Identifying hub genes of papillary thyroid carcinoma in the TCGA and GEO database using bioinformatics analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32714651", "kind": "science-record", "revision": 7, "content_hash": "sha256:0b3d800a707726e00c82de87514ec978ee06e8683feab793ea9a408bc5101afe", "created_at": "2026-11-01T15:41:06Z", "updated_at": "2026-11-01T22:01:57Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identifying hub genes of papillary thyroid carcinoma in the TCGA and GEO database using bioinformatics analysis.", "doi": "10.7717/peerj.9120", "pmid": "32714651", "authors": ["Ying Wan", "Xiaolian Zhang", "Huilin Leng", "Weihua Yin", "Wenxing Zeng", "Congling Zhang"], "journal": "PeerJ", "year": 2020, "abstract": "BACKGROUND: Thyroid carcinoma (THCA) is a common endocrine malignant tumor. Papillary carcinoma with low degree of malignancy and good prognosis is the most common. It can occur at any age, but it is more common in young adults. Although the mortality rate is decreased due to early diagnosis, the survival rate varies depending on the type of tumor. Therefore, the purpose of this study is to identify hub biomarkers and novel therapeutic targets for THCA.\nMETHODS: The GSE3467, GSE3678, GSE33630 and GSE53157 were obtained from the GEO database, including 100 thyroid tumors and 64 normal tissues to obtain the intersection of differentially expressed genes, and a protein-protein interaction network was constructed to obtain the HUB gene. The corresponding overall survival information from The Cancer Genome Atlas Project-THCA was then included in this research. The signature mechanism was studied by analyzing the gene ontology and the Kyoto Encyclopedia of Genes and Genome database.\nRESULTS: In this research, we identified eight candidate genes (FN1, CCND1, CDH2, CXCL12, MET, IRS1, DCN and FMOD) from the network. Also, expression verification and survival analysis of these candidate genes based on the TCGA database indicate the robustness of the above results. Finally, our hospital samples validated the expression levels of these genes.\nCONCLUSION: The research identified eight mRNA (four up-regulated and four down-regulated) which serve as signatures and could be a potential prognostic marker of THCA.", "claims": [{"id": "claim-method", "statement": "SurvExpress, a free online website, uses log-rank tests to draw Kaplan–Meier plots that contain the “Survival” package of R software.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32714651", "locator": "sections[6] \"TCGA database validation and survival analysis\" paragraph 2", "quote": "SurvExpress, a free online website, uses log-rank tests to draw Kaplan–Meier plots that contain the “Survival” package of R software."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32714651", "locator": "sections[28] \"Data Availability Statement\" paragraphs 1-4", "quote": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32714651"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33630"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33630"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32714651", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.7717/peerj.9120", "sha256": "sha256:ce5d0832057c7dbf2d964e9573f268ed45d5994fb72955f846c20cd4377ddf0a", "bytes": 27678, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.7717/peerj.9120", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7354839", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE33630", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE33630", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE33630", "version": null, "note": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM831749", "GSM831750", "GSM831751", "GSM831752", "GSM831753", "GSM831754", "GSM831755", "GSM831756", "GSM831757", "GSM831758", "GSM831759", "GSM831760", "GSM831761", "GSM831762", "GSM831763", "GSM831764", "GSM831765", "GSM831766", "GSM831767", "GSM831768", "GSM831769", "GSM831770", "GSM831771", "GSM831772", "GSM831773", "GSM831774", "GSM831775", "GSM831776", "GSM831777", "GSM831778", "GSM831779", "GSM831780", "GSM831781", "GSM831782", "GSM831783", "GSM831784", "GSM831785", "GSM831786", "GSM831787", "GSM831788", "GSM831789", "GSM831790", "GSM831791", "GSM831792", "GSM831793", "GSM831794", "GSM831795", "GSM831796", "GSM831797", "GSM831798", "GSM831799", "GSM831800", "GSM831801", "GSM831802", "GSM831803", "GSM831804", "GSM831805", "GSM831806", "GSM831807", "GSM831808", "GSM831809", "GSM831810", "GSM831811", "GSM831812", "GSM831813", "GSM831814", "GSM831815", "GSM831816", "GSM831817", "GSM831818", "GSM831819", "GSM831820", "GSM831821", "GSM831822", "GSM831823", "GSM831824", "GSM831825", "GSM831826", "GSM831827", "GSM831828", "GSM831829", "GSM831830", "GSM831831", "GSM831832", "GSM831833", "GSM831834", "GSM831835", "GSM831836", "GSM831837", "GSM831838", "GSM831839", "GSM831840", "GSM831841", "GSM831842", "GSM831843", "GSM831844", "GSM831845", "GSM831846", "GSM831847", "GSM831848", "GSM831849", "GSM831850", "GSM831851", "GSM831852", "GSM831853"], "sample_count": 105, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Normal thyrocytes vs papillary vs anaplastic thyroid carcinomas", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE3467", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE3467", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE3467", "version": null, "note": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM77362", "GSM77363", "GSM77364", "GSM77365", "GSM77366", "GSM77367", "GSM77368", "GSM77369", "GSM77370", "GSM77371", "GSM77372", "GSM77373", "GSM77374", "GSM77375", "GSM77376", "GSM77377", "GSM77378", "GSM77379"], "sample_count": 18, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "The role of micro-RNA genes in papillary thyroid carcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE3678", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE3678", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE3678", "version": null, "note": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM85215", "GSM85216", "GSM85217", "GSM85218", "GSM85219", "GSM85220", "GSM85221", "GSM85222", "GSM85223", "GSM85224", "GSM85225", "GSM85226", "GSM85227", "GSM85228"], "sample_count": 14, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "PTC versus paired normal thyroid tissue", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE53157", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE53157", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE53157", "version": null, "note": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1283115", "GSM1283116", "GSM1283117", "GSM1283118", "GSM1283119", "GSM1283120", "GSM1283121", "GSM1283122", "GSM1283123", "GSM1283124", "GSM1283125", "GSM1283126", "GSM1283127", "GSM1283128", "GSM1283129", "GSM1283130", "GSM1283131", "GSM1283132", "GSM1283133", "GSM1283134", "GSM1283135", "GSM1283136", "GSM1283137", "GSM1283138", "GSM1283139", "GSM1283140", "GSM1283141"], "sample_count": 27, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression profiling associated with the progression to poorly differentiated thyroid carcinomas", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32714651:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:65e9eb305bab4cdd5e0526bdeb2771d4ade1130cc662b25d9909330fc78ac9d4", "bytes": 720, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#table-1", "version": null, "note": "mRNA PCR primer.", "structure": {"pmcid": "PMC7354839", "section_index": 8, "section_title": "RNA extraction and qRT-PCR analysis", "row_count": 17, "column_count": 2}, "table": {"label": "Table 1", "caption": "mRNA PCR primer.", "rows": [["Gene name", "Primer sequence"], ["FN1", "F: CGGTGGCTGTCAGTCAAAG"], ["R: AAACCTCGGCTTCCTCCATAA"], ["CCND1", "F: GCTGCGAAGTGGAAACCATC"], ["R: CCTCCTTCTGCACACATTTGAA"], ["CDH2", "F: TCAGGCGTCTGTAGAGGCTT"], ["R: ATGCACATCCTTCGATAAGACTG"], ["CXCL12", "F: ATTCTCAACACTCCAAACTGTGC"], ["R: ACTTTAGCTTCGGGTCAATGC"], ["MET", "F: AGCAATGGGGAGTGTAAAGAGG"], ["R: CCCAGTCTTGTACTCAGCAAC"], ["IRS1", "F: ACAAACGCTTCTTCGTACTGC"], ["R: AGTCAGCCCGCTTGTTGATG"], ["DCN", "F: ATGAAGGCCACTATCATCCTCC"], ["R: GTCGCGGTCATCAGGAACTT"], ["FMOD", "F: GAGACCTACGAGCCTTACCC"], ["R: TTGAGGTTGCGATTGTCACAG"]], "row_count": 17, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[8]/table-wrap[1]#table-1"}}], "gaps": ["asset:data:geo:GSE33630 not downloaded", "asset:data:geo:GSE33630 licence not read", "asset:data:geo:GSE3467 not downloaded", "asset:data:geo:GSE3467 licence not read", "asset:data:geo:GSE3678 not downloaded", "asset:data:geo:GSE3678 licence not read", "asset:data:geo:GSE53157 not downloaded", "asset:data:geo:GSE53157 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "SurvExpress, a free online website, uses log-rank tests to draw Kaplan–Meier plots that contain the “Survival” package of R software."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["logrank_test"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: log_rank_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE3467", "GSE3678", "GSE33630", "GSE53157"], "resolved_accessions": ["GSE3467", "GSE3678", "GSE33630", "GSE53157"], "statements": ["The following information was supplied regarding data availability:\nData is available at NCBI GEO: GSE3467, GSE3678, GSE33630 and GSE53157 and from the TCGA database using search terms TCGA-THCA.\nPCR data is available as Supplemental File."], "basis": "The paper names GSE3467, GSE3678, GSE33630, GSE53157 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["logrank_test"], "assets": ["source:pmid:32714651", "data:geo:GSE33630", "asset:table:pmid:32714651:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE33630"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:21:29Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 23771, "completion_tokens": 1991, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32714651", "type": "paper", "label": "pmid:32714651"}, {"id": "source:pmid:32714651", "type": "manuscript", "label": "PMID 32714651 full text"}, {"id": "data:geo:GSE33630", "type": "dataset", "label": "GEO GSE33630"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32714651", "type": "paper", "label": "pmid:32714651"}, {"id": "source:pmid:32714651", "type": "manuscript", "label": "PMID 32714651 full text"}, {"id": "data:geo:GSE33630", "type": "dataset", "label": "GEO GSE33630"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32714651", "type": "extraction", "used": ["source:pmid:32714651"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE33630", "type": "accession_resolution", "used": ["data:geo:GSE33630"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32714651", "parent_hash": "sha256:483d806338121d421827b367be0b0f89ccaee81d35ac088ee9be60dc72d5d391", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE33630 licence not read", "asset:data:geo:GSE33630 not downloaded", "asset:data:geo:GSE3467 licence not read", "asset:data:geo:GSE3467 not downloaded", "asset:data:geo:GSE3678 licence not read", "asset:data:geo:GSE3678 not downloaded", "asset:data:geo:GSE53157 licence not read", "asset:data:geo:GSE53157 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["logrank_test"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["SurvExpress, a free online website, uses log-rank tests to draw Kaplan–Meier plots that contain the “Survival” package of R software."], "order_basis": "analysis_only", "id": "assay:1"}]}