Circular RNA hsa_circ_0000073 contributes to osteosarcoma cell proliferation, migration, invasion and methotrexate resistance by sponging miR-145-5p and miR-151-3p and upregulating NRAS.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32706759", "kind": "science-record", "revision": 9, "content_hash": "sha256:0fc80719103e6c7e105fdc244257da62f487c6cc89bb31a0573ccb0cf4e45b7f", "created_at": "2026-11-01T15:41:06Z", "updated_at": "2026-11-01T22:45:07Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Circular RNA hsa_circ_0000073 contributes to osteosarcoma cell proliferation, migration, invasion and methotrexate resistance by sponging miR-145-5p and miR-151-3p and upregulating NRAS.", "doi": "10.18632/aging.103423", "pmid": "32706759", "authors": ["Xia Li", "Yi Liu", "Xiangxin Zhang", "Jun Shen", "Renjie Xu", "Yubo Liu", "Xiao Yu"], "journal": "Aging", "year": 2020, "abstract": "An increasing number of studies have demonstrated that circular RNAs (circRNAs), as promising therapeutic targets, are essential for diverse human diseases, especially cancer. However, the potential functions and complex mechanisms of most circRNAs in osteosarcoma (OS) are still not fully elucidated. In the present study, we obtained the expression profile of circRNAs from a GEO database (GSE96964) and identified hsa_circ_0000073 as a highly expressed candidate in OS. Overexpression of hsa_circ_0000073 accelerated the proliferation, migration, invasion and MTX resistance of OS cells, and knockdown of hsa_circ_0000073 resulted in the opposite effects. Mechanistically, hsa_circ_0000073 upregulated NRAS expression by targeting miR-145-5p and miR-151-3p in OS cells. In addition, the promotion of OS progression by hsa_circ_000007 was blocked by miR-145-5p and miR-151-3p-mediated NRAS inhibition. In conclusion, hsa_circ_0000073 facilitated the proliferation, migration, invasion and MTX resistance of OS cells through the inhibition of miR-145-5p and miR-151-3p-mediated downregulation of NRAS.", "claims": [{"id": "claim-method", "statement": "The results were calculated via t-test or one-way analysis of variance.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32706759", "locator": "sections[21] \"Statistical analysis\" paragraph 2", "quote": "The results were calculated via t-test or one-way analysis of variance."}], "state": "complete"}, {"id": "claim-data-access", "statement": "We preliminarily explored the circRNA expression profile of a publicly available OS dataset.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32706759", "locator": "sections[3] \"The circRNA hsa_circ_0000073 was identified in a screen because of its high expression in OS\" paragraph 2", "quote": "We preliminarily explored the circRNA expression profile of a publicly available OS dataset."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32706759"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE96964"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE96964"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32706759", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.18632/aging.103423", "sha256": "sha256:f8930441aa5468a565d3d1c8da6f89e3b0b684488273960e3aa00c6378b7aba5", "bytes": 31709, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.18632/aging.103423", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7425447", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE96964", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE96964", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE96964", "version": null, "note": "We preliminarily explored the circRNA expression profile of a publicly available OS dataset.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We preliminarily explored the circRNA expression profile of a publicly available OS dataset.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM2546888", "GSM2546889", "GSM2546890", "GSM2546891", "GSM2546892", "GSM2546893", "GSM2546894", "GSM2546895"], "sample_count": 8, "group_sizes": null, "group_sizes_basis": null, "platform": "19978", "taxon": "Homo sapiens", "title": "Microarray expression profile and functional analysis of circular RNAs in osteosarcoma", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32706759:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c211530bb23e8ae5b8026107593558cdf8754c0ab2e1950b4d7e452dc42fb8ef", "bytes": 754, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t1", "version": null, "note": "The sequences of primers in qRT-PCR assay.", "structure": {"pmcid": "PMC7425447", "section_index": 17, "section_title": "Agarose gel electrophoresis and qRT-PCR assays", "row_count": 13, "column_count": 2}, "table": {"label": "Table 1", "caption": "The sequences of primers in qRT-PCR assay.", "rows": [["ID", "Sequence (5’- 3’)"], ["GAPDH", "Forward: TGTTCGTCATGGGTGTGAAC"], ["GAPDH", "Reverse: ATGGCATGGACTGTGGTCAT"], ["U6", "Forward: CTTCGGCAGCACATATAC"], ["U6", "Reverse: GAACGCTTCACGAATTTGC"], ["Hsa_circ_0000073", "Forward: AGGCCGAAGCTGACAAAAT"], ["Hsa_circ_0000073", "Reverse: CAAACCAAGGAATAGCTTCCA"], ["NRAS", "Forward: ACAGTGCCATGAGAGACCAA"], ["NRAS", "Reverse: AATCCCGTAACTCTTGGCCA"], ["MiR-145-5p", "Forward: CAGGAATCCCTTAGATGCTA"], ["MiR-145-5p", "Reverse: CCATGACCTCAAGAACAGT"], ["MiR-151-3p", "Forward: GGATGCTAGACTGAAGCTCCT"], ["MiR-151-3p", "Reverse: CAGTGCGTGTCGTGGAGT"]], "row_count": 13, "column_count": 2, "numeric_cells": 7, "header_rows": 0, "locator": "section[17]/table-wrap[1]#t1"}}], "gaps": ["asset:data:geo:GSE96964 not downloaded", "asset:data:geo:GSE96964 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The results were calculated via t-test or one-way analysis of variance."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE96964"], "resolved_accessions": ["GSE96964"], "statements": ["We preliminarily explored the circRNA expression profile of a publicly available OS dataset."], "basis": "The paper names GSE96964 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:32706759", "data:geo:GSE96964", "asset:table:pmid:32706759:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE96964"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:21:16Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 28983, "completion_tokens": 784, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32706759", "type": "paper", "label": "pmid:32706759"}, {"id": "source:pmid:32706759", "type": "manuscript", "label": "PMID 32706759 full text"}, {"id": "data:geo:GSE96964", "type": "dataset", "label": "GEO GSE96964"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32706759", "type": "paper", "label": "pmid:32706759"}, {"id": "source:pmid:32706759", "type": "manuscript", "label": "PMID 32706759 full text"}, {"id": "data:geo:GSE96964", "type": "dataset", "label": "GEO GSE96964"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32706759", "type": "extraction", "used": ["source:pmid:32706759"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE96964", "type": "accession_resolution", "used": ["data:geo:GSE96964"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32706759", "parent_hash": "sha256:15575e1b755c20be20748e7a07df7cbc37665533636e89568b0971aec216a183", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE96964 licence not read", "asset:data:geo:GSE96964 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.85, "evidence": ["invasion and MTX resistance of OS cells, and knockdown of hsa_circ_0000073 resulted in the opposite"], "order_basis": "paper_text_order:737", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["addition, MG-63/MTX and U2OS/MTX cells were cultured in complete medium with 1 mg/mL MTX. Statistica", "ast cells (hFOB 1.19), OS cells (MG63, 143B, U2OS, and HOS) and HEK293 cells were all obtained", "9), OS cells (MG63, 143B, U2OS, and HOS) and HEK293 cells were all obtained from ATCC (Rockville", "te (MTX)-resistant cell lines (MG-63/MTX and U2OS/MTX) were formed by exposing MG63 and U2OS c"], "order_basis": "paper_text_order:1982", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The results were calculated via t-test or one-way analysis of variance."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}