Dipeptidyl peptidase like 6 promoter methylation is a potential prognostic biomarker for pancreatic ductal adenocarcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32701143", "kind": "science-record", "revision": 8, "content_hash": "sha256:4195eea45507f050ca330ad3516a8fe4ea032f2f6ca8dc932aca60f04c43aecd", "created_at": "2026-11-01T15:41:06Z", "updated_at": "2026-11-01T22:01:56Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Dipeptidyl peptidase like 6 promoter methylation is a potential prognostic biomarker for pancreatic ductal adenocarcinoma.", "doi": "10.1042/BSR20200214", "pmid": "32701143", "authors": ["Xin Zhao", "Di Cao", "Zhangyong Ren", "Zhe Liu", "Shaocheng Lv", "Jiqiao Zhu", "Lixin Li", "Ren Lang", "Qiang He"], "journal": "Bioscience reports", "year": 2020, "abstract": "BACKGROUND: Hypermethylation of gene promoters plays an important role in tumorigenesis. The present study aimed to identify and validate promoter methylation-driven genes (PMDGs) for pancreatic ductal adenocarcinoma (PDAC).\nMETHODS: Based on GSE49149 and the PDAC cohort of The Cancer Genome Atlas (TCGA), differential analyses of promoter methylation, correlation analysis, and Cox regression analysis were performed to identify PMDGs. The promoter methylation level was assessed by bisulfite sequencing polymerase chain reaction (BSP) in paired tumor and normal tissues of 72 PDAC patients. Kaplan-Meier survival analyses were performed to evaluate the clinical value of PMDGs.\nRESULTS: In GSE49149, the β-value of the dipeptidyl peptidase like 6 (DPP6) promoter was significantly higher in tumor compared with normal samples (0.50 vs. 0.24, P<0.001). In the PDAC cohort of TCGA, the methylation level of the DPP6 promoter was negatively correlated with mRNA expression (r = -0.54, P<0.001). In a multivariate Cox regression analysis, hypermethylation of the DPP6 promoter was an independent risk factor for PDAC (hazard ratio (HR) = 543.91, P=0.002). The results of BSP revealed that the number of methylated CG sites in the DPP6 promoter was greater in tumor samples than in normal samples (7.43 vs. 2.78, P<0.001). The methylation level of the DPP6 promoter was moderately effective at distinguishing tumor from normal samples (area under ROC curve (AUC) = 0.74, P<0.001). Hypermethylation of the DPP6 promoter was associated with poor overall (HR = 3.61, P<0.001) and disease-free (HR = 2.01, P=0.016) survivals for PDAC patients.\nCONCLUSION: These results indicate that DPP6 promoter methylation is a potential prognostic biomarker for PDAC.", "claims": [{"id": "claim-method", "statement": "To screen out survival-associated genes, we divided the patients into high-expressed and low-expressed groups according to the median value of mRNA expression and performed a Kaplan–Meier survival analysis (K–M survival analysis).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32701143", "locator": "sections[5] \"Identification of PMDGs\" paragraph 3", "quote": "To screen out survival-associated genes, we divided the patients into high-expressed and low-expressed groups according to the median value of mRNA expression and performed a Kaplan–Meier survival analysis (K–M survival analysis)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "In the derivation cohort, the DNA methylation profile (accession number: GSE49149) was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) [13,14].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32701143", "locator": "sections[3] \"DNA methylation datasets of the derivation cohort\" paragraph 2", "quote": "In the derivation cohort, the DNA methylation profile (accession number: GSE49149) was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) [13,14]."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32701143"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE49149"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:group_comparison_wilcoxon", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE49149"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:group_comparison_wilcoxon"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32701143", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1042/BSR20200214", "sha256": "sha256:10bbc30779e9e8e3283eb557eb9a781fa298b06d63d73a98f9c6fa9570b885af", "bytes": 27768, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1042/BSR20200214", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7396423", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE49149", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE49149", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE49149", "version": null, "note": "In the derivation cohort, the DNA methylation profile (accession number: GSE49149) was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) [13,14].", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "In the derivation cohort, the DNA methylation profile (accession number: GSE49149) was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) [13,14].", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1194354", "GSM1194355", "GSM1194356", "GSM1194357", "GSM1194358", "GSM1194359", "GSM1194360", "GSM1194361", "GSM1194362", "GSM1194363", "GSM1194364", "GSM1194365", "GSM1194366", "GSM1194367", "GSM1194368", "GSM1194369", "GSM1194370", "GSM1194371", "GSM1194372", "GSM1194373", "GSM1194374", "GSM1194375", "GSM1194376", "GSM1194377", "GSM1194378", "GSM1194379", "GSM1194380", "GSM1194381", "GSM1194382", "GSM1194383", "GSM1194384", "GSM1194385", "GSM1194386", "GSM1194387", "GSM1194388", "GSM1194389", "GSM1194390", "GSM1194391", "GSM1194392", "GSM1194393", "GSM1194394", "GSM1194395", "GSM1194396", "GSM1194397", "GSM1194398", "GSM1194399", "GSM1194400", "GSM1194401", "GSM1194402", "GSM1194403", "GSM1194404", "GSM1194405", "GSM1194406", "GSM1194407", "GSM1194408", "GSM1194410", "GSM1194411", "GSM1194412", "GSM1194413", "GSM1194414", "GSM1194415", "GSM1194416", "GSM1194417", "GSM1194418", "GSM1194419", "GSM1194420", "GSM1194421", "GSM1194422", "GSM1194423", "GSM1194424", "GSM1194425", "GSM1194426", "GSM1194427", "GSM1194428", "GSM1194429", "GSM1194430", "GSM1194431", "GSM1194432", "GSM1194433", "GSM1194434", "GSM1194435", "GSM1194436", "GSM1194437", "GSM1194438", "GSM1194439", "GSM1194440", "GSM1194441", "GSM1194442", "GSM1194443", "GSM1194444", "GSM1194445", "GSM1194446", "GSM1194447", "GSM1194448", "GSM1194449", "GSM1194450", "GSM1194451", "GSM1194452", "GSM1194453", "GSM1194454", "GSM1194455", "GSM1194456", "GSM1194457", "GSM1194458", "GSM1194459", "GSM1194461", "GSM1194463", "GSM1194464", "GSM1194465", "GSM1194466", "GSM1194467", "GSM1194468", "GSM1194469", "GSM1194470", "GSM1194471", "GSM1194472", "GSM1194473", "GSM1194474", "GSM1194475", "GSM1194476", "GSM1194479", "GSM1194480", "GSM1194481", "GSM1194482", "GSM1194483", "GSM1194484", "GSM1194485", "GSM1194486", "GSM1194487", "GSM1194488", "GSM1194489", "GSM1194490", "GSM1194491", "GSM1194492", "GSM1194493", "GSM1194494", "GSM1194495", "GSM1194496", "GSM1194497", "GSM1194498", "GSM1194499", "GSM1194500", "GSM1194501", "GSM1194502", "GSM1194503", "GSM1194504", "GSM1194505", "GSM1194506", "GSM1194507", "GSM1194508", "GSM1194509", "GSM1194510", "GSM1194511", "GSM1194512", "GSM1194513", "GSM1194514", "GSM1194515", "GSM1194516", "GSM1194517", "GSM1194518", "GSM1194519", "GSM1194520", "GSM1194521", "GSM1194522", "GSM1194523", "GSM1194524", "GSM1194525", "GSM1194526", "GSM1194527", "GSM1194528", "GSM1194529", "GSM1194530", "GSM1194531", "GSM1194532", "GSM1435224", "GSM1435225", "GSM1435226", "GSM1435227", "GSM1435228", "GSM1435229", "GSM1435230", "GSM1435231", "GSM1435232", "GSM1435233", "GSM1435234", "GSM1435235", "GSM1435236", "GSM1435237", "GSM1435238", "GSM1435239", "GSM1435240", "GSM1435241", "GSM1435242", "GSM1435243", "GSM1435244", "GSM1435245"], "sample_count": 196, "group_sizes": null, "group_sizes_basis": null, "platform": "13534", "taxon": "Homo sapiens", "title": "Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma (PDAC)", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32701143:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:115a5486f84e84ef25909000ba3c0ed8460072860ef45daa893d3575eef2d42d", "bytes": 623, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#T1", "version": null, "note": "The primer sequence of four PMDGs", "structure": {"pmcid": "PMC7396423", "section_index": 7, "section_title": "Bisulfite sequencing polymerase chain reaction", "row_count": 9, "column_count": 3}, "table": {"label": "Table 1", "caption": "The primer sequence of four PMDGs", "rows": [["Gene", "Primer sequence (5′–3′)", "Product size (bp)"], ["DPP6-F", "TTG(C/T)GTT(C/T)GTTTAATTTTGATGTAG", "512"], ["DPP6-R", "AAAAATCTTCCAAATCTTCAATT", ""], ["ZFP28-F", "TATTTTGGAGGATGGGAGGTT", "389"], ["ZFP28-R", "TAACCAAC(G/A)CTAAACCTAAATATAAC", ""], ["MTMR7-F", "GGGAAAAGTGT(C/T)GTTTGTAATAGTG", "411"], ["MTMR7-R", "CTAAAATTACC(G/A)AAAC(G/A)AAAACTACT", ""], ["HIST1H4E-F", "ATTTTATTTAGTTGTTAAAATATGTT", "373"], ["HIST1H4E-R", "AACTTAATAATACCCTAAATATTATCT", ""]], "row_count": 9, "column_count": 3, "numeric_cells": 7, "header_rows": 1, "locator": "section[7]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:32701143:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e9250a9e37ed59a693190692d3ff42ec39e6b5f4441c28abe2669345753a6a32", "bytes": 1739, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#T2", "version": null, "note": "Univariate and multivariate Cox regression analyses according to clinicopathological variables and seven PMDGs in the PDAC cohort of TCGA", "structure": {"pmcid": "PMC7396423", "section_index": 12, "section_title": "Identification of potential prognostic biomarkers among PMDGs", "row_count": 18, "column_count": 5}, "table": {"label": "Table 2", "caption": "Univariate and multivariate Cox regression analyses according to clinicopathological variables and seven PMDGs in the PDAC cohort of TCGA", "rows": [["Clinical parameters", "Univariate Cox regression analysis", "Multivariate Cox regression analysis"], ["", "HR (95% CI)", "P", "HR (95% CI)", "P"], ["Age", "1.03 (1.00–1.05)", "0.006", "1.01 (0.98–1.04)", "0.563"], ["Resection status (R0, R1)", "1.79 (1.17–2.74)", "0.007", "1.28 (0.80–2.00)", "0.304"], ["T stage (T1/T2, T3/T4)", "2.01 (1.07–3.82)", "0.031", "1.32 (0.64–2.70)", "0.455"], ["Lymph node invasion (no, yes)", "2.00 (1.19–3.37)", "0.009", "2.04 (1.11–3.80)", "0.023"], ["Histologic grade (Gx, G1, G2, G3, G4)", "1.46 (1.08–1.98)", "0.014", "1.41 (0.99–2.00)", "0.059"], ["Neoplasm recurrence (no, NA, yes)", "1.26 (1.01–1.58)", "0.042", "1.28 (0.99–1.70)", "0.057"], ["Molecular targeting drugs using (no, yes)", "0.58 (0.38–0.88)", "0.011", "0.76 (0.42–1.40)", "0.351"], ["Radiotherapy (no, NA, yes)", "0.72 (0.54–0.96)", "0.024", "0.70 (0.51–9.97)", "0.034"], ["Postoperative chemotherapy (no, yes)", "0.58 (0.37–0.89)", "0.013", "0.38 (0.20–0.71)", "0.003"], ["HIST1H4E", "14.11 (4.47–44.55)", "0.000", "5.92 (1.19–29.00)", "0.030"], ["DPP6", "6.77 (1.70–27.00)", "0.007", "543.91 (9.50–31000.00)", "0.002"], ["MTMR7", "5.66 (1.61–19.95)", "0.007", "4.00 (0.16–99.00)", "0.397"], ["LINGO3", "9.17 (1.83–45.89)", "0.007", "7.01 (0.79–62.00)", "0.08"], ["GRM6", "4.07 (1.15–14.49)", "0.030", "0.04 (0.00–1.40)", "0.073"], ["ZFP28", "3.09 (1.06–9.02)", "0.039", "1.04 (0.20–5.30)", "0.967"], ["RGS22", "3.48 (1.02–11.94)", "0.047", "0.05 (0.00–1.10)", "0.054"]], "row_count": 18, "column_count": 5, "numeric_cells": 68, "header_rows": 2, "locator": "section[12]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:32701143:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c24c7c76af6f1654b6c1d8898b7cc5d858b7bcb24bf5cdd7d73ab23097dcf165", "bytes": 1705, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T3", "version": null, "note": "Kaplan–Meier survival analyses for PDAC patients stratified with clinicopathological parameters, and the association between the methylation level of the DPP6 promoter and clinicopathological features", "structure": {"pmcid": "PMC7396423", "section_index": 14, "section_title": "Association of the methylation level of the DPP6 promoter with clinicopathological parameters of PDAC", "row_count": 29, "column_count": 7}, "table": {"label": "Table 3", "caption": "Kaplan–Meier survival analyses for PDAC patients stratified with clinicopathological parameters, and the association between the methylation level of the DPP6 promoter and clinicopathological features", "rows": [["Clinical parameters", "OS (30 months)", "Methylation of DPP6 promoter"], ["", "n", "HR (95% CI)", "P", "Low level (n=36)", "High level (n=36)", "P"], ["Age (years)", "", "", "0.599", "631", "611", "0.522"], ["≤62", "36", "1", "", "", "", ""], [">62", "36", "1.18 (0.63–2.21)", "", "", "", ""], ["Tumor size (cm)", "", "", "0.218", "3.341", "4.34", "0.021"], ["<4", "40", "1", "", "", "", ""], ["≥4", "32", "1.47 (0.78–2.76)", "", "", "", ""], ["Resection", "", "", "0.240", "", "", "0.003"], ["R0", "57", "1", "", "34", "23", ""], ["R1 and R2", "15", "1.71 (0.79–3.72)", "", "2", "13", ""], ["Invasion of reginal lymph node", "", "", "0.234", "", "", "<0.001"], ["Negative", "21", "1", "", "20", "1", ""], ["Postitive", "51", "1.57 (0.79–3.15)", "", "16", "35", ""], ["Vascular invasion", "", "", "0.243", "", "", "0.153"], ["Negative", "41", "1", "", "24", "17", ""], ["Postitive", "31", "1.44 (0.75–2.75)", "", "12", "19", ""], ["TNM stage", "", "", "0.022", "", "", "<0.001"], ["II", "38", "1", "", "35", "3", ""], ["III and IV", "34", "2.37 (1.26–4.47)", "", "1", "33", ""], ["T stage", "", "", "0.196", "", "", "0.020"], ["T1 and T2", "50", "1", "", "30", "20", ""], ["T3 and T4", "22", "1.51 (0.76–3.01)", "", "6", "16", ""], ["N stage", "", "", "0.001", "", "", "<0.001"], ["N0 and N1", "44", "1", "", "20", "1", ""], ["N2", "28", "2.63 (1.35–5.12)", "", "16", "35", ""], ["M stage", "", "", "0.575", "", "", "0.011"], ["Negative", "65", "1", "", "36", "29", ""], ["Postitive", "7", "1.30 (0.46–3.66)", "", "0", "7", ""]], "row_count": 29, "column_count": 7, "numeric_cells": 94, "header_rows": 2, "locator": "section[14]/table-wrap[1]#T3"}}], "gaps": ["asset:data:geo:GSE49149 not downloaded", "asset:data:geo:GSE49149 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "wilcoxon", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Wilcoxon"}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Cox regression"}}, {"id": "method-4", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "Limma"}}, {"id": "method-5", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson correlation"}}, {"id": "method-6", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.7, "band": "medium", "quote": "ROC curve"}}, {"id": "method-7", "family": null, "specific": null, "label": "Kaplan–Meier survival analysis", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "To screen out survival-associated genes, we divided the patients into high-expressed and low-expressed groups according to the median value of mRNA expression and performed a Kaplan–Meier survival analysis (K–M survival analysis)."}}], "targets": [], "gaps": ["method.reader_named_unmapped", "method.group_comparison_wilcoxon"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["group_comparison_wilcoxon"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: wilcoxon."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE49149"], "resolved_accessions": ["GSE49149"], "statements": ["In the derivation cohort, the DNA methylation profile (accession number: GSE49149) was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) [13,14]."], "basis": "The paper names GSE49149 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32701143", "data:geo:GSE49149", "asset:table:pmid:32701143:1", "asset:table:pmid:32701143:2", "asset:table:pmid:32701143:3"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "group_comparison_wilcoxon", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE49149"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:21:21Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 21584, "completion_tokens": 2474, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32701143", "type": "paper", "label": "pmid:32701143"}, {"id": "source:pmid:32701143", "type": "manuscript", "label": "PMID 32701143 full text"}, {"id": "data:geo:GSE49149", "type": "dataset", "label": "GEO GSE49149"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32701143", "type": "paper", "label": "pmid:32701143"}, {"id": "source:pmid:32701143", "type": "manuscript", "label": "PMID 32701143 full text"}, {"id": "data:geo:GSE49149", "type": "dataset", "label": "GEO GSE49149"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32701143", "type": "extraction", "used": ["source:pmid:32701143"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE49149", "type": "accession_resolution", "used": ["data:geo:GSE49149"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32701143", "parent_hash": "sha256:1ce5d02bd67834dc4ae32d64b91032da29952433404c49ab08434ef44fb0ff8e", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE49149 licence not read", "asset:data:geo:GSE49149 not downloaded", "execution.not_run", "method.group_comparison_wilcoxon", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:group_comparison_wilcoxon"], "assays": [{"role": "data_generation", "definition_id": "methylation_array", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["e promoter methylation level was assessed by bisulfite sequencing polymerase chain reaction (BSP) i"], "order_basis": "paper_text_order:563", "id": "assay:1"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Wilcoxon"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}