMNC", "MNC", "Fold change", "Percentage of false prediction", "Expression change"], ["PENK", "19", "8.72×1010", "1.02476", "14", "1.71", "8.04×10−13", "Upregulated"], ["CHRDL1", "16", "8.72×1010", "1.02476", "14", "1.31", "8.04×10−6", "Upregulated"], ["CALU", "16", "8.72×1010", "0.92137", "15", "0.84", "1.85×10−2", "Downregulated"], ["APOL1", "15", "8.72×1010", "0.92137", "15", "0.77", "5.89×10−3", "Downregulated"], ["IGFBP3", "15", "8.72×1010", "0.92137", "15", "1.37", "9.86×10−6", "Upregulated"], ["CP", "15", "8.72×1010", "1.02476", "14", "1.32", "2.98×10−6", "Upregulated"]], "row_count": 7, "column_count": 8, "numeric_cells": 36, "header_rows": 1, "locator": "section[19]/table-wrap[1]#tV-mmr-22-02-0915"}}], "gaps": ["asset:data:geo:GSE17800 not downloaded", "asset:data:geo:GSE17800 licence not read", "asset:data:geo:GSE21610 not downloaded", "asset:data:geo:GSE21610 licence not read", "asset:data:geo:GSE3585 not downloaded", "asset:data:geo:GSE3585 licence not read", "asset:data:geo:GSE42955 not downloaded", "asset:data:geo:GSE42955 licence not read", "asset:data:geo:GSE79962 not downloaded", "asset:data:geo:GSE79962 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "PPI"}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-3", "family": null, "specific": null, "label": "Meta-analysis of differentially expressed genes using metaMA and RankProd", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The merged expression matrix was processed using metaMA and RankProd according to the reference manuals, and overlapping genes from the two methods were deemed as DEGs."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE17800", "GSE21610", "GSE42955", "GSE79962", "GSE3585"], "resolved_accessions": ["GSE17800", "GSE21610", "GSE42955", "GSE79962", "GSE3585"], "statements": ["All data generated or analyzed during this study are included in this published article."], "basis": "The paper names GSE17800, GSE21610, GSE42955, GSE79962, GSE3585 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:32626989", "data:geo:GSE17800", "asset:table:pmid:32626989:1", "asset:table:pmid:32626989:2", "asset:table:pmid:32626989:3", "asset:table:pmid:32626989:4", "asset:table:pmid:32626989:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE17800"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:21:02Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 37536, "completion_tokens": 1284, "cached_tokens": 12680}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32626989", "type": "paper", "label": "pmid:32626989"}, {"id": "source:pmid:32626989", "type": "manuscript", "label": "PMID 32626989 full text"}, {"id": "data:geo:GSE17800", "type": "dataset", "label": "GEO GSE17800"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32626989", "type": "paper", "label": "pmid:32626989"}, {"id": "source:pmid:32626989", "type": "manuscript", "label": "PMID 32626989 full text"}, {"id": "data:geo:GSE17800", "type": "dataset", "label": "GEO GSE17800"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32626989", "type": "extraction", "used": ["source:pmid:32626989"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE17800", "type": "accession_resolution", "used": ["data:geo:GSE17800"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32626989", "parent_hash": "sha256:380c2e7e3a48982a7243d93beb6b5c48db53700f6ba43a9a57a40c91f54f6941", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE17800 licence not read", "asset:data:geo:GSE17800 not downloaded", "asset:data:geo:GSE21610 licence not read", "asset:data:geo:GSE21610 not downloaded", "asset:data:geo:GSE3585 licence not read", "asset:data:geo:GSE3585 not downloaded", "asset:data:geo:GSE42955 licence not read", "asset:data:geo:GSE42955 not downloaded", "asset:data:geo:GSE79962 licence not read", "asset:data:geo:GSE79962 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["Integrated microarray analysis to identify potential biomarkers an", "s. MetaMA (v 3.1.2) (13) is an R package for microarray DEG meta-analyses that uses moderated effect"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["LU in hearts with DCM were validated using a mouse model. In conclusion, the present study identified", "fied using the Cytoscape plugin cytoHubba. A mouse DCM model, which established via intraperito", "LU in hearts with DCM were validated using a mouse model. In conclusion, the present study iden", "and Use of Laboratory Animals (23). The DCM mouse model was established by intraperitoneal injection"], "order_basis": "paper_text_order:833", "id": "assay:2"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["PPI"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}