Identification of candidate genes in ischemic cardiomyopathy by gene expression omnibus database.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32631246", "kind": "science-record", "revision": 7, "content_hash": "sha256:4f7253cda7849b17a82add87b0ce69bcb7cbd6d75edb7fd1d27487eda0a29bf1", "created_at": "2026-11-01T15:41:05Z", "updated_at": "2026-11-01T22:01:52Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of candidate genes in ischemic cardiomyopathy by gene expression omnibus database.", "doi": "10.1186/s12872-020-01596-w", "pmid": "32631246", "authors": ["Haiming Dang", "Yicong Ye", "Xiliang Zhao", "Yong Zeng"], "journal": "BMC cardiovascular disorders", "year": 2020, "abstract": "BACKGROUND: Ischemic cardiomyopathy (ICM) is one of the most usual causes of death worldwide. This study aimed to find the candidate gene for ICM.\nMETHODS: We studied differentially expressed genes (DEGs) in ICM compared to healthy control. According to these DEGs, we carried out the functional annotation, protein-protein interaction (PPI) network and transcriptional regulatory network constructions. The expression of selected candidate genes were confirmed using a published dataset and Quantitative real time polymerase chain reaction (qRT-PCR).\nRESULTS: From three Gene Expression Omnibus (GEO) datasets, we acquired 1081 DEGs (578 up-regulated and 503 down-regulated genes) between ICM and healthy control. The functional annotation analysis revealed that cardiac muscle contraction, hypertrophic cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy and dilated cardiomyopathy were significantly enriched pathways in ICM. SNRPB, BLM, RRS1, CDK2, BCL6, BCL2L1, FKBP5, IPO7, TUBB4B and ATP1A1 were considered the hub proteins. PALLD, THBS4, ATP1A1, NFASC, FKBP5, ECM2 and BCL2L1 were top six transcription factors (TFs) with the most downstream genes. The expression of 6 DEGs (MYH6, THBS4, BCL6, BLM, IPO7 and SERPINA3) were consistent with our integration analysis and GSE116250 validation results.\nCONCLUSIONS: The candidate DEGs and TFs may be related to the ICM process. This study provided novel perspective for understanding mechanism and exploiting new therapeutic means for ICM.", "claims": [{"id": "claim-method", "statement": "MetaMA, an R package, is applied to combine data from three GEO datasets. The Benjamini & Hochberg (False discovery rate; FDR) were used to modulate the P-values.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32631246", "locator": "sections[4] \"Identification of DEGs\" paragraph 2", "quote": "MetaMA, an R package, is applied to combine data from three GEO datasets. The Benjamini & Hochberg (False discovery rate; FDR) were used to modulate the P-values."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32631246", "locator": "sections[25] \"Availability of data and materials\" paragraph 2", "quote": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32631246"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE116250"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE116250"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32631246", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12872-020-01596-w", "sha256": "sha256:1316e1c3a5e552b31d433965f7a337a34471b8bef4ace7c208b6a0544e3c5b1d", "bytes": 33752, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12872-020-01596-w", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7336680", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE116250", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE116250", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE116250", "version": null, "note": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3219558", "GSM3219559", "GSM3219560", "GSM3219561", "GSM3219562", "GSM3219563", "GSM3219564", "GSM3219565", "GSM3219566", "GSM3219567", "GSM3219568", "GSM3219569", "GSM3219570", "GSM3219571", "GSM3219572", "GSM3219573", "GSM3219574", "GSM3219575", "GSM3219576", "GSM3219577", "GSM3219578", "GSM3219579", "GSM3219580", "GSM3219581", "GSM3219582", "GSM3219583", "GSM3219584", "GSM3219585", "GSM3219586", "GSM3219587", "GSM3219588", "GSM3219589", "GSM3219590", "GSM3219591", "GSM3219592", "GSM3219593", "GSM3219594", "GSM3219595", "GSM3219596", "GSM3219597", "GSM3219598", "GSM3219599", "GSM3219600", "GSM3219601", "GSM3219602", "GSM3219603", "GSM3219604", "GSM3219605", "GSM3219606", "GSM3219607", "GSM3219608", "GSM3219609", "GSM3219610", "GSM3219611", "GSM3219612", "GSM3219613", "GSM3219614", "GSM3219615", "GSM3219616", "GSM3219617", "GSM3219618", "GSM3219619", "GSM3219620", "GSM3219621"], "sample_count": 64, "group_sizes": null, "group_sizes_basis": null, "platform": "16791", "taxon": "Homo sapiens", "title": "RNA-seq of heart failure in human left ventricles", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE46224", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE46224", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE46224", "version": null, "note": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1126612", "GSM1126613", "GSM1126614", "GSM1126615", "GSM1126616", "GSM1126617", "GSM1126618", "GSM1126619", "GSM1126620", "GSM1126621", "GSM1126622", "GSM1126623", "GSM1126624", "GSM1126625", "GSM1126626", "GSM1126627", "GSM1126628", "GSM1126629", "GSM1126630", "GSM1126631", "GSM1126632", "GSM1126633", "GSM1126634", "GSM1126635", "GSM1126636", "GSM1126637", "GSM1126638", "GSM1126639", "GSM1126640", "GSM1126641", "GSM1126642", "GSM1126643", "GSM1126644", "GSM1126645", "GSM1126646", "GSM1126647", "GSM1126648", "GSM1126649", "GSM1126650", "GSM1126651", "GSM1126652", "GSM1126653", "GSM1126654", "GSM1126655", "GSM1126656", "GSM1126657", "GSM1126658", "GSM1126659", "GSM1126660", "GSM1126661", "GSM1126662", "GSM1126663", "GSM1126664", "GSM1126665", "GSM1126666", "GSM1126667", "GSM1126668", "GSM1126669", "GSM1126670", "GSM1126671", "GSM1126672", "GSM1126673", "GSM1126674", "GSM1126675", "GSM1126676", "GSM1126677", "GSM1126678", "GSM1126679", "GSM1126680", "GSM1126681", "GSM1126682", "GSM1126683", "GSM1126684", "GSM1126685", "GSM1126686", "GSM1126687", "GSM1126688", "GSM1126689", "GSM1126690", "GSM1126691"], "sample_count": 80, "group_sizes": null, "group_sizes_basis": null, "platform": "11154", "taxon": "Homo sapiens", "title": "Deep RNA Sequencing Reveals Dynamic Regulation of Myocardial Noncoding RNA in Failing Human Heart and Remodeling with Mechanical Circulatory Support", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE52601", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE52601", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE52601", "version": null, "note": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1272369", "GSM1272370", "GSM1272371", "GSM1272372", "GSM1272373", "GSM1272374", "GSM1272375", "GSM1272376", "GSM1272377", "GSM1272378", "GSM1272379", "GSM1272380", "GSM1272381", "GSM1272382", "GSM1272383", "GSM1272384", "GSM1272385", "GSM1272386", "GSM1272387", "GSM1272388", "GSM1272389", "GSM1272390", "GSM1272391", "GSM1272392"], "sample_count": 24, "group_sizes": null, "group_sizes_basis": null, "platform": "10558", "taxon": "Homo sapiens", "title": "Comparative RNA-sequencing analysis of myocardial and circulating small RNAs in human heart failure and their utility as biomarkers [array]", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE5406", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE5406", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE5406", "version": null, "note": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM123518", "GSM123519", "GSM123520", "GSM123521", "GSM123522", "GSM123523", "GSM123524", "GSM123525", "GSM123526", "GSM123527", "GSM123528", "GSM123529", "GSM123530", "GSM123531", "GSM123532", "GSM123533", "GSM123534", "GSM123535", "GSM123536", "GSM123537", "GSM123538", "GSM123539", "GSM123540", "GSM123541", "GSM123542", "GSM123543", "GSM123544", "GSM123545", "GSM123546", "GSM123547", "GSM123548", "GSM123549", "GSM123550", "GSM123551", "GSM123552", "GSM123553", "GSM123554", "GSM123555", "GSM123556", "GSM123557", "GSM123558", "GSM123559", "GSM123560", "GSM123561", "GSM123562", "GSM123563", "GSM123564", "GSM123565", "GSM123566", "GSM123567", "GSM123568", "GSM123569", "GSM123570", "GSM123571", "GSM123572", "GSM123573", "GSM123574", "GSM123575", "GSM123576", "GSM123577", "GSM123578", "GSM123579", "GSM123580", "GSM123581", "GSM123582", "GSM123583", "GSM123584", "GSM123585", "GSM123586", "GSM123587", "GSM123588", "GSM123589", "GSM123590", "GSM123591", "GSM123592", "GSM123593", "GSM123594", "GSM123595", "GSM123596", "GSM123597", "GSM123598", "GSM123599", "GSM123600", "GSM123601", "GSM123602", "GSM123603", "GSM123604", "GSM123605", "GSM123606", "GSM123607", "GSM123608", "GSM123609", "GSM123610", "GSM123611", "GSM123612", "GSM123613", "GSM123614", "GSM123615", "GSM123616", "GSM123617", "GSM123618", "GSM123619", "GSM123620", "GSM123621", "GSM123622", "GSM123623", "GSM123624", "GSM123625", "GSM123626", "GSM123627", "GSM123628", "GSM123629", "GSM123630", "GSM123631", "GSM123632", "GSM123633", "GSM123634", "GSM123635", "GSM123636", "GSM123637", "GSM123638", "GSM123639", "GSM123640", "GSM123641", "GSM123642", "GSM123643", "GSM123644", "GSM123645", "GSM123646", "GSM123647", "GSM123648", "GSM123649", "GSM123650", "GSM123651", "GSM123652", "GSM123653", "GSM123654", "GSM123655", "GSM123656", "GSM123657", "GSM123658", "GSM123659", "GSM123660", "GSM123661", "GSM123662", "GSM123663", "GSM123664", "GSM123665", "GSM123666", "GSM123667", "GSM123668", "GSM123669", "GSM123670", "GSM123671", "GSM123672", "GSM123673", "GSM123674", "GSM123675", "GSM123676", "GSM123677", "GSM123678", "GSM123679", "GSM123680", "GSM123681", "GSM123682", "GSM123683", "GSM123684", "GSM123685", "GSM123686", "GSM123687", "GSM123688", "GSM123689", "GSM123690", "GSM123691", "GSM123692", "GSM123693", "GSM123694", "GSM123695", "GSM123696", "GSM123697", "GSM123698", "GSM123699", "GSM123700", "GSM123701", "GSM123702", "GSM123703", "GSM123704", "GSM123705", "GSM123706", "GSM123707", "GSM123708", "GSM123709", "GSM123710", "GSM123711", "GSM123712", "GSM123713", "GSM123714", "GSM123715", "GSM123716", "GSM123717", "GSM123718", "GSM123719", "GSM123720", "GSM123721", "GSM123722", "GSM123723", "GSM123724", "GSM123725", "GSM123726", "GSM123727"], "sample_count": 210, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Human ischemic cardiomyopathy, idiopathic cardiomyopathy, and nonfailing controls", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32631246:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9df14cd746275a0c7accd0fc47f34c8ab396e50d636a322b42d7b7d5468d773a", "bytes": 887, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#Tab1", "version": null, "note": "Baseline clinical characteristics of subjects", "structure": {"pmcid": "PMC7336680", "section_index": 9, "section_title": "Confirmation by qRT-PCR", "row_count": 16, "column_count": 4}, "table": {"label": "Table 1", "caption": "Baseline clinical characteristics of subjects", "rows": [["Characteristics", "ICM(n = 10)1", "Control (n = 10)1", "P value2"], ["Gender", "", "", "> 0.90"], ["Female", "5 (50%)", "5 (50%)", ""], ["Male", "5 (50%)", "5 (50%)", ""], ["Age", "60 (51,64)", "59 (58,62)", "0.80"], ["TC", "4.12 (3.83, 5.02)", "4.00 (3.76,4.33)", "0.70"], ["TG", "2 (1,3)", "1 (1,2)", "0.50"], ["HDL", "1.16 (0.78,1.24)", "1.04 (0.82,1.26)", "> 0.90"], ["LDL", "2.70 (2.02,3.14)", "2.57 (1.77,2.87)", "0.70"], ["Hypertension", "3 (30%)", "6 (60%)", "0.40"], ["Diabetes", "5 (50%)", "2 (20%)", "0.30"], ["Hyperlipidemia", "3 (30%)", "6 (60%)", "0.40"], ["Smoking", "7 (70%)", "4 (40%)", "0.40"], ["Drinking", "1 (10%)", "2 (20%)", "> 0.90"], ["HCT", "34 (31,41)", "39 (36,42)", "0.13"], ["HB", "110 (103,144)", "134 (122,150)", "0.08"]], "row_count": 16, "column_count": 4, "numeric_cells": 43, "header_rows": 1, "locator": "section[9]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:32631246:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ccd344ee90f58fe9f927a329abcb73517581f36863ba346793dea8956c88bd9c", "bytes": 715, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[2]#Tab2", "version": null, "note": "Primer sequences used for real-time PCR", "structure": {"pmcid": "PMC7336680", "section_index": 9, "section_title": "Confirmation by qRT-PCR", "row_count": 15, "column_count": 2}, "table": {"label": "Table 2", "caption": "Primer sequences used for real-time PCR", "rows": [["Primer name", "Sequence"], ["ACTB-F", "CATGTACGTTGCTATCCAGGC"], ["ACTB-R", "CTCCTTAATGTCACGCACGAT"], ["ATP1A1-F", "CTGTGGATTGGAGCGATTCTT"], ["ATP1A1-R", "TTACAACGGCTGATAGCACCA"], ["BCL2L1-F", "GAGCTGGTGGTTGACTTTCTC"], ["BCL2L1-R", "TCCATCTCCGATTCAGTCCCT"], ["FKBP5-F", "ACCAAACGGAAAGGAGAGGGA"], ["FKBP5-R", "TCTTCCCGCTGCATTTTCTCC"], ["RRS1-F", "GGCATCCGTCCCAAGAAGAAG"], ["RRS1-R", "TTCTTGGCCTGAATCCGCTTG"], ["PALLD-F", "AAGAAGGCCAGTAGAACTGCT"], ["PALLD-R", "AAGCGAAGTTTTCGTTCCAGG"], ["ECM2-F", "ACAAGCTCTATCACGTCCCG"], ["ECM2-R", "ACGGTCCATGCCATCATCAG"]], "row_count": 15, "column_count": 2, "numeric_cells": 0, "header_rows": 1, "locator": "section[9]/table-wrap[2]#Tab2"}}, {"id": "asset:table:pmid:32631246:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1ce7983f9a87dedd2954c4b9be3ceeaddcd4d38e87052a8c9171e43a57dafac7", "bytes": 644, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#Tab3", "version": null, "note": "Gene expression datasets used in this study", "structure": {"pmcid": "PMC7336680", "section_index": 11, "section_title": "DEGs in ICM", "row_count": 4, "column_count": 6}, "table": {"label": "Table 3", "caption": "Gene expression datasets used in this study", "rows": [["GEO accession", "Author", "Platform", "Samples (N:ICM)", "Year", "Tissue"], ["GSE46224", "Kai-Chien Yang [22]", "GPL11154Illumina HiSeq 2000 (Homo sapiens)", "8:8", "2014", "Left ventricle apex tissue"], ["GSE52601", "Akat KM [23]", "GPL10558Illumina HumanHT-12 V4.0 expression beadchip", "4:3", "2014", "left ventricular myocardium"], ["GSE5406", "Cappola TP [24]", "GPL96 [HG-U133A] Affymetrix Human Genome U133A Array", "16:108", "2006", "Left ventricular myocardium"]], "row_count": 4, "column_count": 6, "numeric_cells": 15, "header_rows": 1, "locator": "section[11]/table-wrap[1]#Tab3"}}, {"id": "asset:table:pmid:32631246:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:39b5e94aeb8362cb6264de5f094b1c7688f59623d2757f9d105df4fbba64e63c", "bytes": 1878, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[2]#Tab4", "version": null, "note": "The top 40 DEGs in ICM", "structure": {"pmcid": "PMC7336680", "section_index": 11, "section_title": "DEGs in ICM", "row_count": 41, "column_count": 5}, "table": {"label": "Table 4", "caption": "The top 40 DEGs in ICM", "rows": [["ID", "Symbol", "P.Value", "FDR", "Regulation"], ["3151", "HMGN2", "0", "0", "Up"], ["4060", "LUM", "0", "0", "Up"], ["54,829", "ASPN", "0", "0", "Up"], ["57,570", "TRMT5", "0", "0", "Up"], ["5654", "HTRA1", "0", "0", "Up"], ["25,878", "MXRA5", "0", "0", "Up"], ["392", "ARHGAP1", "1.55E-15", "1.30E-12", "Up"], ["2487", "FRZB", "3.19E-13", "2.08E-10", "Up"], ["51,466", "EVL", "3.92E-13", "2.30E-10", "Up"], ["4628", "MYH10", "1.08E-12", "5.29E-10", "Up"], ["10,947", "AP3M2", "1.27E-12", "5.98E-10", "Up"], ["3910", "LAMA4", "1.45E-12", "6.30E-10", "Up"], ["3043", "HBB", "1.56E-12", "6.54E-10", "Up"], ["1513", "CTSK", "4.13E-12", "1.56E-09", "Up"], ["1842", "ECM2", "1.09E-11", "3.86E-09", "Up"], ["4330", "MN1", "1.13E-11", "3.92E-09", "Up"], ["7060", "THBS4", "1.63E-11", "5.45E-09", "Up"], ["23,114", "NFASC", "3.06E-11", "9.22E-09", "Up"], ["57,758", "SCUBE2", "5.44E-11", "1.56E-08", "Up"], ["4878", "NPPA", "5.95E-11", "1.66E-08", "Up"], ["8547", "FCN3", "0", "0", "Down"], ["3163", "HMOX2", "0", "0", "Down"], ["12", "SERPINA3", "0", "0", "Down"], ["28,231", "SLCO4A1", "0", "0", "Down"], ["4140", "MARK3", "0", "0", "Down"], ["2289", "FKBP5", "4.44E-16", "4.01E-13", "Down"], ["84,525", "HOPX", "1.40E-13", "9.69E-11", "Down"], ["2752", "GLUL", "3.79E-13", "2.30E-10", "Down"], ["476", "ATP1A1", "4.67E-13", "2.45E-10", "Down"], ["262", "AMD1", "4.50E-13", "2.45E-10", "Down"], ["10,157", "AASS", "1.42E-12", "6.30E-10", "Down"], ["27,254", "CSDC2", "3.51E-12", "1.42E-09", "Down"], ["4624", "MYH6", "4.11E-12", "1.56E-09", "Down"], ["23,022", "PALLD", "6.10E-12", "2.24E-09", "Down"], ["9057", "SLC7A6", "2.05E-11", "6.68E-09", "Down"], ["9588", "PRDX6", "2.31E-11", "7.33E-09", "Down"], ["598", "BCL2L1", "2.91E-11", "9.00E-09", "Down"], ["5533", "PPP3CC", "3.50E-11", "1.03E-08", "Down"], ["5604", "MAP2K1", "7.18E-11", "1.92E-08", "Down"], ["23,212", "RRS1", "1.44E-10", "3.53E-08", "Down"]], "row_count": 41, "column_count": 5, "numeric_cells": 121, "header_rows": 1, "locator": "section[11]/table-wrap[2]#Tab4"}}], "gaps": ["asset:data:geo:GSE116250 not downloaded", "asset:data:geo:GSE116250 licence not read", "asset:data:geo:GSE46224 not downloaded", "asset:data:geo:GSE46224 licence not read", "asset:data:geo:GSE52601 not downloaded", "asset:data:geo:GSE52601 licence not read", "asset:data:geo:GSE5406 not downloaded", "asset:data:geo:GSE5406 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": null, "specific": null, "label": "MetaMA integration of three GEO datasets with Benjamini-Hochberg false discovery rate correction", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "MetaMA, an R package, is applied to combine data from three GEO datasets. The Benjamini & Hochberg (False discovery rate; FDR) were used to modulate the P-values."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE46224", "GSE52601", "GSE5406", "GSE116250"], "resolved_accessions": ["GSE46224", "GSE52601", "GSE5406", "GSE116250"], "statements": ["The datasets used and analysed during the current study are available from public database Gene Expression Omnibus repository. Accession numbers of the datasets used in current study are GSE46224, GSE52601, GSE5406 and GSE116250 in Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo)."], "basis": "The paper names GSE46224, GSE52601, GSE5406, GSE116250 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:32631246", "data:geo:GSE116250", "asset:table:pmid:32631246:1", "asset:table:pmid:32631246:2", "asset:table:pmid:32631246:3", "asset:table:pmid:32631246:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE116250"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:21:29Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 29033, "completion_tokens": 1863, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32631246", "type": "paper", "label": "pmid:32631246"}, {"id": "source:pmid:32631246", "type": "manuscript", "label": "PMID 32631246 full text"}, {"id": "data:geo:GSE116250", "type": "dataset", "label": "GEO GSE116250"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32631246", "type": "paper", "label": "pmid:32631246"}, {"id": "source:pmid:32631246", "type": "manuscript", "label": "PMID 32631246 full text"}, {"id": "data:geo:GSE116250", "type": "dataset", "label": "GEO GSE116250"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32631246", "type": "extraction", "used": ["source:pmid:32631246"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE116250", "type": "accession_resolution", "used": ["data:geo:GSE116250"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32631246", "parent_hash": "sha256:94f60d833f8a33d1b780a7b7a316fa9a89bdb96a75dd34b861a20e0f6b587d1c", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE116250 licence not read", "asset:data:geo:GSE116250 not downloaded", "asset:data:geo:GSE46224 licence not read", "asset:data:geo:GSE46224 not downloaded", "asset:data:geo:GSE52601 licence not read", "asset:data:geo:GSE52601 not downloaded", "asset:data:geo:GSE5406 licence not read", "asset:data:geo:GSE5406 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["Methods The analysis of microarray data The expression profile of ICM and healt"], "order_basis": "paper_text_order:1603", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}